ID: 1124883307

View in Genome Browser
Species Human (GRCh38)
Location 15:33661541-33661563
Sequence TGGTGGGTGAGGCTGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2522
Summary {0: 1, 1: 1, 2: 19, 3: 234, 4: 2267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124883296_1124883307 18 Left 1124883296 15:33661500-33661522 CCAGGGACTGGTTTCATGGAAGA 0: 325
1: 560
2: 1171
3: 1237
4: 1212
Right 1124883307 15:33661541-33661563 TGGTGGGTGAGGCTGGGGGAGGG 0: 1
1: 1
2: 19
3: 234
4: 2267
1124883294_1124883307 29 Left 1124883294 15:33661489-33661511 CCTTTTTGGCACCAGGGACTGGT 0: 487
1: 806
2: 1199
3: 1099
4: 765
Right 1124883307 15:33661541-33661563 TGGTGGGTGAGGCTGGGGGAGGG 0: 1
1: 1
2: 19
3: 234
4: 2267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124883307 Original CRISPR TGGTGGGTGAGGCTGGGGGA GGG Intronic
Too many off-targets to display for this crispr