ID: 1124881130

View in Genome Browser
Species Human (GRCh38)
Location 15:33643895-33643917
Sequence AGTGAGCCTAAAGAATGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124881130_1124881132 -10 Left 1124881130 15:33643895-33643917 CCAAGTCATTCTTTAGGCTCACT 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1124881132 15:33643908-33643930 TAGGCTCACTGCATTGTTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 186
1124881130_1124881134 12 Left 1124881130 15:33643895-33643917 CCAAGTCATTCTTTAGGCTCACT 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1124881134 15:33643930-33643952 GTAGTAGTTAAATTTTCCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 175
1124881130_1124881133 11 Left 1124881130 15:33643895-33643917 CCAAGTCATTCTTTAGGCTCACT 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1124881133 15:33643929-33643951 GGTAGTAGTTAAATTTTCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124881130 Original CRISPR AGTGAGCCTAAAGAATGACT TGG (reversed) Intronic