ID: 1124881132

View in Genome Browser
Species Human (GRCh38)
Location 15:33643908-33643930
Sequence TAGGCTCACTGCATTGTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124881128_1124881132 22 Left 1124881128 15:33643863-33643885 CCATCTTTTTGTTTTTGTGGCAG 0: 1
1: 0
2: 12
3: 209
4: 2157
Right 1124881132 15:33643908-33643930 TAGGCTCACTGCATTGTTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 186
1124881127_1124881132 23 Left 1124881127 15:33643862-33643884 CCCATCTTTTTGTTTTTGTGGCA 0: 1
1: 2
2: 16
3: 103
4: 1033
Right 1124881132 15:33643908-33643930 TAGGCTCACTGCATTGTTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 186
1124881130_1124881132 -10 Left 1124881130 15:33643895-33643917 CCAAGTCATTCTTTAGGCTCACT 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1124881132 15:33643908-33643930 TAGGCTCACTGCATTGTTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124881132 Original CRISPR TAGGCTCACTGCATTGTTTT GGG Intronic