ID: 1124880657

View in Genome Browser
Species Human (GRCh38)
Location 15:33639639-33639661
Sequence CCCCAGTGGGAGCTGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 415}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124880651_1124880657 7 Left 1124880651 15:33639609-33639631 CCAGCATGTCAGCTTTGATTTCA 0: 1
1: 0
2: 1
3: 15
4: 209
Right 1124880657 15:33639639-33639661 CCCCAGTGGGAGCTGGGCCATGG 0: 1
1: 0
2: 3
3: 35
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124880657 Original CRISPR CCCCAGTGGGAGCTGGGCCA TGG Intronic
900155849 1:1202992-1203014 CCCCACTGGGAGCTGAGCTGGGG + Intergenic
900284578 1:1892942-1892964 CCCCTGTGGGGGCGGGGCCTCGG - Intergenic
900321527 1:2086679-2086701 GCCCGGTGGGCGGTGGGCCAGGG + Intronic
900339600 1:2181701-2181723 ACCCAGCTGGAGCTGGCCCAGGG - Intronic
900368928 1:2322933-2322955 CCTAAGTGAGAGCTGGCCCAGGG - Intronic
900374397 1:2346905-2346927 GGCTAGTGGGAGCTGGGCCGGGG - Intronic
900384890 1:2406002-2406024 TCCCAGTGGGGGCTGGGGCGGGG + Intronic
900568647 1:3347630-3347652 CCAAAGTGGGACCTGGGGCAGGG - Intronic
900639365 1:3681433-3681455 GGCCACTGGGAGCTGGGCCCAGG + Intronic
900953434 1:5872592-5872614 CCACAGTGAGACCCGGGCCACGG + Intronic
901041780 1:6368479-6368501 CCCAAGGTGGAGCTGGGCCTGGG - Intronic
901401064 1:9015285-9015307 GCACAGTGGTAGGTGGGCCAGGG - Intronic
901404501 1:9037424-9037446 CCCCAGTGGGAACTGTGCAAAGG - Exonic
902271499 1:15308358-15308380 CCCCAGTGGCAGCCAGGCCTGGG + Intronic
902332387 1:15736901-15736923 CCCCTGTGGGAGCTGGGTCATGG - Intronic
902409635 1:16205497-16205519 CCACAGTGAGGGCTGGGCGAGGG - Intronic
903218288 1:21855010-21855032 CCCCAGAGGCAGCTGGACAACGG + Intronic
904093087 1:27958777-27958799 CAGCAGCGGGAGCTGGGGCACGG - Exonic
904345115 1:29862855-29862877 AACCAATGGGAGCTGGGCCCAGG - Intergenic
904437497 1:30508171-30508193 CCCCAGTGTGAGAGGGACCAGGG - Intergenic
904443667 1:30550599-30550621 CCCAAGGCGGAGCTGGGCCTGGG + Intergenic
904485458 1:30822061-30822083 GGCCAGAAGGAGCTGGGCCAAGG - Intergenic
904829748 1:33299103-33299125 CCCCGGAGGGAGCTGGGGCCTGG - Exonic
905800398 1:40838953-40838975 CCCCACTTGGGGGTGGGCCAAGG + Exonic
906097806 1:43236031-43236053 CCCCGGAGGGTGCTGGGCCAGGG + Intronic
906521430 1:46469146-46469168 TCCAGGTGGGGGCTGGGCCATGG + Intergenic
907048221 1:51312985-51313007 CCCCAGAGGCAGCTGGTCCTGGG + Intronic
908092030 1:60696332-60696354 AACCAGTGGGAGCTGCCCCATGG - Intergenic
909782253 1:79561621-79561643 CCGCAGGGGGAGCTTGGGCATGG + Intergenic
912017563 1:105060723-105060745 CCCCAGTGGGATCTCTGCGAAGG + Intergenic
913287605 1:117241156-117241178 AGCCAGCAGGAGCTGGGCCAGGG - Intergenic
913330314 1:117661843-117661865 TCCCAGTGTGAGGTGGGCCCAGG + Intergenic
914905137 1:151737756-151737778 CCCCAGTGGGGACTGTGTCAGGG - Intergenic
915089861 1:153416809-153416831 CCCCAGTGGGACCTGAGCACAGG + Intronic
915093033 1:153439660-153439682 CCCCAGTGGGACCTGAGCACAGG - Intronic
915095647 1:153460340-153460362 CCCCAGTGGGACCTGAGCACAGG - Intronic
915454374 1:156029720-156029742 CCCAGGTGGGAGCTGGGGGAGGG + Intergenic
915592034 1:156876112-156876134 CTCAAGTGGGAGCTGGGGGAGGG + Exonic
915637098 1:157194956-157194978 CCCGAGGCGGAGCTGGGCCCAGG + Intergenic
915905160 1:159872064-159872086 TCTCAGTGGGGGCTGGGGCAAGG - Intronic
916051809 1:161041736-161041758 CGGCAGTGGGAGATGGGGCAGGG - Exonic
916057443 1:161077627-161077649 CCCCAGCGTGACCTGGGACACGG - Exonic
916075903 1:161199912-161199934 AGCTACTGGGAGCTGGGCCAGGG - Intronic
916174826 1:162029377-162029399 GCAGAGTGGGAGCTGTGCCAGGG + Intergenic
918038402 1:180897182-180897204 CAGCCGTGGGAGCTGGGCCCAGG - Intergenic
920821573 1:209386590-209386612 CCCCATTGGGAGCTGAGCCTTGG - Intergenic
922493132 1:226034707-226034729 CTCCAGATGGAGCTGAGCCACGG + Intergenic
922783683 1:228272687-228272709 CCTCTGTGGGTGCTGGGCCATGG + Intronic
923499325 1:234551268-234551290 CCCCTTTGGGACCTGGGCCTCGG - Intergenic
923790356 1:237106272-237106294 GCCCAGCGGGAGCTGGTGCAGGG - Intronic
1063129989 10:3169964-3169986 ACACAGCAGGAGCTGGGCCAGGG + Intronic
1069438547 10:68407335-68407357 CCCCAGGGGGAGCGGCGCCCCGG + Intergenic
1069566382 10:69466072-69466094 AGCCAGTGGGATCTGGGCCCTGG - Intronic
1069571436 10:69496687-69496709 CCCCACTGAGAGCTGGCACAAGG - Intronic
1069755147 10:70769948-70769970 CCCCAGTGGAAGAGGGGCGAGGG + Intergenic
1069822563 10:71236656-71236678 CTCCAGTGGGGGCTCGGGCAGGG - Intronic
1069905595 10:71730449-71730471 CACCTGTGGGAGCCGGGCCAGGG - Intronic
1070736162 10:78865228-78865250 CCCCAAAGGGAGCAGGGGCAGGG - Intergenic
1071524080 10:86348045-86348067 CCCCAGTGATAGGTGGTCCAGGG - Intronic
1071525034 10:86353648-86353670 CCCCAACTGGAGCTGGCCCAAGG - Intronic
1071770931 10:88728302-88728324 CGCCAGCCGCAGCTGGGCCAAGG + Intronic
1071976936 10:90964686-90964708 CCCCAGTGGTAGCTGAGCCGTGG - Intergenic
1072909509 10:99487315-99487337 CCCTGGGGGGAGCTGGGCGAAGG + Intergenic
1074776043 10:116769119-116769141 TCCTAGTGGTGGCTGGGCCAGGG - Intergenic
1075650616 10:124126377-124126399 ACACAATGGGTGCTGGGCCAAGG - Intergenic
1076023797 10:127095570-127095592 GCCCAGCAAGAGCTGGGCCATGG - Intronic
1076034657 10:127188982-127189004 CTCCACTGTGAGCTGGGTCAGGG + Intronic
1076133507 10:128029351-128029373 TCACAGTGGGTGCTGGGTCAGGG - Intronic
1076497434 10:130906110-130906132 TCCCGGTGGGAGCTGTGGCAGGG - Intergenic
1076525264 10:131108714-131108736 GCCCAGTGGGATCTGGGCTGAGG - Intronic
1076799211 10:132812871-132812893 GCCCAGTGGGAGCAGGCCCTGGG - Exonic
1076861813 10:133141401-133141423 CCCCTGTGGGAGGTGTGGCAGGG + Intergenic
1077183843 11:1227828-1227850 GTCCAGGGGGAGCTGGGCCGAGG + Intronic
1077514719 11:2994518-2994540 CCTCTGAGGGAGCTGGGCCTTGG + Intergenic
1077582918 11:3428595-3428617 TCCCAGTGGGATGTGGGACAGGG + Intergenic
1077917752 11:6622282-6622304 CCCCAGTGGGTGCAGGGCTCAGG + Exonic
1078085815 11:8232495-8232517 CCAGAGTGGGACCTGGACCAGGG + Intronic
1078105566 11:8356220-8356242 CCCCAGTGGGAACAGAGACAGGG + Intergenic
1078330694 11:10416978-10417000 ACCTAGGGGGATCTGGGCCAAGG - Intronic
1079312513 11:19379030-19379052 CCCCAGTGTGTGCAGGGGCAGGG + Intronic
1081713351 11:45232230-45232252 CCTCAGTGCCGGCTGGGCCAGGG - Intronic
1082784916 11:57311484-57311506 CTCCGGAGGGAGCAGGGCCAGGG - Intronic
1083620078 11:64044888-64044910 CCCCACTGTGTGCTGGGCCTGGG + Intronic
1083672574 11:64307293-64307315 AGCGAGTGGGAGCTGGACCAGGG - Exonic
1083805711 11:65072624-65072646 CTCCAGTGGGAGCTGGGGACAGG - Intronic
1083937360 11:65876922-65876944 ACCCAGTAAGGGCTGGGCCATGG - Intergenic
1084768997 11:71330524-71330546 ACCAAGTGGGAGCTGAGCCAAGG - Intergenic
1085201082 11:74702720-74702742 CCCCTGTGGGGTCTGGGGCACGG + Intronic
1085412364 11:76298778-76298800 CCCCAGAGAGAACTGGGACATGG - Intergenic
1085449830 11:76625138-76625160 CAGCAGCAGGAGCTGGGCCAGGG - Intergenic
1085520962 11:77138580-77138602 CCCCAGTGTGAACTTGGCCGCGG + Intronic
1087019870 11:93591263-93591285 CCCCACTGGGAAATGGGCAAAGG + Intergenic
1089051908 11:115552963-115552985 CACCAGTGGGTCCAGGGCCAAGG + Intergenic
1089103457 11:115983060-115983082 CCCCAGGGGGAGCAGGCCCGAGG + Intergenic
1089144674 11:116317123-116317145 CCTCAGTGGGAGATTGGGCATGG - Intergenic
1089460043 11:118647707-118647729 CCATAGTGGTAGCGGGGCCAGGG + Intronic
1089662379 11:119993930-119993952 CCCCTGTGGGGGCAGGGACAAGG + Intergenic
1090204129 11:124875553-124875575 GGCCACTGGGGGCTGGGCCAGGG - Exonic
1090381765 11:126332313-126332335 CTCCAGTTGGCGCTGGGCCTAGG - Intronic
1091602866 12:1928594-1928616 CCCCTGAGGGCGGTGGGCCAAGG - Intergenic
1091692912 12:2609311-2609333 TCCCAGTGGGAGCCGAGCTAGGG - Intronic
1091784673 12:3235960-3235982 CCCCAGCGGCAGCAGGTCCAGGG - Intronic
1091796647 12:3301126-3301148 CACCACTGGGAACTGGGGCAGGG - Intergenic
1091936739 12:4440834-4440856 CTACAGTGGCAGCTGAGCCAAGG + Intronic
1092243268 12:6848670-6848692 ACCCAGGGAGAGCAGGGCCAAGG + Intronic
1093404990 12:18793364-18793386 CCACAGTGGGAGATAGTCCAAGG - Intergenic
1093944112 12:25087664-25087686 CCCCAGTCGCTGCTGAGCCAGGG + Intronic
1095946007 12:47753758-47753780 CTCCAATGGGAGTTGGGGCAGGG - Intronic
1096425320 12:51496650-51496672 CCTCTGCTGGAGCTGGGCCATGG - Intronic
1096465496 12:51846159-51846181 GCCCACTGGGGGCAGGGCCAGGG + Intergenic
1096491522 12:52015401-52015423 CCACAGTGGGAGCTGGGGCAGGG + Exonic
1096705115 12:53415966-53415988 CACCAGTGGCAGCTGCCCCAGGG + Intronic
1097250040 12:57627558-57627580 CCCCACGGGGAGCTGGCGCACGG - Intronic
1097676009 12:62603175-62603197 CCCCGGTGGGGGCTGGGCTGCGG - Exonic
1101678551 12:106942366-106942388 CCCAACAGCGAGCTGGGCCAAGG + Intergenic
1102689962 12:114752702-114752724 CCCCAGGGGATGCTGGGGCAGGG + Intergenic
1103923008 12:124409262-124409284 GCCCTGAGGGAGGTGGGCCAGGG - Intronic
1103951554 12:124554319-124554341 CCAGACTGGGAGGTGGGCCATGG - Intronic
1103985081 12:124761583-124761605 CCCCAGTGGGGGTTGGGGGATGG + Intergenic
1104379977 12:128298794-128298816 CCCCAGTGGGGAGTGGACCAAGG + Intronic
1104757379 12:131277625-131277647 CCCCAGTGGGCGCTCTGCCTTGG + Intergenic
1104775667 12:131388849-131388871 CCCCAGTGGGCGCTCTGCCTTGG - Intergenic
1104802918 12:131566861-131566883 CTCCAGAGGGAGCTGGGCTCTGG + Intergenic
1104902540 12:132197226-132197248 CCCCATTGTGAGCCGGGCCACGG - Exonic
1107197153 13:37666334-37666356 CCCCACTGGGGACTGGGGCATGG + Intronic
1107519078 13:41161293-41161315 CCCAACAGGGAGCTGAGCCAAGG - Intergenic
1111211310 13:85083601-85083623 ACCCACTGTGATCTGGGCCAAGG - Intergenic
1113784837 13:112996989-112997011 CAGCTGTGGGAGCTGGGCCTAGG + Intronic
1114634577 14:24180075-24180097 CCTCAGTGGAATCTGGGCCCCGG - Exonic
1118868878 14:69725316-69725338 CAGAAGTGGGAGCTGGACCAGGG + Intergenic
1118905880 14:70022830-70022852 CCGCAGTGAGTGCTAGGCCAGGG + Intronic
1119168388 14:72514531-72514553 CCCCAGTGGTATCTGAGCCCAGG + Intronic
1119768628 14:77206278-77206300 CCCTAGTGAGAGCTGTGCCAGGG + Intronic
1121502385 14:94448505-94448527 CCCAAGAGAGAGCAGGGCCAGGG + Exonic
1121562908 14:94887670-94887692 GCTCAGTGGGAGCTGGGGGAGGG + Intergenic
1122059066 14:99124625-99124647 CCACAGTGGGGTCTGGGGCAGGG - Intergenic
1122078114 14:99248422-99248444 CCCCAGCAGGCTCTGGGCCAGGG + Intronic
1122128684 14:99592860-99592882 CCCCAGGAGGGGCTGGGCAAAGG + Intronic
1122398131 14:101449824-101449846 CCCCAATGGGGGCTGGGGTATGG - Intergenic
1122599178 14:102912750-102912772 CGCAAGTGTGAGCTGGGCCGGGG + Intergenic
1122859622 14:104576714-104576736 CCCCAGAGGGAGCTGGGCTCAGG + Intronic
1122859675 14:104576959-104576981 CCACAGAGGGAGCTGGGCTCAGG + Intronic
1122859692 14:104577057-104577079 CCACAGAGGGAGCTGGGCTCAGG + Intronic
1123055197 14:105566196-105566218 GCCCCAGGGGAGCTGGGCCAGGG - Intergenic
1123079646 14:105686040-105686062 GCCCCAGGGGAGCTGGGCCAGGG - Intergenic
1124620787 15:31272755-31272777 CACCTGTGGGGGCAGGGCCACGG - Intergenic
1124880657 15:33639639-33639661 CCCCAGTGGGAGCTGGGCCATGG + Intronic
1127854852 15:62945878-62945900 CCCCCATGTGAGCTGGGCAAAGG + Intergenic
1128108259 15:65059825-65059847 CCCCAGTGGGAGAAGAGACAAGG + Intronic
1128369470 15:67029897-67029919 CAGAAGTGGGATCTGGGCCAGGG + Intergenic
1128482870 15:68054690-68054712 CCCCATGGGGAGCTGGGGCTGGG + Intronic
1128799542 15:70489013-70489035 CCCCAGTGGCATCTGGTCTAGGG - Intergenic
1129814523 15:78540322-78540344 CCCTCGTGGGAGCTGGGTCGCGG - Intergenic
1130175285 15:81562592-81562614 CCCAAGTTTTAGCTGGGCCATGG + Intergenic
1130916200 15:88307062-88307084 CCCCAGAGGAAGCTGGACCCTGG + Intergenic
1132350711 15:101138228-101138250 GCCCAGTGGGAGCAGGGGCGAGG + Intergenic
1132415017 15:101613446-101613468 CACCAGTGACTGCTGGGCCAGGG - Intergenic
1132522193 16:397075-397097 CCCCCGTGAGCGCCGGGCCACGG + Intronic
1132686239 16:1163300-1163322 GCCCAGTTGGAGCAGGGCCTGGG + Intronic
1133155571 16:3872895-3872917 CCCCAGTGGGAGGCAGGCCCTGG - Intronic
1133309403 16:4834257-4834279 CTCTAGTTGGAGCTGTGCCAGGG - Intronic
1133338352 16:5021005-5021027 CTGCAGTGGGAGCTGGGGTAGGG + Intergenic
1133767764 16:8849710-8849732 CCACTGTGGGAACTGGGGCAGGG - Intergenic
1135406043 16:22198681-22198703 CCCTTGTGGTGGCTGGGCCACGG - Intergenic
1136186788 16:28593100-28593122 CTGCAGTGGGGCCTGGGCCAGGG + Intronic
1137624659 16:49900082-49900104 CCCCCGTGGGTGCGGGGCCCTGG - Intergenic
1138189237 16:55000639-55000661 CCCCAGTGAGCGATGGGCAAGGG - Intergenic
1138351112 16:56346733-56346755 TGCCAGTGGGAGCTGGGCTGTGG - Exonic
1138370951 16:56525921-56525943 GGCCACTGGGAGCTTGGCCAAGG - Intergenic
1138589901 16:57994005-57994027 CCTGAGTTGCAGCTGGGCCACGG + Intergenic
1139355808 16:66366569-66366591 TCCCAGGGGGAAGTGGGCCAGGG + Intergenic
1139467489 16:67161767-67161789 CCCCAGCCGGATCTGGGCCATGG + Exonic
1139596698 16:67962282-67962304 CCTCAGGCGGGGCTGGGCCAAGG + Intronic
1139706950 16:68747343-68747365 CTGCAGAGGCAGCTGGGCCAGGG + Intronic
1141317616 16:82977170-82977192 TCCCAGAGAGAGCAGGGCCAAGG - Intronic
1141624987 16:85256535-85256557 GCCCAGTGGGAGCTTCGCCAAGG - Intergenic
1141690350 16:85593225-85593247 CCACAGTGAGAGCTGGCCCGTGG - Intergenic
1141985240 16:87575571-87575593 CCGCAGTGGGATTTGGCCCAAGG - Intergenic
1142608423 17:1095102-1095124 CCTCAGTGGGGACTGCGCCAAGG - Intronic
1142670897 17:1486951-1486973 CCGCGGTGGGATCTGAGCCAAGG - Intronic
1142806288 17:2372780-2372802 TCCCACTGTGAGCTGGGGCACGG + Intronic
1144498302 17:15764345-15764367 CCCCAGAGGGACATAGGCCAAGG + Intergenic
1144752982 17:17662859-17662881 CTCCAGTGGGTGCTGGGAGAAGG - Intergenic
1144825025 17:18100961-18100983 CCCCAGGGAGAGCTGGGGAATGG + Intronic
1145013188 17:19381481-19381503 TCCCAGTGGGGACTGTGCCATGG + Exonic
1145018240 17:19412514-19412536 CCCAAGTTGGAGCTAGGCCTGGG + Exonic
1145246425 17:21272823-21272845 CCCCTGAGGGAGATTGGCCAAGG + Intergenic
1145249157 17:21288011-21288033 TCCCTTTGGGCGCTGGGCCATGG - Intronic
1145414451 17:22703460-22703482 CCCCAGTTGGTGCTGGGGGAAGG + Intergenic
1146147502 17:30433694-30433716 CCATAGTGGGAACTGAGCCAGGG - Intronic
1146637794 17:34518978-34519000 CCCCAGTGTGACCTGGGCCCAGG + Intergenic
1146903280 17:36601792-36601814 CCCTGGCGGGAGCTGCGCCATGG + Exonic
1148000409 17:44384316-44384338 CCCCACTTGGAGCTGGACCCTGG - Exonic
1148733429 17:49851377-49851399 CCCCCGCGGGAGCCGGGCCGGGG + Intergenic
1148740710 17:49890859-49890881 TCCCGCTGGGAGCGGGGCCAGGG + Intergenic
1148901755 17:50883923-50883945 CCCCAGTGGGTGCAGGGTGACGG - Intergenic
1149008656 17:51832127-51832149 CCCCAGTGCCACCTGGGCAAGGG + Intronic
1149050499 17:52298701-52298723 CACCAGTGGGAGGTAGGCAAAGG - Intergenic
1149782569 17:59409653-59409675 ACCCAGTGGAAGAGGGGCCATGG - Intergenic
1150283583 17:63943438-63943460 CCCCAGTGGCCCCTGGGGCAAGG - Intronic
1150322747 17:64230244-64230266 GCCCCGTGTGAGCTGGCCCATGG + Intronic
1151475282 17:74341664-74341686 CTCCAGTGGGACCTGGGCCCTGG + Intronic
1151772848 17:76176741-76176763 CCCGAGGCGGAGCTGGGCCTTGG + Intronic
1151872866 17:76848444-76848466 CCCCAGTGTGCGCTTGGCCAGGG - Intergenic
1152007583 17:77692066-77692088 GTCCAGTGGGAGCTGAGGCAGGG + Intergenic
1152378135 17:79929098-79929120 CTCCACTGGGAGCTGGGGCCAGG + Intergenic
1153022492 18:642738-642760 CACCAGTGGGAGCTGGTAAAAGG - Intronic
1153041041 18:812735-812757 CACTACTGAGAGCTGGGCCAAGG - Intergenic
1154311605 18:13271404-13271426 CCCCAGTGGGAATTGGGAAATGG - Intronic
1154414744 18:14170910-14170932 GCCCAGTCAGGGCTGGGCCAGGG + Intergenic
1154491454 18:14925336-14925358 CCCCAATGGGAAGTGTGCCAGGG - Intergenic
1156352419 18:36312392-36312414 GCCCAGAGAGAGCTGAGCCAGGG - Intronic
1157006564 18:43590257-43590279 CCCAAGGAGGAGCTGGGCCAGGG - Intergenic
1157501526 18:48194098-48194120 CAACAGTGGGGCCTGGGCCAAGG + Intronic
1158528057 18:58233166-58233188 CCCCAGTAGGGGATGGGGCAGGG - Intronic
1159697319 18:71575862-71575884 CCCCAGTGGGGGCTGTGTGAGGG + Intergenic
1159887150 18:73919706-73919728 CCCCAGTGGGAGCTGCTGGAAGG + Intergenic
1160363438 18:78304008-78304030 CTCCAGTGCCTGCTGGGCCATGG - Intergenic
1160537919 18:79604778-79604800 CCCCAGGGGAACCTGGGCCGTGG + Intergenic
1160792249 19:928167-928189 CCCGAGAGGCAGCTGGGCCCAGG - Intronic
1160875099 19:1293197-1293219 CCCAGGCGGGAGCTGGGCCTTGG + Intronic
1160952903 19:1676046-1676068 CCCCGAAGGGCGCTGGGCCAGGG + Intergenic
1161294721 19:3513813-3513835 CCCCAGTGTCCACTGGGCCAGGG + Intronic
1161574910 19:5049784-5049806 CCCTGCTGGGAGCTGGGACACGG - Intronic
1161719492 19:5895135-5895157 CCCCAGCTGGGGCTGGGGCAAGG + Intronic
1162096285 19:8311839-8311861 CCACAGTGGGTTCTGGGCCTGGG - Intronic
1162536780 19:11267277-11267299 CCCCTGTGGAAGCTGGGTCAAGG + Intergenic
1162796083 19:13088365-13088387 CCCCAGAGGGGCCTGGGCCAGGG - Intronic
1162833698 19:13302774-13302796 CTCCACTGGGAGCTGGGGCCGGG + Intronic
1163008257 19:14409586-14409608 CTCCACGAGGAGCTGGGCCAGGG + Exonic
1163325098 19:16598428-16598450 CCCAAGTGGGACCTGAGTCAAGG - Intronic
1163400030 19:17086452-17086474 CCCCAATACGAGCCGGGCCAAGG - Intronic
1163729193 19:18940073-18940095 CCACAGAGGCCGCTGGGCCAGGG - Intronic
1163977808 19:20868958-20868980 CCCCAGTGGGAGCCTGTTCAGGG + Intergenic
1164605636 19:29595969-29595991 CCTCTGTGGGAGGTGGACCAGGG + Intergenic
1164674131 19:30090637-30090659 CCCCAGGGTGTGCTGGGACACGG + Intergenic
1164675891 19:30101204-30101226 GCCCACTGAGAGCTGGGACAAGG + Intergenic
1165461355 19:35945908-35945930 CCCCAGGGGAAGCTGGGGCAGGG + Intergenic
1165928594 19:39342388-39342410 CCCCCGTCGGGGCGGGGCCAGGG + Intronic
1166305541 19:41935116-41935138 CCCAAGTGGGAGCAGAGACAGGG + Intergenic
1166359824 19:42248480-42248502 CTCCAGGGAGAGCTGGGCCGTGG + Exonic
1166562829 19:43744710-43744732 ACCCACTGGGAGCAGGGGCAAGG - Intronic
1167377013 19:49117791-49117813 TCCCAGTGGGGGCTGGACGAGGG + Intronic
1167404180 19:49293473-49293495 ACCCAGTGGTAGCCGGGCGAGGG + Intronic
1168120914 19:54252172-54252194 CCCTAGTGGGAACAGGGCAAGGG - Intronic
1168459093 19:56538892-56538914 GCCCAGTGGATGCCGGGCCATGG + Intergenic
1168643785 19:58047014-58047036 CTCCAGAGGCGGCTGGGCCAAGG + Intronic
1168655140 19:58122119-58122141 CCCAGGTGTGAGCTGTGCCAAGG - Intergenic
926310312 2:11670083-11670105 CCCGGGTTGGAGCTGGGCCGCGG + Exonic
926345139 2:11938021-11938043 CCCCAGTGGGACAGAGGCCATGG + Intergenic
926541099 2:14182546-14182568 CCCAAGGTGGAGCTGGGCCTGGG + Intergenic
927213341 2:20651741-20651763 CCCCAGCTGGAGCAGGGCAACGG + Intergenic
929608427 2:43251602-43251624 CCCGAGTGGGAGATGTGGCAGGG + Intronic
930754400 2:54960349-54960371 CTCCCCTGGGGGCTGGGCCAGGG + Intronic
932178084 2:69620991-69621013 CCACAGTGAGAGTTGGGCAAAGG - Intronic
932187615 2:69712428-69712450 CCCTATTAGGACCTGGGCCAAGG + Intronic
932337295 2:70938472-70938494 CCCCAGTGCTCGCTGGGCCACGG + Intronic
932435216 2:71699336-71699358 CCCCAGCTGGGGCTGGGGCATGG + Intergenic
932746155 2:74335285-74335307 CTCCAGTGGCAGCTCTGCCAAGG - Intronic
932752762 2:74381922-74381944 CCCCATTGAGAGGTTGGCCAGGG + Intronic
932931882 2:76050777-76050799 CCCCAGTTGGAGGTGGGGCCTGG + Intergenic
934777664 2:96949512-96949534 CCCCAGGAGGAGCTGGACCCAGG - Intronic
940337609 2:152545642-152545664 CCCCAGAGGCAGCTGAGCCCAGG - Intronic
941158989 2:162014022-162014044 AGCCAGTGGGAGCTGGGGTAAGG + Intronic
943447377 2:188004582-188004604 CCCCACTGGGAACTGGGATATGG + Intergenic
948334150 2:237194454-237194476 ACACAGTGGGAGCTGGCCCATGG - Intergenic
948377983 2:237534637-237534659 CCCCAGTGTTACCTTGGCCAAGG - Exonic
948712870 2:239836194-239836216 CCCGAGGTGGAGCTGGGCCCAGG + Intergenic
948717071 2:239871913-239871935 CCCCAGTGGGTGGGGGGTCAGGG + Intergenic
948813619 2:240498697-240498719 CCCCTGTGGGAGGTGGGGCCTGG + Intronic
948845906 2:240682742-240682764 GCCCACTGGGAGCAGGGCCTTGG + Exonic
948847952 2:240691987-240692009 GCCCACTGGGAGCAGGGCCTTGG - Exonic
948912603 2:241011930-241011952 CCCCGCTGGGGGCTGAGCCAGGG - Intronic
1169759486 20:9075681-9075703 CCCGAGTGGTAGCTGCTCCATGG - Intronic
1171012255 20:21515100-21515122 GCCCAGAGGCAGCAGGGCCAGGG - Intergenic
1171411253 20:24950169-24950191 CCCCAAAGGGAACTGGGCCATGG + Intronic
1171483185 20:25468822-25468844 CACCAGTGAGAGTTGGGACAGGG - Intronic
1171483315 20:25469265-25469287 CACCAGTGAGAGTTGGGACAGGG - Intronic
1171983628 20:31644504-31644526 GGACTGTGGGAGCTGGGCCAAGG - Intronic
1172147226 20:32764956-32764978 CCCCACTGGCAGCAGGTCCATGG - Intronic
1172436950 20:34935753-34935775 CCACAGTGGGAGCCTGGTCAGGG + Intronic
1172597247 20:36157831-36157853 CCACAGTGGGGACTGGGCTAAGG + Intronic
1172777406 20:37415542-37415564 CCCCTGTGGGTGCTGGGTCAGGG - Intergenic
1173841275 20:46158658-46158680 GTGCAGTGGGAGGTGGGCCAAGG + Intergenic
1174145665 20:48450868-48450890 CCACACTGGGAGCTGGGCTGTGG - Intergenic
1174773457 20:53322670-53322692 CCCCAGTGGCAGCTTGGGCTTGG - Intronic
1175220505 20:57414036-57414058 CTTGAGTGGGAGCTGGGCCTGGG + Intergenic
1175824790 20:61930997-61931019 CCGCAGTGGGGCCGGGGCCACGG + Intronic
1175865834 20:62175958-62175980 CCCCAGTGTGTGCTGGGCGCTGG + Intronic
1175929549 20:62487293-62487315 CCCCACTGAGAGCTGGGGGAGGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1175989940 20:62783610-62783632 GCCCAGGGGGAGCCGGGGCATGG - Intergenic
1176113248 20:63420146-63420168 CCCCAGTTGGAGGTGGGTCTCGG + Intronic
1176164209 20:63664389-63664411 CCCCGGTGGCTGCTGGGCCTGGG + Intronic
1176171206 20:63697187-63697209 CCCGGGTGAGAGCTGGGCGAGGG + Exonic
1176858276 21:13987344-13987366 GCCCAGTCAGGGCTGGGCCAGGG - Intergenic
1178526601 21:33334910-33334932 CTGCAGTGGGAGATGGGGCAGGG + Intronic
1178730063 21:35093663-35093685 CCCCAGATGGAGCAGGGACACGG - Intronic
1178915882 21:36705412-36705434 CCCCAGGGGGAGCTGGGGTAGGG - Intronic
1179106252 21:38403384-38403406 CCCCAGTGGGAACTGGGCGAGGG + Intronic
1179529638 21:42009925-42009947 CCCCAGGGGCAGCTCGGCCAGGG + Intronic
1179831590 21:44000449-44000471 CAGAGGTGGGAGCTGGGCCAGGG + Intergenic
1180074520 21:45455926-45455948 CCCCACTGAGAGCTTGGCCAGGG + Exonic
1180230593 21:46424693-46424715 GCGCAGTGGGAGCAGGGCCGGGG - Intronic
1181518488 22:23432022-23432044 ACCCAGTGGGAGGAGGACCAGGG + Intergenic
1181859175 22:25805096-25805118 CCCCACTGAGAGCTGGGCACAGG - Intronic
1184041442 22:41946528-41946550 CCCCAGGGGGTGCTGTGCCTAGG - Intronic
1184108445 22:42381892-42381914 CCTCCCTGGGAGCTGGGCCCAGG - Exonic
1184344958 22:43907529-43907551 CTCCTGTGGGGGCTGGCCCAGGG + Intergenic
1185179361 22:49350256-49350278 CCCCTGTGGGAGCTGGGCAGGGG + Intergenic
1185384010 22:50523359-50523381 CCCCACTCAGGGCTGGGCCATGG - Exonic
951269136 3:20603411-20603433 CCCCAGGGGGAAGTGGGGCAGGG + Intergenic
952284767 3:31957384-31957406 CCACAGTGGCAGCTGAGGCAAGG + Intronic
952331046 3:32364850-32364872 ACCCAGTGGCAGAGGGGCCAAGG - Intronic
953146456 3:40280558-40280580 CCCCAGTGAGGGAAGGGCCAAGG - Intergenic
953681293 3:45040215-45040237 CCTCGGTTGGAGCTGGCCCATGG + Intergenic
953766334 3:45746568-45746590 CCACAGGCGGAGCTGGGCCCGGG + Intergenic
954440307 3:50518157-50518179 CACCAGGATGAGCTGGGCCAGGG - Intergenic
958892557 3:99796646-99796668 CCCCAGTGGGAGGGGGCCCTGGG + Exonic
959312875 3:104763081-104763103 TCCCAGAGGGAGCTGAGCCTGGG - Intergenic
961299086 3:125910538-125910560 TCCCAGTGGGATGTGGGACAGGG - Intergenic
961535268 3:127566894-127566916 CCCGGGCTGGAGCTGGGCCATGG - Intergenic
962436734 3:135373905-135373927 CCCCACAGGGAGTTGTGCCATGG + Intergenic
962826563 3:139104871-139104893 CCCCTCTGGGAGCTGGGGCCTGG + Intronic
963804987 3:149714116-149714138 CCCAAGGCGGAGCTGGGCCTGGG + Intronic
966735408 3:183182899-183182921 GCCCTGTGGGAGCTGAGTCAGGG + Intronic
966767672 3:183477969-183477991 GCCCTGTGGGAGCTGAGTCAGGG - Intergenic
967329288 3:188274539-188274561 CCCCATTGGGAGGAGGGGCATGG + Intronic
968459782 4:718780-718802 CCACGGTAGGGGCTGGGCCATGG + Intronic
968552431 4:1230474-1230496 GCGCAGTGGGAGATGGGCCCTGG + Intronic
968620343 4:1601085-1601107 CCACTGTGGCAGCTGGGGCAGGG - Intergenic
968900120 4:3426996-3427018 ACCCAGGGAGACCTGGGCCATGG + Intronic
968981874 4:3854625-3854647 CCAGATTGGGAGCTGGGGCAGGG + Intergenic
969455102 4:7295994-7296016 GCCCTGTGGGAGCTGCGTCATGG + Intronic
969531620 4:7733846-7733868 CCCCAGTGGGAGCCAGGTCAAGG + Intronic
969618152 4:8265597-8265619 CTCCAGTGGGAGCTGGGGTGAGG - Intergenic
969717238 4:8873596-8873618 AGCCAGAGGGGGCTGGGCCAAGG + Intergenic
972872685 4:43319794-43319816 GCCCAGTGATAGCCGGGCCATGG + Intergenic
973975028 4:56254614-56254636 TGCCAGTGGGAAGTGGGCCAGGG - Intronic
976511975 4:85921709-85921731 CCACAGTAGGAGGTGAGCCAGGG + Intronic
979920519 4:126490341-126490363 CCCCAGTGGATCCTGTGCCAGGG - Intergenic
981348042 4:143698871-143698893 CCTCAGTGGGAGTTGGCCCCTGG - Exonic
982081293 4:151792977-151792999 CCCCGGTAGGAGCAGGCCCATGG + Intergenic
984268271 4:177520171-177520193 CACCAGTGGGACCTGGACCCCGG - Intergenic
985516163 5:345790-345812 CCCCAGGAGGAGCTGGGGCTGGG + Intronic
985521544 5:376145-376167 CCCCTTTGAGGGCTGGGCCAAGG - Intronic
985553210 5:543581-543603 GGCCAGAGGGAGCTGGGCTATGG + Intergenic
985559198 5:573984-574006 CCCCAGGGAGAGCCGGGCCTGGG + Intergenic
985599176 5:816916-816938 CCCCAGTGGGAGACTGGTCATGG + Intronic
985775780 5:1841076-1841098 CCTCAGTGGGAGTCGGCCCAGGG - Intergenic
986301845 5:6483717-6483739 TCAAAGTGGGAGCAGGGCCATGG + Intronic
986869400 5:12029343-12029365 ACCAAGTGGGAGCTGCACCATGG + Intergenic
990148361 5:52788215-52788237 CCCCAGTGGCAGCGGCGCCCAGG - Exonic
990898972 5:60729546-60729568 CCCTACTGGGAGGTGGGTCAGGG - Intergenic
997025973 5:130061719-130061741 CCCCACTGAAAGCTGGGCAAAGG + Intronic
997370164 5:133354496-133354518 CCTCAGTGAGACCTGGGCCTGGG - Intronic
1000329487 5:160195836-160195858 CCCCAGAGGGAGCTGCTGCATGG + Intronic
1000504375 5:162096650-162096672 ACCCAGTGGGAGGTGGTGCAAGG + Intronic
1001547700 5:172580616-172580638 ACCCAGTGAGAGCTTGGCAAAGG - Intergenic
1001558174 5:172650401-172650423 GCCACGTGGGAGCTGGGACAGGG - Intronic
1001673106 5:173490852-173490874 CCCCAGAGACAGCTGGGGCATGG + Intergenic
1002360586 5:178667610-178667632 TCCCAGTGGGATCTGGAACATGG - Intergenic
1002469942 5:179429124-179429146 CTGCACTGGCAGCTGGGCCAGGG + Intergenic
1002519853 5:179786367-179786389 TCCCACTGGGAGCTGGGCCTAGG - Intronic
1002939518 6:1703782-1703804 CACCAGTGGCCGCAGGGCCAAGG + Intronic
1006075779 6:31531346-31531368 CTCCACTAGTAGCTGGGCCAAGG + Exonic
1006255575 6:32829663-32829685 GCCCAGTGGGAGGAGGGCCATGG + Intronic
1006638956 6:35479265-35479287 CCCCAGTGGGAGTGGGGGAAAGG - Intronic
1007714917 6:43850382-43850404 CGCCAGTGGGACCTGGGTGAGGG - Intergenic
1007902633 6:45424304-45424326 ACCCAGTGTGCGCTGGGCCCTGG - Intronic
1008631039 6:53363385-53363407 CCCCAGTGGATCCTGTGCCAGGG + Intergenic
1010689985 6:78899031-78899053 CCCCCATGGGACCTGGGACAAGG - Exonic
1012052553 6:94362351-94362373 CCCGAGGCGGAGCTGGGCCCAGG - Intergenic
1014457222 6:121649811-121649833 CCTCAGTGAGAGCTGAACCAAGG + Intergenic
1015756220 6:136609349-136609371 CTGAGGTGGGAGCTGGGCCAGGG + Intronic
1018834629 6:167473642-167473664 CCCAGGTGGCAGCTGGGCCACGG + Intergenic
1019292150 7:256069-256091 CGGCAGAGGGAGCTGGGCCTGGG + Intronic
1019449590 7:1090444-1090466 CCCCACTCGCAGCAGGGCCAGGG + Intronic
1022482238 7:30751892-30751914 CCCTAGAGGCAGCAGGGCCAGGG + Intronic
1023982022 7:45075919-45075941 CACCAATGGGAACAGGGCCACGG + Exonic
1024395503 7:48862182-48862204 GCCCAGAGGCAGCTGAGCCAGGG + Intergenic
1024399728 7:48910094-48910116 GCCCAGAGGCAGCTGAGCCAGGG - Intergenic
1024532664 7:50406420-50406442 GACCAGTGGCAGCTGGGGCATGG - Intergenic
1025095401 7:56092164-56092186 CCCCAGTCAGAGCTGGGGCTGGG - Intronic
1025252098 7:57358557-57358579 CCCCAGTGTGGTCTGGGCAATGG - Intergenic
1026846288 7:73700682-73700704 CCCTAATGGGTGCTGGGGCATGG + Intronic
1028343237 7:89748160-89748182 TCCCAGTGAGAGCTGGATCATGG + Intergenic
1029495346 7:100893425-100893447 CCCCAATGGACCCTGGGCCACGG - Exonic
1030595148 7:111529134-111529156 CCCCAGAGGGACCTGTGACAAGG + Intronic
1031562560 7:123255894-123255916 CCCCAGTGGGGACTCGGCAATGG - Intergenic
1031987301 7:128171450-128171472 GCACAGTGGGGGCTGAGCCAAGG + Intergenic
1032398212 7:131605946-131605968 CCCCAGTGGGAGCAGCCCCTGGG + Intergenic
1033951920 7:146795528-146795550 TCCCTGTGGGATCTGAGCCAAGG - Intronic
1035173503 7:157033910-157033932 CCTCGGTGGGACCTGGGCCCAGG + Intergenic
1035434456 7:158849110-158849132 CCCAACAGGGAGCTGAGCCAAGG - Intergenic
1035680693 8:1485622-1485644 CCACAGTGGGAGCTGGGAGGGGG - Intergenic
1036652677 8:10655171-10655193 CCCCAGAGGGAGCTGGATTATGG + Intronic
1036798889 8:11775081-11775103 CCCCAGTGGGAACTCTGCCTTGG + Intronic
1037107581 8:15128391-15128413 CAGCAGTGGGAGCTGAGGCATGG - Intronic
1040375183 8:46817911-46817933 CCCCAGTGGAAGCAGGGTCCAGG - Intergenic
1040378161 8:46846426-46846448 CCCCAGTGGAAGCAGGGTCCAGG - Intergenic
1043002080 8:74771830-74771852 GCCCAGAGGGAGCTGGTCCCCGG + Intronic
1044409319 8:91867227-91867249 CCCAAGGTGGAGCTGGGCCTGGG + Intergenic
1046625511 8:116572681-116572703 CCCCAGTGCCAGGAGGGCCACGG - Intergenic
1049209409 8:141378649-141378671 TCCTGCTGGGAGCTGGGCCATGG + Intergenic
1049429162 8:142551200-142551222 CACCAGTGGCCGCTGAGCCAAGG + Intergenic
1049646726 8:143738944-143738966 ACCCGGTGGGAGCTAGGGCAGGG + Intergenic
1049737039 8:144214101-144214123 CCCTGGTGGGAGCTTGGCCCAGG - Intronic
1049767809 8:144363069-144363091 TCCCAGTAGGAACTGGGGCAGGG + Intergenic
1049790819 8:144472064-144472086 CCCCAGTGGGAGAGGCCCCAGGG + Intronic
1050367931 9:4889718-4889740 CTCCAGTGGGAGATGAGGCATGG - Intergenic
1052827373 9:33186911-33186933 ACAGAGTGGGAGGTGGGCCATGG - Intergenic
1053300553 9:36946235-36946257 GCTCAGGGGCAGCTGGGCCATGG - Intronic
1056850746 9:90081698-90081720 GCCCAGGAGGAGCTGGGGCAAGG - Intergenic
1057304118 9:93902644-93902666 CCCCAGTGGGAGGTGATGCAGGG - Intergenic
1057384562 9:94595599-94595621 CTGCAGTGGGAGCTGGGCGCTGG + Intergenic
1057548859 9:96037639-96037661 TCCAAGTGGGAGCAGGGCCAGGG + Intergenic
1057619031 9:96619141-96619163 GCCCGGTGGGAGGTGGGCCAGGG + Intronic
1057652750 9:96932217-96932239 CCCCAGGGAACGCTGGGCCATGG + Exonic
1057767574 9:97935500-97935522 CCCCAGTGTCAGCAGTGCCAAGG + Intronic
1060538795 9:124415293-124415315 CTCGGGTGGGAGCTGGGCCAAGG - Intronic
1061016656 9:127984888-127984910 TCCCAGTGGGAGATTGACCAGGG + Intergenic
1061245294 9:129398463-129398485 CCGCAGTGAGGGCTGGGCAAGGG + Intergenic
1062143493 9:134973878-134973900 CCTCAGTGGGTCCTGGGACAAGG + Intergenic
1062273808 9:135721404-135721426 CCCCAGGGCGAGAAGGGCCAGGG - Intronic
1062425042 9:136502220-136502242 CCCCGGTGGGAGGTGGGACCTGG - Intronic
1062443353 9:136583371-136583393 GCACCCTGGGAGCTGGGCCATGG + Intergenic
1062614614 9:137390776-137390798 CCCCACTGCCAGCTGGGCCTGGG + Intronic
1186880020 X:13855822-13855844 CCGCAGTGGAGGCTGTGCCATGG - Intronic
1188190956 X:27171298-27171320 ACCCAGTAGGAGCTGGTCTAGGG - Intergenic
1188588610 X:31806704-31806726 ACCCAGTGTGAGCAAGGCCATGG - Intronic
1189265888 X:39715876-39715898 TCCCAGTGGGAGGTGGGTAAAGG + Intergenic
1192201113 X:69067339-69067361 CTGCAGTGGCAGCGGGGCCAGGG - Intergenic
1192538806 X:71950663-71950685 CACAAGTGGGAGCAGAGCCATGG - Intergenic
1192727611 X:73768966-73768988 GCCCTGTGGGAGCCAGGCCATGG - Intergenic
1192795187 X:74420604-74420626 CACCAGTGGGGGCCGGGCCCAGG - Intergenic
1192808689 X:74531490-74531512 CCCCATTGGGGTCTGGGTCAGGG - Exonic
1193467917 X:81869392-81869414 CCCAAGGTGGAGCTGGGCCAGGG - Intergenic
1194523167 X:94943084-94943106 CCCCTATGGGTGCTGGCCCAGGG - Intergenic
1195148707 X:102043909-102043931 TCCCAGTGGGAGCTGTGTCCAGG - Intergenic
1195654744 X:107323897-107323919 CCCGAGGCGGAGCTGGGCCCAGG + Intergenic
1195996010 X:110732356-110732378 CCTCACTGGGGGTTGGGCCAAGG - Intronic
1196937475 X:120743862-120743884 CCTCAGTGGGAGCTGACCTAGGG - Intergenic
1199619116 X:149683501-149683523 CCCCAGGAGGAGCTGGCTCACGG - Intergenic
1199871291 X:151901125-151901147 CCCGAGTTGGAGCTGGAGCAAGG + Intergenic
1200093692 X:153647536-153647558 CCCCAGGGCCAGGTGGGCCAGGG - Intronic
1200121667 X:153794045-153794067 CCCCTGGGGGAGCCGGTCCAGGG + Exonic
1200224241 X:154408469-154408491 CCCCAGTGGTGGCAGGGGCATGG - Intronic
1200832483 Y:7700481-7700503 CCCCAGTTGGACCAGGGACAGGG + Intergenic
1200858495 Y:7964914-7964936 CCCCAGTGGAAGCAGGGTCCAGG + Intergenic
1201290791 Y:12420165-12420187 CCCCAGAGAGACCTGGGCGAGGG + Intergenic
1202260714 Y:22967426-22967448 CCCCAGTGGAAGCAGGGTCCAGG - Intergenic
1202413701 Y:24601167-24601189 CCCCAGTGGAAGCAGGGTCCAGG - Intergenic
1202457084 Y:25068919-25068941 CCCCAGTGGAAGCAGGGTCCAGG + Intergenic