ID: 1124877334

View in Genome Browser
Species Human (GRCh38)
Location 15:33607370-33607392
Sequence CAGGCCCACCTGAAGTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124877334_1124877335 -8 Left 1124877334 15:33607370-33607392 CCTGGGCACTTCAGGTGGGCCTG 0: 1
1: 0
2: 0
3: 21
4: 252
Right 1124877335 15:33607385-33607407 TGGGCCTGAGCCTCCAAACCAGG 0: 1
1: 0
2: 4
3: 177
4: 3121
1124877334_1124877336 -7 Left 1124877334 15:33607370-33607392 CCTGGGCACTTCAGGTGGGCCTG 0: 1
1: 0
2: 0
3: 21
4: 252
Right 1124877336 15:33607386-33607408 GGGCCTGAGCCTCCAAACCAGGG 0: 1
1: 0
2: 0
3: 22
4: 239
1124877334_1124877339 -2 Left 1124877334 15:33607370-33607392 CCTGGGCACTTCAGGTGGGCCTG 0: 1
1: 0
2: 0
3: 21
4: 252
Right 1124877339 15:33607391-33607413 TGAGCCTCCAAACCAGGGGACGG 0: 1
1: 0
2: 2
3: 20
4: 216
1124877334_1124877337 -6 Left 1124877334 15:33607370-33607392 CCTGGGCACTTCAGGTGGGCCTG 0: 1
1: 0
2: 0
3: 21
4: 252
Right 1124877337 15:33607387-33607409 GGCCTGAGCCTCCAAACCAGGGG 0: 1
1: 0
2: 1
3: 20
4: 561
1124877334_1124877343 17 Left 1124877334 15:33607370-33607392 CCTGGGCACTTCAGGTGGGCCTG 0: 1
1: 0
2: 0
3: 21
4: 252
Right 1124877343 15:33607410-33607432 ACGGTTTTTCCTCTTGAGACTGG 0: 1
1: 0
2: 0
3: 8
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124877334 Original CRISPR CAGGCCCACCTGAAGTGCCC AGG (reversed) Intronic
900121103 1:1049081-1049103 CCCGCCCACCTGAGCTGCCCCGG - Intronic
900319044 1:2073466-2073488 CAGGCCAACCTGCAGGACCCCGG + Intronic
900385039 1:2406661-2406683 CAGGTCCTTGTGAAGTGCCCAGG + Intronic
900799520 1:4728658-4728680 CAGGCACAACTGCAGAGCCCAGG + Intronic
901167625 1:7231165-7231187 CAGGCCCACGTCAAGGGGCCAGG - Intronic
901529323 1:9843473-9843495 CACCCCCCCCTGCAGTGCCCAGG - Intergenic
901758129 1:11453807-11453829 CAGGCCCACCTGGTGTACCGGGG + Intergenic
902056055 1:13601307-13601329 AAGGCCCAGCTTAAGTGGCCTGG - Intronic
902180495 1:14684803-14684825 CAGGCCCACCTGGATAACCCAGG + Intronic
903322299 1:22550461-22550483 CCGGCCCCCCTCAAGTCCCCAGG + Intergenic
903336388 1:22627320-22627342 CAGGCCCAGCTAACGTGCCAAGG + Intergenic
904602152 1:31679638-31679660 CAGGCCCCCCTGGAGTACCTGGG - Exonic
905097628 1:35487544-35487566 CAGGCAGACCTGTAGTGGCCAGG - Intronic
905105399 1:35560735-35560757 CAGCCCCACCAGGAGTGCCAGGG - Exonic
906323208 1:44829223-44829245 CAGGGCCACCAGCAGTACCCCGG + Exonic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
909971675 1:81998216-81998238 CAGGCCCACCTAGAGACCCCAGG + Intergenic
911127613 1:94355023-94355045 CATGCCCACCTGCAGGGACCAGG + Intergenic
911862992 1:102978734-102978756 CATCGCCACCTGAAGTGCCCTGG + Exonic
915041339 1:152970580-152970602 CAGGACCACACCAAGTGCCCAGG + Intergenic
915086397 1:153391765-153391787 CAGGCCCTTGTGAAGTGCCGAGG - Intergenic
915142039 1:153773858-153773880 CAGCCCCACGTGGTGTGCCCTGG + Exonic
915447462 1:155982077-155982099 CAGCCCCACCCGCAGTGCCAGGG - Intronic
915469288 1:156115949-156115971 CAGGCCCACCAAAAGAGCTCCGG + Intronic
921162944 1:212485940-212485962 CTAGCCTCCCTGAAGTGCCCAGG + Intergenic
922250544 1:223845706-223845728 CCGGCCGAGCTGAGGTGCCCCGG + Exonic
922413454 1:225397614-225397636 CAGGCACACCTGGAGTCACCTGG + Intronic
922740218 1:228010303-228010325 CAGGCCCACCTCTAGGGTCCTGG - Intronic
922919792 1:229292951-229292973 CAGTCACAACTGGAGTGCCCAGG + Intronic
1062856384 10:781454-781476 CATTCCCACCAGCAGTGCCCCGG - Intergenic
1062903483 10:1163222-1163244 CACACCCACGTGATGTGCCCTGG - Intergenic
1066642598 10:37571192-37571214 CATGCCCACCTGAATTTCCATGG - Intergenic
1067683685 10:48455175-48455197 CAGTCACCCCTGAAGTCCCCTGG - Intronic
1067713815 10:48671727-48671749 CGGCCCCACCTGCAGGGCCCGGG + Intergenic
1068261948 10:54594474-54594496 CAGGCCCCCTTGAGGTGCCTGGG - Intronic
1069797523 10:71062876-71062898 CCGGCCCCCCTGCAGTTCCCTGG + Intergenic
1069862453 10:71480169-71480191 ATGGCCCCCCTGAAGTGCCAGGG + Intronic
1069903207 10:71717639-71717661 CAGGGCCACCTGGAGAGCACTGG + Intronic
1070378543 10:75858156-75858178 CCAGCCCACCAGCAGTGCCCTGG + Intronic
1070698039 10:78577547-78577569 CAGCCCCACCCTCAGTGCCCAGG - Intergenic
1071503409 10:86219102-86219124 CACTCCCACCTGAACTGCCCAGG - Intronic
1073583663 10:104688918-104688940 CATGCCCATCTGAAGGGGCCAGG - Intronic
1076571208 10:131434381-131434403 CGGGCCGACCTGCAGAGCCCTGG - Intergenic
1076686352 10:132200065-132200087 CTGGCCCCGCTGGAGTGCCCGGG + Intronic
1077041967 11:528812-528834 CAGGCCCAGCTGACCTGCGCGGG + Intergenic
1077107687 11:849153-849175 CGGGCCCACCTGGAGCGCTCTGG + Intronic
1077144131 11:1037196-1037218 CAGCACCCCCTGAAGGGCCCTGG + Intergenic
1077216067 11:1395615-1395637 CACACACACCTGAGGTGCCCAGG - Intronic
1077250139 11:1557274-1557296 CAGGCCCTGCTGCAGTGCGCTGG + Exonic
1077474444 11:2779714-2779736 CAGGGCCTCCTGAAGTGCAATGG + Intronic
1078546274 11:12249300-12249322 CAGACCCACCTGCAGGGCTCTGG + Intronic
1079115166 11:17635863-17635885 CAGGCCCACCTGAAGAAGCTGGG + Intronic
1079545448 11:21627496-21627518 CAGCCCACCCTGAAGTACCCTGG - Intergenic
1080604347 11:33852575-33852597 CAGGCCCTGCAGCAGTGCCCAGG + Intergenic
1081765313 11:45606322-45606344 GATGCCCTCCTGAACTGCCCTGG - Intergenic
1083502974 11:63128479-63128501 CAGGCCCACCTGCAGTTATCCGG + Intronic
1083708068 11:64530251-64530273 CAGGCCAGTCTGCAGTGCCCTGG + Intergenic
1084606556 11:70175659-70175681 CCTGCCCACATGCAGTGCCCGGG - Intronic
1085055053 11:73398479-73398501 CCTGCCCACCTGAAAAGCCCTGG - Intergenic
1085471722 11:76762868-76762890 GAGGCCCATCTGCAGTGCTCTGG - Intergenic
1089132801 11:116225338-116225360 CAGGCCCAGCTGTAGTAGCCAGG + Intergenic
1089973309 11:122711598-122711620 AAGGCCAGGCTGAAGTGCCCGGG - Intronic
1090916752 11:131171317-131171339 CACGCTCGCCAGAAGTGCCCGGG + Intergenic
1096496105 12:52040343-52040365 CAGGCCCAACCTGAGTGCCCAGG - Intronic
1097141053 12:56902819-56902841 CAGTCCCTCCTAAAGTGCCTGGG - Intergenic
1100743517 12:97620725-97620747 AAGGCACACCTGCTGTGCCCTGG - Intergenic
1102720380 12:115010862-115010884 CAACCCCACCTGCAATGCCCTGG + Intergenic
1103447233 12:121002147-121002169 CTGGCCAAGCTGAGGTGCCCAGG + Exonic
1103901451 12:124305709-124305731 CAGGCCCACCTGGATGACCCAGG + Intronic
1104991244 12:132624975-132624997 CAGGTCTGCCTGAAGTGCCGCGG - Exonic
1105039245 12:132948872-132948894 CAGCCACACCTGCAGGGCCCAGG + Intronic
1114083286 14:19219642-19219664 CAGGGCCCCCTGAGCTGCCCGGG + Intergenic
1115176030 14:30562669-30562691 CAGGCCCACCCGCAGTTACCTGG + Intronic
1116774860 14:49167549-49167571 CAGGCCCGCCTCAAGTGCTGGGG + Intergenic
1117056016 14:51912594-51912616 CAGACAAACCAGAAGTGCCCAGG + Intronic
1118316006 14:64726556-64726578 CAGGCCCACCTGGAGCAGCCGGG - Intronic
1119421639 14:74510913-74510935 CAGGCCCTTCTGCAGTTCCCAGG - Intronic
1121454173 14:94027759-94027781 CAGTCCCAGCTCGAGTGCCCTGG - Intronic
1122717301 14:103703354-103703376 CAGGCCCGTCTGGAGTCCCCTGG - Intronic
1202894904 14_GL000194v1_random:1412-1434 CAGGGCCCCCTGAGCTGCCCTGG + Intergenic
1124141894 15:27084546-27084568 CAGGCTAGCCTGAAGTGCCCAGG - Intronic
1124512392 15:30338252-30338274 AAGGCTCACCTGATGTGCCAAGG + Intergenic
1124730522 15:32192499-32192521 AAGGCTCACCTGATGTGCCAAGG - Intergenic
1124877334 15:33607370-33607392 CAGGCCCACCTGAAGTGCCCAGG - Intronic
1125894833 15:43293655-43293677 CACGCCCACCTGCAGTCCCCTGG + Intronic
1128234950 15:66060923-66060945 CAAACCCACCTGCTGTGCCCAGG + Intronic
1129356604 15:74995999-74996021 CAGCCCCACCTGGCGTTCCCTGG + Intronic
1129769397 15:78193793-78193815 CAGGTCCACCAGAAGGCCCCAGG + Intronic
1129826506 15:78638222-78638244 CGAGCCCACCTGATGTGCCCGGG + Intronic
1131011018 15:89018484-89018506 CAGGCCCAACTGAAATTCCCAGG + Intergenic
1133129715 16:3669219-3669241 CAGGCGCACTCGAAGTGCACAGG + Intronic
1135766049 16:25178685-25178707 CAGGCCCACCTGGATAACCCAGG - Intergenic
1136271999 16:29153851-29153873 CAGGAATACCTGGAGTGCCCAGG - Intergenic
1136625439 16:31459218-31459240 CTGGCCCACCTGGAGGGCCCTGG + Exonic
1138451649 16:57096809-57096831 CTGGCCTGCCTGATGTGCCCTGG - Intronic
1138969624 16:62129225-62129247 GAGGTCCCCCTGAAGTGCCTGGG - Intergenic
1140376264 16:74447791-74447813 CAGGTCCCCCTGCAGTGCACTGG - Intergenic
1142075603 16:88115837-88115859 CAGGAATACCTGGAGTGCCCAGG - Intronic
1142108659 16:88319492-88319514 CAGGCCCTGCTGATGCGCCCGGG + Intergenic
1143545296 17:7591746-7591768 CAGGCCCAACTGACCTGCGCTGG - Exonic
1144635722 17:16907712-16907734 CAGACCCACCTGCAGAGCCCTGG + Intergenic
1146163879 17:30573640-30573662 CAGCCCCACCTCAAGGGCCATGG - Intergenic
1146287254 17:31582242-31582264 CAGGCCCAGCAGGAGTGCCTCGG - Intergenic
1146794484 17:35771780-35771802 GAGGCCCCCCAGAGGTGCCCTGG - Intronic
1147379985 17:40048911-40048933 CAGGACCTCCTGAAGGGCCATGG - Intronic
1148196278 17:45715679-45715701 AAGGCCCCACAGAAGTGCCCAGG - Intergenic
1151550350 17:74819135-74819157 CAGGCCCCTCGGAAGTACCCGGG - Intronic
1152154151 17:78622042-78622064 CAGCCCCCCCTGCAGTGACCAGG + Intergenic
1152426229 17:80220181-80220203 CACGCCCACCTGCGGTGGCCCGG - Intronic
1152593996 17:81229410-81229432 CAGGCTCAGCTGAGGTGCCCCGG + Exonic
1153378212 18:4405966-4405988 CAGGCTCAGCTCAAGAGCCCTGG + Intronic
1154052744 18:10976931-10976953 AGGTCCCACCTGAAGTGTCCAGG + Intronic
1154279658 18:12991349-12991371 CACGCGCACTTGCAGTGCCCTGG + Exonic
1156610222 18:38716532-38716554 CAGGCCCACCAGAAGGTCACTGG + Intergenic
1157121836 18:44918326-44918348 CAGGCTCAGCTGGAGTGACCTGG + Intronic
1157901980 18:51526717-51526739 CAGGACCACCTGCAGGCCCCTGG + Intergenic
1158333486 18:56389095-56389117 CAGGCTCACATCAAGTGCTCAGG + Intergenic
1159511452 18:69401498-69401520 CAGGCGCTCCTGGAGTCCCCAGG - Intronic
1160831574 19:1106998-1107020 CAGCCCCACCTGCTGTGCACAGG + Intergenic
1161780839 19:6290905-6290927 CAGTCTCTCCTGAAGTGGCCTGG - Intergenic
1162321563 19:9973791-9973813 CAGGCAGCCCTGGAGTGCCCTGG + Exonic
1163006084 19:14397495-14397517 GGGGCCCACCTGCTGTGCCCAGG + Intronic
1163061661 19:14765945-14765967 GGGGCCCACCTGCTGTGCCCAGG - Intronic
1165259002 19:34597269-34597291 CATGCCCACCTGAGGTTACCTGG + Intronic
1166049149 19:40247849-40247871 CAGGGACACAAGAAGTGCCCAGG + Intronic
1167215142 19:48159579-48159601 CAGGCCCACCTGGATAGTCCAGG - Intronic
1167695408 19:51012837-51012859 GAGGCCTTCCTGAATTGCCCAGG - Exonic
1167719599 19:51169290-51169312 CAGGCCCACCTGCAGTTATCTGG - Intergenic
1167919255 19:52769238-52769260 CAGGCCCACCTGCAGTTATCCGG + Intronic
1168444002 19:56396134-56396156 CAGGCCCACCTGCAGTTATCCGG - Intergenic
1202666495 1_KI270708v1_random:125472-125494 CAGGCCCACCTGCAGTTATCTGG + Intergenic
927676726 2:25111640-25111662 CAGGCCCACCTGGATTATCCAGG - Intronic
927679607 2:25131233-25131255 CAGTGCCAACTGCAGTGCCCGGG + Intronic
927874805 2:26648212-26648234 GAGCCCCATCTGAATTGCCCCGG + Intergenic
929205854 2:39291834-39291856 GTGGCCCACCTGAAGTGCAGTGG - Intronic
929417755 2:41761053-41761075 CAGGCCCAACCGAAGGCCCCTGG - Intergenic
932539656 2:72638949-72638971 CAGGGCAACCTCAGGTGCCCTGG + Intronic
932972947 2:76567834-76567856 CAGGCCCACAGGAAGTCCCAAGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
938499184 2:131821664-131821686 CAGGGCCCCCTGAGCTGCCCTGG + Intergenic
938679584 2:133676033-133676055 CAGGCTTACCTGAGATGCCCAGG - Intergenic
939110305 2:137998730-137998752 CAGGCCAACCTGAAATGTCAAGG + Intronic
939122955 2:138140390-138140412 CAGGCACACCTAAAGTGCTGAGG + Intergenic
942372874 2:175304799-175304821 CAGGCCAATCTCAAATGCCCTGG - Intergenic
945026430 2:205624116-205624138 CAGCACCAGCTGGAGTGCCCAGG + Intergenic
946253888 2:218429743-218429765 CAGGCCCACCCCAAGCCCCCTGG - Intronic
947499343 2:230660646-230660668 CAGGGCCACCTCCCGTGCCCTGG + Intergenic
948062943 2:235055192-235055214 CAGGCACACAGGAAGTGTCCTGG - Exonic
948723443 2:239918039-239918061 CAGGCCCACCTGGACAGCCCAGG - Intronic
948943566 2:241208171-241208193 CTGGCCCACCAGTAGTGCCAAGG - Intronic
949031618 2:241799836-241799858 CAGGGCCAGCAGAAGTGACCAGG - Intronic
1169074197 20:2751555-2751577 CAGGCCCAGCCCAAGTCCCCCGG - Intronic
1171522074 20:25783665-25783687 CAGGCCCACCACAGGAGCCCTGG + Intronic
1171529825 20:25845610-25845632 CAGGCCCACCACAGGAGCCCTGG + Intronic
1171554753 20:26072218-26072240 CAGGCCCACCACAGGAGCCCTGG - Intergenic
1172450863 20:35021665-35021687 CAGACCCCCAGGAAGTGCCCAGG + Intronic
1172693015 20:36803507-36803529 GAGGAGCACCTGAAATGCCCAGG + Intronic
1174929307 20:54795043-54795065 CAGGCACACATGAAGTGCTAAGG - Intergenic
1175239009 20:57533050-57533072 TAGGCCCACCTGAAGAATCCAGG - Intergenic
1175803526 20:61814343-61814365 CAGAGACACCTGAAGGGCCCTGG + Intronic
1176067891 20:63208771-63208793 CGGGCCCACCAGAGCTGCCCAGG + Intronic
1176199552 20:63854286-63854308 CAGGCACACCTGGAGTGCAGAGG + Intergenic
1176614607 21:9017399-9017421 CAGGGCCCCCTGAGCTGCCCTGG + Intergenic
1176655878 21:9588653-9588675 CAGGCCCACCACAGGAGCCCTGG + Intergenic
1176710609 21:10146475-10146497 CAGGGCCCCCTGAGCTGCCCTGG - Intergenic
1177997764 21:28122872-28122894 CAGGCCAACAAGAAGGGCCCAGG - Intergenic
1180005512 21:45018890-45018912 CAGCCCCACCCGCAGGGCCCCGG + Intergenic
1180294688 22:10873625-10873647 CAGGGCCCCCTGAGCTGCCCGGG - Intergenic
1180497494 22:15903039-15903061 CAGGGCCCCCTGAGCTGCCCGGG - Intergenic
1183045523 22:35216608-35216630 AAGTCCCAACTGAAGTGCCCAGG + Intergenic
1183392184 22:37552061-37552083 CAGGGCCACGTGAAGCCCCCAGG + Intergenic
1183465480 22:37978186-37978208 GAGGCCAACCTGGAGTGCTCTGG - Intronic
1184261528 22:43319981-43320003 CAGGTACACCTGTAGTTCCCCGG + Exonic
1184431004 22:44441570-44441592 CAGAGCCACCTGATGTGCCCTGG - Intergenic
1185116628 22:48941716-48941738 CAGCCCAGCCTGCAGTGCCCAGG - Intergenic
1185244453 22:49765735-49765757 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185244475 22:49765806-49765828 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185244497 22:49765877-49765899 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185244516 22:49765948-49765970 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185244540 22:49766019-49766041 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
949407188 3:3726708-3726730 AAGGCCCAGCAGGAGTGCCCTGG + Intronic
951704578 3:25530665-25530687 CAGGCCCACCTGGATTTTCCAGG + Intronic
953495901 3:43386789-43386811 CAGGACCACCTGTAGAGTCCAGG - Intronic
955392522 3:58531761-58531783 CAGGCCCAGCTGATCTGCTCAGG - Exonic
955549643 3:60070138-60070160 CAGGATCACCTGGAGTGCCCTGG + Intronic
961312878 3:126014987-126015009 CAGGCACTGCTGCAGTGCCCAGG + Intronic
961385523 3:126521419-126521441 CACACCCACCAGCAGTGCCCAGG - Intergenic
967967735 3:194975252-194975274 CAGCCCGACCTGAAGAGCTCTGG + Intergenic
968436167 4:590659-590681 CAGGCCCACCAGAGGAGCCCAGG + Intergenic
968896948 4:3409845-3409867 GAGGCCCAGCTGAGGGGCCCTGG - Intronic
968917406 4:3502582-3502604 CACGCCCACCCGTGGTGCCCTGG - Intergenic
969211781 4:5693360-5693382 CAGGCCCACCTGGATAGTCCAGG - Intronic
969312196 4:6360193-6360215 CAGGGCCACATGCAGAGCCCTGG + Intronic
969660688 4:8525748-8525770 CATGCTCCCCAGAAGTGCCCAGG - Intergenic
973108446 4:46370103-46370125 CAGAGCTACCTTAAGTGCCCTGG + Intronic
975344302 4:73276617-73276639 CAGCCCAGCCTGGAGTGCCCTGG + Intergenic
976850847 4:89542595-89542617 CAGGCCCACCTGAACAGACCTGG + Intergenic
985091099 4:186363404-186363426 CAGGCCCACCTGCAGTTATCTGG + Intergenic
985665258 5:1178785-1178807 CAGGCCCTCCTCCAGCGCCCAGG - Intergenic
986195275 5:5532520-5532542 CAGGCCCACCTCTACAGCCCTGG + Intergenic
989132213 5:38118650-38118672 CTGGCCCACCTGGGTTGCCCTGG + Intergenic
997206991 5:132055983-132056005 CGGGCCCAGCTGGAGAGCCCTGG - Intergenic
997210727 5:132075239-132075261 AAGGCCCAGAGGAAGTGCCCAGG + Intronic
997302857 5:132819188-132819210 CAGGCACACCTGAGGCACCCCGG - Intergenic
998404407 5:141866071-141866093 CATGCCCATCTGAAGGCCCCAGG + Intronic
999747553 5:154603990-154604012 CAGGCCCCTTTGAAGTCCCCAGG + Intergenic
1000145815 5:158452434-158452456 ATGGCCCATCTGAAGTCCCCTGG + Intergenic
1001099008 5:168798593-168798615 CAGCCCCTCCTGGAGTGCCAAGG + Intronic
1001288243 5:170438898-170438920 CAGGCCCACATGCAGTGTCCAGG - Intronic
1002516603 5:179763712-179763734 GGGGCCCAGGTGAAGTGCCCTGG - Intronic
1004306087 6:14502950-14502972 CAGGCCTCCCTGTACTGCCCTGG - Intergenic
1004504958 6:16239754-16239776 CAGGCCTAACTGCAGTGCCTGGG + Intronic
1005709504 6:28489940-28489962 CAGACGCACCTGAATTCCCCCGG - Intergenic
1006472357 6:34236101-34236123 CAGTCCCAACGGAAGGGCCCAGG + Intergenic
1008179683 6:48312959-48312981 CAGGCCCACCTGGAGAGTCCAGG - Intergenic
1013270631 6:108542598-108542620 AAGGAACACATGAAGTGCCCTGG + Intergenic
1016581604 6:145634397-145634419 CATGCCCACCTCAAGTGCCATGG + Intronic
1017886427 6:158603411-158603433 CTGGCCGACCTGAAGAGCTCAGG + Intronic
1018170737 6:161141175-161141197 CAGAGGCACCTGAACTGCCCAGG - Intronic
1019503503 7:1377637-1377659 CAGGCCCACCTGGGCAGCCCAGG + Intergenic
1019581447 7:1765558-1765580 CAGGCCCACCTGGAGAACACAGG - Intergenic
1021899029 7:25264602-25264624 CAAGCCCACCTTGACTGCCCTGG - Intergenic
1024118745 7:46216532-46216554 CAGGCTCAGCTGAGGTGCCTGGG + Intergenic
1025302155 7:57826570-57826592 CAGGCCCACCACAGGAGCCCTGG - Intergenic
1026614079 7:71886300-71886322 TAGGCTGGCCTGAAGTGCCCTGG + Intronic
1027149954 7:75726260-75726282 CAGTCCCACCTGCAGTGCCTGGG + Intronic
1029681648 7:102115621-102115643 CAGGCCTTCCTAAAGGGCCCTGG - Intronic
1030733222 7:113014298-113014320 CAGGCCCACCCCATGGGCCCAGG - Intergenic
1032839338 7:135701905-135701927 CAGGCCTGGCTGAGGTGCCCTGG - Intronic
1033345592 7:140523377-140523399 CAGGGCCACCTGAAGCTTCCGGG + Exonic
1034872681 7:154697495-154697517 CAGGGCCACCTGGAATGCCAAGG - Intronic
1035328923 7:158084018-158084040 GAGGCCCAGCGGAAGGGCCCAGG - Intronic
1036500058 8:9305496-9305518 CAGGCACACAGGAAGTCCCCAGG - Intergenic
1038695685 8:29804455-29804477 CGGGCCCACCTGCATTGCCTTGG - Intergenic
1040598859 8:48865036-48865058 CTGTCCCACCTGATCTGCCCAGG - Intergenic
1040946807 8:52893205-52893227 CAGGCCCAGCGGAACTGTCCTGG - Intergenic
1045524911 8:102933347-102933369 CAGTCCCAACTGAGGTCCCCTGG - Intronic
1046626819 8:116584174-116584196 CACTCCCAGCTGAAGGGCCCAGG + Intergenic
1047255149 8:123208469-123208491 CTGGCCCCACTGCAGTGCCCAGG + Exonic
1047944308 8:129859390-129859412 CAGGCCCACCTGCAGTTATCCGG - Intronic
1049159471 8:141087999-141088021 AGAGCCCACCTCAAGTGCCCGGG + Intergenic
1049799242 8:144510150-144510172 AAGGCCCAGCTGCAGAGCCCCGG - Intronic
1049804106 8:144531164-144531186 CAGGCACAGCTGAAGGGCACAGG + Intronic
1050717150 9:8542825-8542847 CAGACGCACCAGAAGTTCCCTGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053647589 9:40132171-40132193 CAGGGCCCCCTGAGCTGCCCTGG - Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053758142 9:41331672-41331694 CAGGGCCCCCTGAGCTGCCCTGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054536990 9:66243999-66244021 CAGGGCCCCCTGAGCTGCCCTGG + Intergenic
1057230310 9:93317722-93317744 CTGGCCCACCTGGCCTGCCCAGG - Intronic
1060505974 9:124198732-124198754 CCAGCCCAGCTGAGGTGCCCTGG - Intergenic
1060771532 9:126335567-126335589 CATGCCCACCTCTGGTGCCCCGG - Intronic
1060918282 9:127403921-127403943 CTGGCCCACCTGACCTGCCTGGG + Intronic
1061048615 9:128180916-128180938 CAGGCCCACCAGAGGTCCTCAGG - Intronic
1061152321 9:128835933-128835955 CAGGCCCACCTCACTTGCCAAGG + Intronic
1061242210 9:129381355-129381377 CAGCCCCTCCTGAAGTCCCCTGG - Intergenic
1061832472 9:133304558-133304580 CGGGCCCCCCTGCAGCGCCCTGG + Intergenic
1061894615 9:133640789-133640811 CAGGGCCACCTGCAGAGCCCTGG + Intronic
1202795369 9_KI270719v1_random:115463-115485 CAGGGCCCCCTGAGCTGCCCTGG - Intergenic
1203633595 Un_KI270750v1:92114-92136 CAGGCCCACCACAGGAGCCCTGG + Intergenic
1185653421 X:1665759-1665781 CAGGGACACCTGGAGTCCCCAGG - Intergenic
1193440660 X:81536333-81536355 CAGGCCCACATAAAGTCCCAAGG - Intergenic
1193593501 X:83419127-83419149 CAGGACAGCCTCAAGTGCCCTGG + Intergenic
1195803072 X:108734676-108734698 CGTGCCCACCTGCGGTGCCCTGG + Exonic
1196581988 X:117390746-117390768 CAGGCCCACCTGAGGTGGAAGGG + Intergenic
1199496443 X:148457638-148457660 AAGGCCCAGCTCAAATGCCCAGG + Intergenic
1199616438 X:149659656-149659678 CAGGTCCAGCTGTACTGCCCTGG + Intergenic
1199626203 X:149743592-149743614 CAGGTCCAGCTGTACTGCCCTGG - Intergenic
1201543787 Y:15138331-15138353 CAGGCCCACCTGCAGCTACCCGG + Intergenic