ID: 1124881133 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:33643929-33643951 |
Sequence | GGTAGTAGTTAAATTTTCCC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 124 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 11, 4: 111} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1124881130_1124881133 | 11 | Left | 1124881130 | 15:33643895-33643917 | CCAAGTCATTCTTTAGGCTCACT | 0: 1 1: 0 2: 1 3: 15 4: 144 |
||
Right | 1124881133 | 15:33643929-33643951 | GGTAGTAGTTAAATTTTCCCAGG | 0: 1 1: 0 2: 1 3: 11 4: 111 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1124881133 | Original CRISPR | GGTAGTAGTTAAATTTTCCC AGG | Intronic | ||