ID: 1124881133

View in Genome Browser
Species Human (GRCh38)
Location 15:33643929-33643951
Sequence GGTAGTAGTTAAATTTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124881130_1124881133 11 Left 1124881130 15:33643895-33643917 CCAAGTCATTCTTTAGGCTCACT 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1124881133 15:33643929-33643951 GGTAGTAGTTAAATTTTCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124881133 Original CRISPR GGTAGTAGTTAAATTTTCCC AGG Intronic