ID: 1124881134

View in Genome Browser
Species Human (GRCh38)
Location 15:33643930-33643952
Sequence GTAGTAGTTAAATTTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124881130_1124881134 12 Left 1124881130 15:33643895-33643917 CCAAGTCATTCTTTAGGCTCACT 0: 1
1: 0
2: 1
3: 15
4: 144
Right 1124881134 15:33643930-33643952 GTAGTAGTTAAATTTTCCCAGGG 0: 1
1: 0
2: 2
3: 19
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124881134 Original CRISPR GTAGTAGTTAAATTTTCCCA GGG Intronic