ID: 1124882945

View in Genome Browser
Species Human (GRCh38)
Location 15:33659108-33659130
Sequence GCTGATGTGCAGTGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 371}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124882936_1124882945 18 Left 1124882936 15:33659067-33659089 CCATGTTGGTTGTCATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1124882945 15:33659108-33659130 GCTGATGTGCAGTGGGCAGAGGG 0: 1
1: 0
2: 3
3: 33
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124882945 Original CRISPR GCTGATGTGCAGTGGGCAGA GGG Intronic
900478062 1:2885324-2885346 GCTTTTCTGCACTGGGCAGATGG + Intergenic
901403195 1:9028570-9028592 GCTGGAGTGCAGTGGCCAGGAGG + Intergenic
901474244 1:9478634-9478656 GTGGCTGTGCAGGGGGCAGACGG - Intergenic
901757164 1:11448415-11448437 GCTGGTGTGTGGTGTGCAGAGGG + Intergenic
902078773 1:13806834-13806856 TCTGAGGTGATGTGGGCAGAGGG - Intronic
902841197 1:19075011-19075033 GCTGCTGTCCAGTGAGCAGCCGG - Intronic
902866916 1:19285788-19285810 GCTGCTATGCAGAGGGCACAGGG + Intronic
902928430 1:19713316-19713338 GCTCATGTGTAGTGGGCAACAGG + Intronic
903668190 1:25020815-25020837 GCTTCTGTGCAATGGGCAGCAGG - Intergenic
903711741 1:25331009-25331031 GCTGGAGTGCAGTGGCCCGATGG + Intronic
904407785 1:30304632-30304654 ACTGATTTCCAGTGGGAAGAAGG + Intergenic
904592665 1:31623707-31623729 GCTGATGGGCAGGTAGCAGAGGG - Exonic
905646799 1:39630489-39630511 GCAGCTGTACAGTGGACAGATGG - Intronic
905717082 1:40161381-40161403 GCTGGTGGGCCGTGGGAAGATGG + Exonic
906201896 1:43965928-43965950 GATGAAGTGAAGGGGGCAGATGG - Intronic
906363652 1:45186244-45186266 ACTGTTGTGCAGTGGGGGGAGGG + Intronic
907067730 1:51502215-51502237 GCTGGAGTGCAGTGGTGAGATGG - Intronic
907318610 1:53588668-53588690 GATGTTGGGCAGGGGGCAGAAGG + Intronic
908513896 1:64873060-64873082 CCTTATGTGCAGAGGTCAGAGGG - Intronic
908679794 1:66647998-66648020 TGTGATGTGGGGTGGGCAGAGGG + Intronic
912095258 1:106132873-106132895 GCTAGAGTGCAGTGGCCAGATGG + Intergenic
915147526 1:153803842-153803864 GCTGCTGTGCCTTGTGCAGAGGG - Intergenic
916244260 1:162671232-162671254 GCTGATGAGAAGTTGGCAGTAGG - Intronic
917236819 1:172901585-172901607 ACTGATGTGCAGGTGGCACATGG + Intergenic
918859600 1:189805648-189805670 GCTTCTGTTCAGTTGGCAGAGGG - Intergenic
918874820 1:190027069-190027091 ACTGTTGTGGGGTGGGCAGAGGG - Intergenic
919500293 1:198329901-198329923 GCTGATGTGAAGTGAGCAAAGGG - Intergenic
919893283 1:201991820-201991842 GCTGAAGTCCACTGGGCTGAAGG + Intronic
920084959 1:203408684-203408706 GCTGATGTGGGGAGGGAAGAAGG + Intergenic
921161064 1:212472440-212472462 GCTAATGTCCAGTAGGCAGAAGG - Intergenic
921892053 1:220363595-220363617 GCTTATGTGCCGTGGGCAGACGG + Intergenic
922437518 1:225620955-225620977 GCTGGAGTGCAGTGGTGAGATGG - Intronic
922702572 1:227770420-227770442 GACGCTGTGGAGTGGGCAGAGGG - Intronic
923087831 1:230714504-230714526 CCGGAGGTGCAGAGGGCAGAGGG + Intergenic
923280400 1:232437908-232437930 GGTCATGTGGAGTGGGAAGATGG + Intronic
924043668 1:240007996-240008018 GCTGATGAGCTGTGAGCAGAAGG + Intergenic
924155431 1:241170663-241170685 GCTGATGTGCAAAAGGCTGATGG + Intronic
924278216 1:242409687-242409709 GCTGATTTGCACTGGGCTCAGGG + Intronic
1063600920 10:7480571-7480593 CCTGATGGGCAGTGTTCAGACGG + Intergenic
1064943793 10:20765500-20765522 GCTGGAGTGCAGTGGTGAGATGG - Intergenic
1065489228 10:26265925-26265947 GCTGCAGGGCAGTGAGCAGAAGG - Intronic
1065786489 10:29220472-29220494 GCTGGAGAGCAGTGAGCAGAAGG - Intergenic
1066805720 10:39250689-39250711 ACTGTTGTGGAGTGGGAAGAGGG - Intergenic
1067179640 10:43974799-43974821 ACTGAGGTGCATGGGGCAGAGGG - Intergenic
1067216738 10:44310147-44310169 TGTGATGTGCAGTCCGCAGATGG + Intergenic
1067426507 10:46215359-46215381 ACTGATGTGGAGTGGGAGGAAGG - Intergenic
1070499135 10:77053981-77054003 GCGGCTGTGCAGTGGGCAGCAGG - Intronic
1070800278 10:79241288-79241310 GAGGATCTGCAGTGGGGAGATGG + Intronic
1071211427 10:83346059-83346081 GGTGATGTCCAGTAGGCAGCTGG - Intergenic
1071451079 10:85791887-85791909 GCTTTTGTGCAGGGGGCATAGGG + Intronic
1071472461 10:85993310-85993332 GCAGATGTGTAGTGGGGAGCAGG + Intronic
1071497006 10:86175534-86175556 GCAGTGGGGCAGTGGGCAGATGG - Intronic
1072606723 10:96990214-96990236 GCTGGAGTGCAATGGGCATATGG + Intergenic
1072627088 10:97119535-97119557 GCTGATGGGCCGTGAACAGAAGG + Intronic
1073267540 10:102236958-102236980 GCTGAACTGCAGTGTGCAAATGG + Intronic
1074494247 10:113965104-113965126 GCTGATGAGCTGTGGGGAGGTGG + Intergenic
1075484471 10:122811015-122811037 TTTGTAGTGCAGTGGGCAGAGGG - Intergenic
1075589305 10:123679896-123679918 GCTGCAGTGCAGTGGGCTGATGG - Intronic
1075980195 10:126731794-126731816 GCTGCTGTGCAATGAACAGATGG + Intergenic
1076180178 10:128401209-128401231 GCTGATGTTCTGGAGGCAGATGG + Intergenic
1076684405 10:132190804-132190826 GCTGATGTGCACGTGGAAGATGG + Exonic
1076849302 10:133085419-133085441 GCTGATGAACAGTGAGCAGAGGG + Intronic
1077088398 11:766211-766233 GTTGAGGGGCAGTGGCCAGATGG - Intergenic
1077445320 11:2588019-2588041 GGTGGTGAGCAGTGGGCAGGGGG + Intronic
1081470756 11:43368318-43368340 GGTGATGTTCAGTAGGCAGTTGG - Intronic
1081741558 11:45444619-45444641 GCCCATGATCAGTGGGCAGATGG - Intergenic
1081908859 11:46687228-46687250 TCTGAAGAGCAGTGGGAAGAGGG + Intronic
1082005986 11:47419230-47419252 GCTTATGCGGAATGGGCAGAGGG + Intronic
1082008907 11:47437565-47437587 GCTGACGTGCAGTGGGTGGGAGG - Intergenic
1082600114 11:55138679-55138701 ACTGTTGTGGAGTGGGGAGAGGG + Intergenic
1083656630 11:64232886-64232908 GGTGATGGGCAGAGGGCAGGAGG + Intronic
1084105471 11:66977472-66977494 GGTGTTGTCCAGTGGACAGAGGG + Intergenic
1084116276 11:67044771-67044793 GCTGCTGTGCTGTGGGCACCCGG + Intronic
1084143338 11:67249262-67249284 GCAGATGTGTTGTTGGCAGATGG + Intronic
1084942938 11:72623546-72623568 GAAGGTGTGCAGTGGGCAGCGGG - Intronic
1086203780 11:84234346-84234368 ACTGATGGGCAGAAGGCAGAAGG - Intronic
1087253835 11:95933784-95933806 ACTGTTGGGCAGGGGGCAGAGGG + Intergenic
1087785840 11:102353375-102353397 GCTGGAGTGCAGTGGCAAGATGG + Intronic
1088996971 11:115009219-115009241 GCAGATGTGCAGTTGGCAGGAGG - Intergenic
1089146276 11:116331617-116331639 GTTGATGCTCAGTGGGCAGTGGG - Intergenic
1090380796 11:126326319-126326341 GCTGACCTGCCGTGGGCAGATGG + Intronic
1090600152 11:128361769-128361791 GCTGATGAGAAGTGGGCGGAAGG + Intergenic
1092233137 12:6788963-6788985 GGAGATGTCCAATGGGCAGACGG + Intronic
1094187917 12:27664775-27664797 GGTGGTGGGCAGTGGGGAGAGGG + Intronic
1094521869 12:31199513-31199535 CCTGTCGTGCAGTGGGGAGAGGG - Intergenic
1095133509 12:38571221-38571243 GCTGCTGGGCAGTGGGGAAAGGG - Intergenic
1095638383 12:44457719-44457741 GCTGTCTTGCAGTGAGCAGAAGG + Intergenic
1095858391 12:46887206-46887228 GCTGAAGTGCAGAGGGCACAAGG + Intergenic
1096243192 12:49970301-49970323 GCTGTTGTGCAGTGGATAGGTGG + Intronic
1097270625 12:57771955-57771977 GCTAGTGAGGAGTGGGCAGAGGG - Exonic
1097741370 12:63246368-63246390 CCTGTTGTGGAGTGGGGAGAGGG + Intergenic
1098100205 12:67007141-67007163 GGTGATGGGCAGAGGGTAGAGGG + Intergenic
1098308966 12:69129195-69129217 GCTGTTGTGCAGTGAGCTGGAGG + Intergenic
1101807288 12:108075475-108075497 GCTGGAGTGCAGTGGCGAGAGGG + Intergenic
1102027176 12:109720204-109720226 GCTATTGTGCAGAGGGCACAGGG + Intronic
1102262965 12:111456205-111456227 GCTGCTGTGGACTGGCCAGATGG + Exonic
1102425786 12:112843448-112843470 GCTCATCTGCAGTCTGCAGATGG + Intronic
1102779164 12:115548672-115548694 GGAGATGGCCAGTGGGCAGATGG - Intergenic
1103919166 12:124390549-124390571 GCCGATGAGCAGTGGGACGAGGG - Intronic
1105204069 13:18205194-18205216 GATGGTGTGCAGTGGACACATGG + Intergenic
1105545716 13:21349217-21349239 GCAGATGTGCAGAGGGCAGTAGG - Intergenic
1105833109 13:24183190-24183212 GTTGAGGTGCATTTGGCAGAGGG + Intronic
1106044876 13:26129632-26129654 ACTGCTGTGTAGAGGGCAGAAGG - Intergenic
1106146466 13:27053849-27053871 GCACATGTTCAGTGGGGAGAAGG + Intergenic
1106480889 13:30136052-30136074 GCAGATGTGTAGTGGGCAGCTGG + Intergenic
1106928308 13:34635959-34635981 GCTGGTGTGCAGTGAGGAAAGGG + Intergenic
1107429839 13:40330451-40330473 GTTACTGTGCAGTGGGCATACGG + Intergenic
1107452376 13:40521493-40521515 GCTCAAGTGCAATGGGCTGACGG + Intergenic
1108169813 13:47729567-47729589 ACTGTTGTGGGGTGGGCAGAGGG - Intergenic
1109122002 13:58469562-58469584 GCTGATGTGCAGAGACCAGCTGG + Intergenic
1109880769 13:68471752-68471774 GCTGATTGGGAGTGAGCAGAAGG - Intergenic
1111647056 13:91044595-91044617 GATGCTTTACAGTGGGCAGATGG - Intergenic
1113298959 13:108995587-108995609 CCTGTTGTGGAGTGGGGAGAGGG - Intronic
1117619373 14:57568801-57568823 GAAAATGTGGAGTGGGCAGAGGG + Intronic
1118729701 14:68657781-68657803 GCTGATGAGCACAGAGCAGAAGG - Intronic
1119070453 14:71577777-71577799 GCTGGAGTGCAGTGGTCCGATGG + Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119348815 14:73947524-73947546 CCTGATGTGCACTGGGCATTTGG + Intronic
1120656325 14:87194338-87194360 GCTGATTTGCAAGGGACAGAGGG + Intergenic
1121372062 14:93368389-93368411 GATGATGGGGAGTGGGGAGAAGG + Intronic
1121594642 14:95151574-95151596 GCCGATGAGCACTGGGCATATGG - Intronic
1121660672 14:95632773-95632795 GCTGTAGAGCAGAGGGCAGAAGG + Intergenic
1122027696 14:98889471-98889493 GCTGGAGTGTAGAGGGCAGAGGG + Intergenic
1122598982 14:102912013-102912035 GCTGATGTGCAGGCGGCTGCAGG + Intergenic
1122614025 14:103004436-103004458 GCTGCTGTGCAGCTGGCAGAAGG + Intronic
1123017347 14:105381766-105381788 ACTGATGGGCAGTGGGAACATGG - Intronic
1123946709 15:25242337-25242359 GCTGTCCTGCATTGGGCAGAAGG - Intergenic
1124080191 15:26486981-26487003 GCTGAGGTGCAGCGAGAAGATGG + Intergenic
1124682078 15:31740408-31740430 GCTGCTGCTCAGTGAGCAGATGG + Intronic
1124882945 15:33659108-33659130 GCTGATGTGCAGTGGGCAGAGGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126220334 15:46205994-46206016 GCTGAAATCAAGTGGGCAGATGG + Intergenic
1127537150 15:59900642-59900664 GCTGGTGTGCAGTTGGCAAGTGG - Intergenic
1127760720 15:62136875-62136897 GCTGATGGGCAATGGGAAGCAGG + Intergenic
1128237703 15:66079080-66079102 TCTGAGGGGCAGTGGGCAGTGGG + Intronic
1128780861 15:70357699-70357721 GCTGATGTGCAGATGGGTGATGG + Intergenic
1129149173 15:73676921-73676943 GGTCAAGTGCAGGGGGCAGAAGG - Intergenic
1129320118 15:74770073-74770095 GCTAATGCCCACTGGGCAGATGG + Intergenic
1129426742 15:75468958-75468980 GCAGATGTCCAGTGAGCAGAAGG + Exonic
1130041342 15:80407248-80407270 GCTGTTGTGAAGTGGTCAGCTGG - Intronic
1130603613 15:85295434-85295456 GCTGATCTGCAGCAGGGAGAGGG - Intergenic
1130815378 15:87426579-87426601 GCTGATATGCAGATGGCAGAAGG - Intergenic
1131072114 15:89472559-89472581 CCTGAGGTGCAGTGGGCACATGG - Intronic
1131354283 15:91731034-91731056 GCTGTTGTGCTGAGGACAGAAGG + Intergenic
1131642531 15:94307763-94307785 GCTGATGGGCTGTGGGCAGAGGG + Intronic
1131800134 15:96059943-96059965 GAAGATGTGCAGTAGGAAGAAGG + Intergenic
1132554477 16:566493-566515 ACTGAGGTGCAGTGGACATATGG - Intergenic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135084327 16:19462848-19462870 GCTGGAGTGCAGTGGCCTGATGG - Intronic
1135247414 16:20868992-20869014 GCTGATGTGCAGAGGAGGGAGGG - Intronic
1135493997 16:22935787-22935809 GCTTATGTGCAGTAGGCTGCTGG - Intergenic
1135905164 16:26505369-26505391 GCTGTTTTGCAGATGGCAGAAGG - Intergenic
1137479438 16:48839587-48839609 GATGATTTGCACTGGGAAGAAGG + Intergenic
1138531009 16:57634368-57634390 GCAGAGGAGCAGTGGGCAGAGGG - Intronic
1138911969 16:61411883-61411905 GCTCATGTGCAGTGGTAAGGGGG - Intergenic
1139307568 16:66000399-66000421 CCTAATGGGCAGTGGGCAAAGGG + Intergenic
1139372055 16:66475099-66475121 GCTTATGTGAAGTGGGAAGCAGG + Intronic
1140949426 16:79802123-79802145 CCTGTGGTTCAGTGGGCAGATGG - Intergenic
1141829883 16:86504319-86504341 ACCTATCTGCAGTGGGCAGAGGG - Intergenic
1142507494 17:374179-374201 GCTGAAGTGCAGTGGGACAAGGG + Intronic
1142879617 17:2874255-2874277 GCAAATGTCCAGTTGGCAGAGGG - Intronic
1143099159 17:4495731-4495753 GAGGATGGGCAGAGGGCAGATGG + Intergenic
1144086178 17:11810651-11810673 GGTGATGTGCTGTGGAGAGAAGG + Intronic
1144707875 17:17381283-17381305 GCAGAGGGGCAGGGGGCAGACGG - Intergenic
1145102213 17:20086650-20086672 GCTGAAGTATAGTGAGCAGAGGG + Intronic
1145823995 17:27862789-27862811 GCTGAAGCACAGTGGGCAGTGGG + Intronic
1148464014 17:47853746-47853768 GCTGATGAGCTGCAGGCAGATGG - Intronic
1150846029 17:68659059-68659081 GCTTCTGTGGAGTGGGGAGAAGG - Intergenic
1151019918 17:70602968-70602990 GCTGGTGTGCAGTGGTGTGATGG - Intergenic
1151842041 17:76625830-76625852 GCTGAAGGGCAGTGAGCAGCAGG + Exonic
1152410112 17:80118845-80118867 GCCGTGGTGCAGGGGGCAGAAGG + Intergenic
1154226184 18:12506542-12506564 GCTGATATTCAATGGGCAAAGGG + Exonic
1155042143 18:22073655-22073677 GCAGATGTGCAATGGGGAGGAGG + Intergenic
1155243226 18:23883102-23883124 GCAGAAGTGCAGTGTGAAGAGGG + Intronic
1155416792 18:25606997-25607019 GCGGGGGTGCAGTGGGCACAAGG + Intergenic
1157423439 18:47564921-47564943 CCTGATGGGCAGAGGACAGAGGG + Intergenic
1158030688 18:52961134-52961156 CCTGTTGTGCGGTGGGGAGAGGG + Intronic
1158629097 18:59096467-59096489 CCAGAAGTGCAGTGGGCATATGG + Intergenic
1159800578 18:72894622-72894644 CCTGATGTGGGGTGGGCAGAGGG + Intergenic
1161171668 19:2815314-2815336 GCTGCTGGGCCGTGGGCGGATGG + Exonic
1161482173 19:4516734-4516756 GCTATTGTGCAATGGGCAGCCGG - Intronic
1161600478 19:5179412-5179434 GCTGATGTTCACTGCGCCGAGGG - Intronic
1162124331 19:8491083-8491105 GCTCAGGTGCCATGGGCAGAGGG - Exonic
1163616490 19:18331978-18332000 GCTGGAGTGCAGTGGCAAGATGG + Intergenic
1164924997 19:32123781-32123803 GGTGCTGTGCTGTGGGGAGATGG - Intergenic
1166133462 19:40761161-40761183 GATGATATACAGTTGGCAGAAGG + Intronic
1166966483 19:46532155-46532177 CCTGCTGTGCAGTGGGAAGTAGG - Intronic
1166991511 19:46695607-46695629 GCTTGTGTGCGGAGGGCAGATGG + Intronic
1167700707 19:51043499-51043521 GCGGCAGTGCAGTGAGCAGAAGG + Intergenic
925287476 2:2725380-2725402 GCTGATGTGGAAGGGGGAGAGGG - Intergenic
925452650 2:3983021-3983043 GCTGATGCACAGTGGGGAAATGG + Intergenic
927577628 2:24212653-24212675 TCTGATGAGCAGTGGGTAGCGGG + Exonic
927730348 2:25465574-25465596 GCTGAAGCGCGGTGAGCAGAGGG - Intronic
928342826 2:30460247-30460269 GCAGATGAACACTGGGCAGATGG - Intronic
930180530 2:48351323-48351345 GCTGGAGTGCAGTGGTGAGATGG + Intronic
930712501 2:54562216-54562238 GCTGATGTGAAGTGGAGAGATGG - Intronic
931709658 2:64977390-64977412 GCTAGAGTGCAGTGGGAAGATGG - Intergenic
931717091 2:65037822-65037844 GCTGAAGTGAGGTGGGCAAAGGG - Intergenic
932287516 2:70549401-70549423 GCTGATGGGGAAAGGGCAGAAGG - Intronic
933069187 2:77836332-77836354 GCTGAGGGGCATAGGGCAGAGGG - Intergenic
934662082 2:96148455-96148477 CCTGCTGTGCAGGGGGCTGATGG - Intergenic
934901769 2:98165526-98165548 ACAGAGGTGCAGAGGGCAGAGGG + Intronic
934912935 2:98275831-98275853 GCCAATTTGCAGTGGGTAGAAGG + Intronic
935126077 2:100223995-100224017 GCAGCTGTGAAGTGGGCAGTTGG - Intergenic
935317928 2:101855703-101855725 GCTGTGGTGCAGTGAGCAGTGGG + Intronic
935488612 2:103689180-103689202 GCTGTTGTGCGGTGGGGGGAGGG + Intergenic
935543043 2:104371961-104371983 GCTGATCAGCAGTGGGCTGTAGG - Intergenic
936077279 2:109409612-109409634 GCTGAAGTTATGTGGGCAGAAGG + Intronic
936711804 2:115140362-115140384 GCTGCAGGGCTGTGGGCAGAAGG + Intronic
941216593 2:162717463-162717485 GCTGAAGAGCAGTGAGCAGGAGG - Intronic
941616841 2:167730000-167730022 GCTGACCTGCAGTGCCCAGAAGG + Intergenic
941684282 2:168431828-168431850 GCTCATGTGCAGATTGCAGATGG + Intergenic
944373912 2:199017757-199017779 GCTGCTGTGCAAGGAGCAGAAGG + Intergenic
946173159 2:217907243-217907265 GGTGATGGGCTGTGGACAGAAGG + Exonic
947543286 2:230993036-230993058 GCTGATAAGCACTGGGCAGTGGG + Intergenic
947670653 2:231933600-231933622 GCAGCAGAGCAGTGGGCAGACGG + Intergenic
1169141189 20:3228230-3228252 GCGGGTGGGCAGTGGGCAGGAGG - Intronic
1169591066 20:7143146-7143168 GTTGATGAGCATTGAGCAGAGGG - Intergenic
1169980183 20:11375942-11375964 GGAGATGGGGAGTGGGCAGAGGG + Intergenic
1170119260 20:12894135-12894157 GCTGATATGCAGAGTGCTGAGGG - Intergenic
1171173385 20:23034642-23034664 GCTGAGGTGCTATGGGCACAAGG - Intergenic
1172597867 20:36162711-36162733 GCTGATGTGCAGTGGTGGGCTGG - Intronic
1172768080 20:37361622-37361644 GCTGATGTGCCTTGTGGAGATGG - Intronic
1175972230 20:62692326-62692348 CCTGCTCTGCAGTGGGCAGCTGG - Intergenic
1176235959 20:64053670-64053692 GCAGATGTGCTGTGGACAGTCGG + Intronic
1176712069 21:10159171-10159193 GCTGTTGTGGGGTGGGGAGAGGG + Intergenic
1176713905 21:10332885-10332907 GATGGTGTGCAGTGGACACATGG - Intergenic
1178291750 21:31374219-31374241 GCTGGTGTGCAGCGGGCAGGGGG + Intronic
1178815324 21:35924097-35924119 GCTGATGGCATGTGGGCAGAAGG + Intronic
1180070702 21:45434728-45434750 GCTGACTGGCAGTGGGGAGATGG + Intronic
1180115779 21:45704076-45704098 GCTGATGTCAAGAGGTCAGAAGG + Intronic
1180172171 21:46065241-46065263 GCTGATGCTCAGTGTGCTGATGG + Intergenic
1180758270 22:18178373-18178395 GCTGTTTTGCTGTGTGCAGATGG - Intergenic
1180768558 22:18362165-18362187 GCTGTTTTGCTGTGTGCAGATGG - Intergenic
1180777752 22:18500226-18500248 GCTGTTTTGCTGTGTGCAGATGG + Intergenic
1180788630 22:18561171-18561193 GCTGGAGTGCAGTGGCGAGATGG + Intergenic
1180810478 22:18757537-18757559 GCTGTTTTGCTGTGTGCAGATGG + Intergenic
1180826433 22:18865389-18865411 GCTGTTTTGCTGTGTGCAGATGG - Intergenic
1181196622 22:21191792-21191814 GCTGTTTTGCTGTGTGCAGATGG + Intergenic
1181212905 22:21301332-21301354 GCTGTTTTGCTGTGTGCAGATGG - Intergenic
1181233108 22:21434147-21434169 GCTGGAGTGCAGTGGCGAGATGG - Intronic
1181245543 22:21500696-21500718 GCTGGAGTGCAGTGGCGAGATGG + Intergenic
1181468330 22:23122717-23122739 GTGGATGGGCAGTGGGAAGATGG + Intronic
1182299896 22:29331471-29331493 GAGGATGTGCAGTGGGTACAAGG + Exonic
1182570604 22:31234804-31234826 GCTGAAGTGCAGGGAGCAGGAGG - Intronic
1183649987 22:39148271-39148293 GACGAGCTGCAGTGGGCAGATGG + Intronic
1183981297 22:41542031-41542053 GCTGGTGTGGCTTGGGCAGAGGG - Intronic
1184851555 22:47124258-47124280 GGTGATGTGCAGGGTTCAGAGGG + Intronic
1203230176 22_KI270731v1_random:103053-103075 GCTGTTTTGCTGTGTGCAGATGG - Intergenic
1203276576 22_KI270734v1_random:91295-91317 GCTGTTTTGCTGTGTGCAGATGG - Intergenic
950126612 3:10513721-10513743 GCGAATGTGCAGGGGGCTGAGGG + Intronic
950241247 3:11371833-11371855 GCAGATGTGCACTGGGAACAAGG - Intronic
950252264 3:11475594-11475616 GCTGATCTGCAGACTGCAGAGGG - Intronic
950875946 3:16273430-16273452 GCTGGAGTGCAGTGGGTACAGGG + Intronic
950988174 3:17399599-17399621 GCTGCTGTGCAGTGGGGCAAAGG - Intronic
951580695 3:24159776-24159798 ACTGGTGTCCAGTGGGAAGAGGG + Intronic
951586451 3:24220037-24220059 GCTGATGTGTAATAGGCAGCAGG + Intronic
952381233 3:32807044-32807066 GCTGGAGTGCAGTGGGCACTTGG + Intergenic
952979345 3:38722438-38722460 GGTGATGGCCAGTGGGCAAAGGG + Intronic
953409061 3:42678833-42678855 GCTCATGTGGAGTTGTCAGAGGG + Intergenic
954014071 3:47670534-47670556 GCTGGAGTGCAGTGGCCTGATGG - Intronic
954212035 3:49103376-49103398 GCTGTGCTGAAGTGGGCAGATGG - Exonic
954504995 3:51061555-51061577 CCTGATGTGGGGTGGGGAGAGGG + Intronic
955403996 3:58613807-58613829 ACTGATGGGCAGGAGGCAGAAGG + Intronic
955493100 3:59502717-59502739 GCTGCTGTGCAGTGGGAATATGG + Intergenic
958255891 3:91324468-91324490 TCTGATGTGCAAAGTGCAGAAGG + Intergenic
959693662 3:109226404-109226426 TCTGATGTGGAGTGGGAAGTAGG + Intergenic
959993859 3:112659295-112659317 ACTGTTGTGGGGTGGGCAGAGGG - Intergenic
961173348 3:124814946-124814968 GCTGATGGGGAGTGGGGAGCAGG - Intronic
961321208 3:126077877-126077899 TGTGATGTGCAGTGGGGACAGGG + Intronic
961491079 3:127257270-127257292 ACAGGTGTGCAGTGGGGAGAGGG - Intergenic
961726364 3:128933484-128933506 CCTGGTGTGCAGTGGGCATTGGG + Intronic
962846601 3:139279266-139279288 GCTGATGAGGATTGGGCAGTTGG + Intronic
965389618 3:168089434-168089456 GCTGATGTGCAGTGCTTAGAAGG - Intronic
965439220 3:168692045-168692067 TCTGATTGGCAGTGGGGAGAGGG + Intergenic
965661352 3:171045435-171045457 GCTGATTTGCAGGGTGCTGAGGG + Intergenic
966942823 3:184757718-184757740 CCTGAAGTGCAGTGGGGAGAGGG + Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967308395 3:188082252-188082274 GCAGATGTTCAGAGGTCAGATGG + Intergenic
969200391 4:5599564-5599586 ACTGATGTGGGGTGGGCAGAGGG + Intronic
969610181 4:8223318-8223340 GGCAAAGTGCAGTGGGCAGAGGG - Intronic
969621799 4:8282354-8282376 GCCTATGCCCAGTGGGCAGAAGG - Intronic
969675200 4:8610611-8610633 GCAGATGTGGCCTGGGCAGATGG + Intronic
970121181 4:12754125-12754147 ACTGTTGTGGGGTGGGCAGAGGG + Intergenic
970655704 4:18228270-18228292 GCTGGAGGCCAGTGGGCAGAGGG + Intergenic
971028008 4:22607553-22607575 GCAACTGTGCAGTTGGCAGAGGG + Intergenic
971201245 4:24511212-24511234 GCTGACGGGCAGTGGGCACAAGG - Intergenic
971867539 4:32191391-32191413 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
973138028 4:46731167-46731189 GCTGATGTGAAGTTGACACAGGG + Intergenic
975142397 4:70931776-70931798 GCTGGAGTGCAGTGGGGCGATGG + Intronic
975654992 4:76632577-76632599 GCTGAACTGCAGTGGGTTGAAGG + Intronic
977653846 4:99499208-99499230 GCAGATGTTCATTGAGCAGAAGG + Intergenic
978821737 4:112974562-112974584 GTTGATTTCCAGTGGGAAGATGG - Intronic
978997799 4:115177711-115177733 ACTGTTGTGCAGTGGGGGGAGGG + Intergenic
979818028 4:125134383-125134405 CCTGTTGTGGGGTGGGCAGAGGG + Intergenic
979881132 4:125961726-125961748 TCTGTTGGGCTGTGGGCAGATGG + Intergenic
981901479 4:149870204-149870226 GCAGATGTACAGAGGGAAGACGG - Intergenic
981964973 4:150589510-150589532 GCTAATGTACAGAGGGCAAAAGG - Intronic
982086507 4:151841618-151841640 GCTGGGCTGCAGTGGGGAGAGGG - Intergenic
982614370 4:157622360-157622382 GCTGTTGTGTTGTGGGCGGAGGG - Intergenic
983047878 4:163008337-163008359 GCAGTTGTGCAGTGCTCAGATGG + Intergenic
984630375 4:182054220-182054242 GGAGATGGGCAGTGGGCAGGAGG - Intergenic
984731759 4:183075113-183075135 GCTGGAGTGCAGTGGGCAATGGG - Intergenic
985718010 5:1473486-1473508 GATGACGTGCGGAGGGCAGAGGG + Intronic
985793050 5:1941791-1941813 GCTGATTTGCTTTGGGCAGAAGG + Intergenic
987342234 5:16949264-16949286 GCTGCTGTGCTCTGGGCACAGGG - Intergenic
990342287 5:54835296-54835318 GATGAAATGCAGTGGGCAGGAGG - Intergenic
990719832 5:58681966-58681988 GCTGATTTGCTGTGGGTCGAAGG + Intronic
991048237 5:62245262-62245284 ACTGATGGGCAGAAGGCAGAAGG - Intergenic
991544235 5:67763529-67763551 CCTGATGTGGAGTGGGGGGAGGG + Intergenic
993592491 5:89811532-89811554 ACTGTTGTGCAGTGGGGGGAGGG - Intergenic
994134394 5:96268546-96268568 GCTGAAGTGCAGTGGTGAAATGG - Intergenic
997579892 5:135010628-135010650 GCTGATGGGCAGTGGGTGGGTGG + Intronic
997785931 5:136713830-136713852 GCTAATGTGCAATGGGCTGATGG + Intergenic
998489575 5:142534569-142534591 GCTGGTGTGAGGAGGGCAGAAGG - Intergenic
998935707 5:147230219-147230241 CCTGATATCCAGTGGGGAGAGGG + Intergenic
999030805 5:148288869-148288891 ACTGAGGTGCAGTGAGCTGAGGG + Intergenic
999250792 5:150181115-150181137 GCTGAGGTGCAGTGAGAAGGGGG - Intronic
1000664594 5:163979556-163979578 ACTGCTGTGGGGTGGGCAGAGGG - Intergenic
1000828965 5:166080347-166080369 GCGGATGTCCAGTGGGCAGCTGG - Intergenic
1001316953 5:170650031-170650053 GCTCCTGTGCAGTTGGGAGAAGG + Intronic
1001586714 5:172837877-172837899 GCTGGTGTGCAGAAGGCAGCAGG - Intronic
1004498525 6:16187541-16187563 GCTGATGGGTTGAGGGCAGAAGG - Intergenic
1004840336 6:19576746-19576768 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
1005284981 6:24315686-24315708 GCTGGAGTGCAGTAGGGAGAAGG + Intronic
1005699292 6:28383744-28383766 ACTGATGAGCAGTGGCCAGCAGG - Intronic
1005787500 6:29260881-29260903 TCTTATGTACAGAGGGCAGATGG + Intergenic
1006337313 6:33427556-33427578 GAGGATGTGCAGTGGACATAGGG + Intronic
1007685647 6:43665864-43665886 GCTGGAGTGCAGTGGCCAGTGGG + Intronic
1007827358 6:44610591-44610613 GATGATGTGCTGTGGGCATATGG - Intergenic
1007849859 6:44792671-44792693 GCTGGAGTGCAGTGGCGAGATGG + Intergenic
1008999450 6:57696705-57696727 TCTGATGTGCAAAGTGCAGAAGG - Intergenic
1009187936 6:60596109-60596131 TCTGATGTGCAAAGTGCAGAAGG - Intergenic
1011844613 6:91547997-91548019 GCTGATGTGGAGTGGAGAGAGGG + Intergenic
1013093309 6:106920971-106920993 TCTAATGTGCAGTGAGCTGATGG - Intergenic
1015399139 6:132768680-132768702 GCTGATGTGGAGGGAGGAGAGGG - Intergenic
1015630107 6:135223444-135223466 GTTCATGTGGAGTGGGCAGAGGG - Intergenic
1018365969 6:163120307-163120329 GCAGATGTGCAGTGGAAACAAGG - Intronic
1018799429 6:167210700-167210722 GCTGAGGCCAAGTGGGCAGAGGG + Intergenic
1020205220 7:6109339-6109361 GATGTTGTGCTGTGGGCAGTTGG + Intronic
1022000828 7:26224569-26224591 GCTGGAGTGCAGTGGCCACAGGG - Intergenic
1022171559 7:27836744-27836766 GCTGCTGTGCAGTGGCCAGTAGG - Intronic
1022333855 7:29404601-29404623 GCTGATGTGGAATGGGCACTTGG + Intronic
1022548948 7:31218526-31218548 TCTGACCTGCTGTGGGCAGAGGG - Intergenic
1022860986 7:34366690-34366712 GCAGATGTGCAGTGAGAAGCAGG - Intergenic
1023351173 7:39321425-39321447 AATGACGTGCAGTGGGCAGCTGG + Intronic
1023620532 7:42067457-42067479 TCTGATGGGGAGTGGGGAGAGGG - Intronic
1023882044 7:44326148-44326170 GCTGATGGAGACTGGGCAGAAGG - Intronic
1026466922 7:70662197-70662219 GCCACTGTGCAATGGGCAGAAGG - Intronic
1027539178 7:79446159-79446181 CCTGTTGTGCAGTGGGAGGAGGG + Intronic
1028716719 7:93979519-93979541 GCTGATGTGTCATGGGGAGAAGG - Intronic
1030446259 7:109649572-109649594 ACTGTTGTGGGGTGGGCAGAGGG - Intergenic
1033221197 7:139527058-139527080 CTTGATGTGCATTGGGCACATGG - Intronic
1033258388 7:139821304-139821326 GAGGATGTCCAGTGGGCAGCTGG + Intronic
1033369914 7:140698146-140698168 GCAGGTGTGGGGTGGGCAGAAGG + Intronic
1033886205 7:145949445-145949467 CCTGTTGTGGGGTGGGCAGAGGG + Intergenic
1034198251 7:149264371-149264393 GCTGATGTGAAGTTGGAGGAGGG + Intronic
1034355751 7:150449690-150449712 CCTGCTGTGCAGAGCGCAGAGGG + Intergenic
1035018003 7:155783039-155783061 GGTGGCCTGCAGTGGGCAGACGG + Intergenic
1035268901 7:157708360-157708382 GCTGAAGGGTCGTGGGCAGATGG - Intronic
1035328991 7:158084301-158084323 TCTGCTGTGCAGGTGGCAGATGG + Intronic
1035430390 7:158815681-158815703 GGAGCTGTGCAGTGGGAAGAAGG - Intronic
1036196704 8:6723452-6723474 GCTGAGGTGGAGTGGGCGGGCGG - Intronic
1037263464 8:17033874-17033896 GATGATGTGCAGGGGGTAGCAGG + Intronic
1037460584 8:19104463-19104485 GCTGATGAGCACTGGGCACGGGG - Intergenic
1037754735 8:21703441-21703463 TGTGGTGTGGAGTGGGCAGAGGG - Intronic
1037990673 8:23319546-23319568 CCTGATGTGCCTTGTGCAGAAGG - Intronic
1038408556 8:27340893-27340915 GCGTATGTGCAGTGGGGAGGGGG + Intronic
1039116409 8:34095941-34095963 GCAGATCTGCAGTGGCCTGAGGG + Intergenic
1040705597 8:50122625-50122647 GCTCAGGAGCAGTGGGAAGATGG + Intronic
1041926519 8:63242663-63242685 GCTGATTTGCTGTAGGCAGAAGG + Intergenic
1043705398 8:83342434-83342456 ACTGTTGTGGGGTGGGCAGAGGG + Intergenic
1043827651 8:84948717-84948739 GATGATGGGCATAGGGCAGAAGG + Intergenic
1045064831 8:98435770-98435792 GCGGGTGTGCAGTGGGCAGAGGG + Intronic
1045502073 8:102751335-102751357 GCTGATGGGAAGTGGGGAAAGGG - Intergenic
1046930850 8:119840495-119840517 GTTGGTATGCAGTGAGCAGAAGG + Intronic
1048342411 8:133550490-133550512 GCAGCTGGACAGTGGGCAGAGGG + Intronic
1049188557 8:141272686-141272708 ACTGAGGGGCAGCGGGCAGAGGG - Intronic
1049274439 8:141712793-141712815 TGTGAAGTGAAGTGGGCAGATGG - Intergenic
1050644664 9:7706403-7706425 GCAGATGTGGGGTGGGCTGAGGG - Intergenic
1050995237 9:12209384-12209406 CCTGTTGTGGAGTGGGGAGAGGG - Intergenic
1052742604 9:32407820-32407842 ACTGATGTGCTGTCTGCAGAGGG + Intronic
1052841710 9:33297119-33297141 GCTGATTTGCAGTAAGGAGAGGG - Intronic
1053123124 9:35560705-35560727 GCTGAGGCGCAGTCGGGAGAGGG + Exonic
1053146717 9:35717079-35717101 GATGATGTCCAGTGGGCTTAGGG + Intronic
1053218539 9:36292792-36292814 GCTGACCTGCAGAGGGCAGGAGG - Intronic
1054812487 9:69446086-69446108 GCTGCTCTGCAGTGGCCCGAGGG + Intronic
1056838406 9:89976992-89977014 AGAGGTGTGCAGTGGGCAGAAGG - Intergenic
1059070116 9:111126602-111126624 GCAGATGTGCAGTGAGCATGTGG + Intergenic
1060756850 9:126219891-126219913 CCTGATGTGGAGTCGGCAGGTGG - Intergenic
1061163660 9:128910311-128910333 GCTGCTGTGTCGGGGGCAGAAGG - Intronic
1061926654 9:133809182-133809204 GCAGATGTGCAGGTGGCAGGTGG - Intronic
1062523229 9:136968245-136968267 GCTGGTGTGCAGGGGGCTCAGGG - Intergenic
1186947102 X:14580756-14580778 GCTGAGATGCTCTGGGCAGAAGG - Intronic
1189322060 X:40092713-40092735 GGTGAGGTGGAGTGGGCAGCGGG - Intronic
1191662528 X:63665966-63665988 GCTGATCTACACTGGGGAGATGG - Exonic
1192048379 X:67700330-67700352 GCTCAGGTGCAGAGGGCAGGAGG + Intronic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1196050632 X:111299892-111299914 GCTGATGTGCACTGTGTAGGGGG - Exonic
1196141289 X:112265965-112265987 GCAGATTTGAAGTGGGAAGAAGG - Intergenic
1196494461 X:116307745-116307767 GTTGCTGTGCACTGGGAAGAGGG - Intergenic
1196862910 X:120044247-120044269 GAAGATATTCAGTGGGCAGAAGG + Intergenic
1196880192 X:120192097-120192119 GAAGATATTCAGTGGGCAGAAGG - Intergenic
1200137588 X:153882591-153882613 GCTGGAGGGCAGGGGGCAGAGGG + Intronic
1200907703 Y:8501488-8501510 CCTGTTGTGGGGTGGGCAGATGG - Intergenic
1201916313 Y:19185276-19185298 CCTGTTGTGCAGTGGGGGGAAGG - Intergenic
1202591798 Y:26492921-26492943 ACTGTTGTGCAGTGGGGGGAGGG - Intergenic