ID: 1124887224

View in Genome Browser
Species Human (GRCh38)
Location 15:33698475-33698497
Sequence GGGGGAGCTCCTGTTGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124887211_1124887224 18 Left 1124887211 15:33698434-33698456 CCAGGTTTCCTTGCCAGCTCCCT 0: 1
1: 0
2: 5
3: 38
4: 373
Right 1124887224 15:33698475-33698497 GGGGGAGCTCCTGTTGCTAAGGG 0: 1
1: 0
2: 1
3: 10
4: 130
1124887215_1124887224 -1 Left 1124887215 15:33698453-33698475 CCCTCATAAGGAGCCCGCATCAG 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1124887224 15:33698475-33698497 GGGGGAGCTCCTGTTGCTAAGGG 0: 1
1: 0
2: 1
3: 10
4: 130
1124887216_1124887224 -2 Left 1124887216 15:33698454-33698476 CCTCATAAGGAGCCCGCATCAGG 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1124887224 15:33698475-33698497 GGGGGAGCTCCTGTTGCTAAGGG 0: 1
1: 0
2: 1
3: 10
4: 130
1124887214_1124887224 5 Left 1124887214 15:33698447-33698469 CCAGCTCCCTCATAAGGAGCCCG 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1124887224 15:33698475-33698497 GGGGGAGCTCCTGTTGCTAAGGG 0: 1
1: 0
2: 1
3: 10
4: 130
1124887213_1124887224 10 Left 1124887213 15:33698442-33698464 CCTTGCCAGCTCCCTCATAAGGA 0: 1
1: 0
2: 1
3: 13
4: 166
Right 1124887224 15:33698475-33698497 GGGGGAGCTCCTGTTGCTAAGGG 0: 1
1: 0
2: 1
3: 10
4: 130
1124887210_1124887224 28 Left 1124887210 15:33698424-33698446 CCTGAAGAAGCCAGGTTTCCTTG 0: 1
1: 0
2: 1
3: 20
4: 206
Right 1124887224 15:33698475-33698497 GGGGGAGCTCCTGTTGCTAAGGG 0: 1
1: 0
2: 1
3: 10
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124887224 Original CRISPR GGGGGAGCTCCTGTTGCTAA GGG Intronic
902072163 1:13749452-13749474 GGGGGAGCTCCGCTTGCTCCGGG - Exonic
902776370 1:18677238-18677260 GGTGGAGATCTTGTTTCTAAGGG + Intronic
904295631 1:29517990-29518012 TGGGCAGCTCCAGTTGCTATTGG - Intergenic
905398468 1:37683968-37683990 GGAATAGCTCCTGTTGCTAATGG - Intronic
909742855 1:79054230-79054252 GGGGGTGCAACTGTTGCTAATGG + Intergenic
910135288 1:83961087-83961109 GTGGGAGTTACTGTTGCTCAAGG - Intronic
912748117 1:112262828-112262850 GGGGGTGTTCCTTTTGCTATTGG - Intergenic
915270837 1:154752305-154752327 GGGTGAGCTGATGGTGCTAATGG - Intronic
915491634 1:156253164-156253186 GGGGCTCCTCCTGTTGTTAAGGG + Intronic
919774372 1:201184502-201184524 GTGGGTGGTCCTGTTGGTAATGG + Intergenic
922563742 1:226587675-226587697 GGGGGAGCAGCTGAGGCTAAGGG + Intronic
923515285 1:234692613-234692635 GGGGAAGCTCCTGGAGCTCAGGG + Intergenic
1064626890 10:17270650-17270672 GGGGGAGCTACTGTTTCTTTAGG - Intergenic
1069074692 10:64026595-64026617 GGAGAAGCTGCAGTTGCTAATGG + Intergenic
1074306672 10:112285419-112285441 GGGCCAGCTCCTCTTTCTAAAGG + Intronic
1077680303 11:4233803-4233825 GGAGGAGCTGCTCTTGCAAATGG + Intergenic
1077681182 11:4242103-4242125 GGAGGAGCTGCTCTTGCAAATGG - Intergenic
1077684581 11:4279223-4279245 GGAAGAGCTGCTGTTGCAAATGG + Intergenic
1077685461 11:4287546-4287568 GGAAGAGCTGCTGTTGCAAATGG - Intergenic
1077689713 11:4330380-4330402 GGAGGAGCTGCTGTTGCAAATGG + Intergenic
1077690613 11:4338707-4338729 GGAAGAGCTGCTGTTGCAAATGG - Intergenic
1081730985 11:45371634-45371656 GGGGGTGAGCCTGTTGCGAACGG + Intergenic
1082776574 11:57249431-57249453 GGGTAAGTTCCTTTTGCTAAGGG - Intergenic
1082965268 11:58960477-58960499 GAAGGAGCTCCTGTTTTTAAAGG + Intronic
1083635611 11:64119253-64119275 GGGGCTGCTGCTGTTCCTAAAGG + Intronic
1083764561 11:64835724-64835746 GGGGAAGCACCTCTTGCCAAGGG + Intronic
1087390646 11:97527941-97527963 GTGGGAGTTCCTGTTGCTCCAGG + Intergenic
1088827467 11:113507873-113507895 GGAGCAGCTCTTGTTGCTAATGG - Intergenic
1096111686 12:49032541-49032563 GGGGTAGTTCCTATTGCTAACGG + Exonic
1100253288 12:92854715-92854737 TGGGGATCTCCTGCTGCTAGAGG - Intronic
1102565675 12:113795923-113795945 GGTGGGGCTCCTGTTACTACTGG + Intergenic
1104979879 12:132569103-132569125 GGTGGAGCTCCTGTTGCCTGGGG - Intronic
1105218804 13:18306886-18306908 GGGGCAGCAACTGTGGCTAATGG + Intergenic
1114189324 14:20429037-20429059 GGGGGAGCTACTGGTGCTCGGGG - Exonic
1117842996 14:59880593-59880615 GTGGGTGCTCCTGTGGCTTAGGG + Intergenic
1123091744 14:105745081-105745103 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123091768 14:105745160-105745182 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123091813 14:105745318-105745340 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123091836 14:105745397-105745419 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123091874 14:105745544-105745566 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123092035 14:105746224-105746246 GGGGAAGCTCCTGGAGCTCAGGG - Intergenic
1123097442 14:105773196-105773218 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123097513 14:105773508-105773530 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123097658 14:105774058-105774080 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123097721 14:105774312-105774334 GGGGCAGCTCCTGGAGCTCAGGG - Intergenic
1124460468 15:29885477-29885499 TGGGGAGCTCTTACTGCTAAAGG - Intronic
1124887224 15:33698475-33698497 GGGGGAGCTCCTGTTGCTAAGGG + Intronic
1125510799 15:40291446-40291468 GGAGGAGCTCCGGGAGCTAAAGG - Exonic
1126798725 15:52281517-52281539 CGAGGAGCTCCTGTTGGAAAGGG + Intronic
1130261068 15:82354965-82354987 CGGGGCGCTCAGGTTGCTAAGGG - Intergenic
1130280167 15:82514053-82514075 CGGGGCGCTCAGGTTGCTAAGGG + Intergenic
1130471542 15:84230239-84230261 CGGGGCGCTCAGGTTGCTAAGGG + Intergenic
1130479036 15:84344810-84344832 CGGGGCGCTCAGGTTGCTAAGGG + Intergenic
1130492734 15:84443321-84443343 CGGGGCGCTCAGGTTGCTAAGGG - Intergenic
1130593836 15:85234866-85234888 CGGGGCGCTCAGGTTGCTAAGGG + Intergenic
1130724821 15:86428273-86428295 GAGGGAGTTCCTGTTGCTCTAGG + Intronic
1132383862 15:101386215-101386237 GGGGGAGCTGCTGCAGCTGAGGG + Intronic
1133843778 16:9435570-9435592 GGGGCAGCTCCTGGAGCTCAGGG + Intergenic
1134474534 16:14561279-14561301 GGGGAAGCACATTTTGCTAACGG - Intronic
1135323460 16:21511931-21511953 GGGGGCCCTCCTGTTGGAAAAGG + Intergenic
1135651267 16:24208791-24208813 GGGAGCGCTCCTGAAGCTAATGG + Intronic
1136334948 16:29605196-29605218 GGGGGCCCTCCTGTTGGAAAAGG + Intergenic
1136468350 16:30460695-30460717 GGGGGCGCAACTGTTGCTAATGG + Intergenic
1137351159 16:47714848-47714870 AGGTGACTTCCTGTTGCTAAGGG + Intergenic
1139356852 16:66371756-66371778 GGGGGTCCTCCTGGTGCTCAGGG + Intronic
1139950399 16:70665472-70665494 GGGGGAGCTGCACTCGCTAACGG + Exonic
1142035664 16:87861015-87861037 GGGGGCCCTCCTGTTGGAAAAGG + Intronic
1142575524 17:904503-904525 GGGTGAGTTCCTGTTACTGATGG - Intronic
1146241112 17:31227297-31227319 AGGGGTGTTTCTGTTGCTAAGGG - Intronic
1151815071 17:76467758-76467780 AGAGAAGCTCCTGTTCCTAAAGG - Intronic
1152342038 17:79730767-79730789 GAGGGACCACCTGTTGCTATGGG + Intergenic
1155007878 18:21745375-21745397 TGGGGTGCTACTGCTGCTAATGG - Intronic
1158591876 18:58785009-58785031 GGGCCAGGCCCTGTTGCTAAGGG + Intergenic
1159344126 18:67176525-67176547 GGGGTCTCTCCTGTTGCAAAGGG - Intergenic
1165150448 19:33757050-33757072 GTGGGGGCTCCTGCTGCTACAGG + Intronic
1165453129 19:35896614-35896636 GGGTGAGCTCCTGGGGCTGAGGG - Intronic
1166297118 19:41894824-41894846 GGGGGAGCTCCTGGGTCTGAGGG + Intronic
1166297158 19:41894927-41894949 GGGGGAGCTCCTGGGTCTGAGGG + Intronic
1166833352 19:45651658-45651680 GGGGGACCACCAGTTGCTTAAGG + Intergenic
1168689861 19:58369658-58369680 GGGGGAGTCCCTGTTGCTTGGGG - Intronic
926233125 2:11019804-11019826 GGGGGAGCACCTGCTGGTGAAGG + Intergenic
926349870 2:11984792-11984814 TGGGGAGCTGCTGTTGGGAAGGG + Intergenic
926386434 2:12340016-12340038 GGAGGAGCTCCTTTCCCTAAGGG + Intergenic
934295509 2:91739749-91739771 GGGGCAGCAACTGTGGCTAATGG - Intergenic
934856655 2:97734059-97734081 GCGGGTGCTCCTGTTTCTCATGG + Intronic
935719765 2:105969685-105969707 GCCGGAGATCCTGTTCCTAAAGG - Intergenic
937376638 2:121340885-121340907 GGAGGAGCTGCTGTTGCTGTTGG + Exonic
937844124 2:126558511-126558533 GGGGGAGGTCTTTTTGCTCAAGG + Intergenic
938426386 2:131193491-131193513 AGGGGTGTTTCTGTTGCTAAGGG + Intronic
942558704 2:177198453-177198475 GGTGGAGCTGCTGTGGCTGAAGG - Intergenic
948908230 2:240989929-240989951 TGGAGAGCCCCTGTTGCTAGAGG - Intronic
1170549296 20:17462532-17462554 GGGGGAGCTCAGGATGCTGAGGG - Intronic
1172182543 20:33012404-33012426 GGGGGAGCTTCTGTTGCTGTAGG + Intronic
1174272622 20:49380661-49380683 GGGGGAGTGCCTGCTGCTCAGGG + Intronic
1175366384 20:58459220-58459242 GGGGGAGCTCCTGGTGGGGATGG - Exonic
1178486052 21:33020755-33020777 GGGGGAGCTCTGGATGCTACAGG + Intergenic
1180798184 22:18617922-18617944 GGGGGAGCTACTGTAGCAATGGG - Intergenic
1181223534 22:21377344-21377366 GGGGGAGCTACTGTAGCAATGGG + Intergenic
1181255208 22:21558278-21558300 GGGGGAGCTACTGTAGCAATGGG - Intronic
1182280350 22:29214742-29214764 GGGGGAGTCCCTGTGGCTGAGGG - Intronic
1182713935 22:32340257-32340279 ATGGGAGCTACTGTTACTAACGG + Intergenic
1184943532 22:47785162-47785184 TGAGGAGCCCCTCTTGCTAAGGG + Intergenic
950496632 3:13337884-13337906 GGTGGAGGTGCTGCTGCTAAGGG - Exonic
953941036 3:47097390-47097412 GGGGAATATCCTGTTACTAAAGG - Intronic
954639540 3:52089793-52089815 GGAGGACCTGCTGTTGCTTATGG - Intronic
954683079 3:52356337-52356359 GGGGGAGCTGCTCTTCCAAAGGG - Intronic
958714640 3:97764722-97764744 GAAGAAGCTCCTGTTGCCAAGGG + Exonic
962958128 3:140285363-140285385 GCAGCAGCTCCTGTTGCTTAAGG + Intronic
965276554 3:166690742-166690764 GGGGTTGCAACTGTTGCTAATGG + Intergenic
966861373 3:184232744-184232766 GGGGGAGCTCCTGATGGTTCAGG + Intronic
967946488 3:194808003-194808025 GGGGGAGCTCCTTCTGCTCCCGG - Intergenic
968611445 4:1558993-1559015 GGGGCAGCTTCTGCTGCCAAGGG - Intergenic
969365863 4:6694022-6694044 GGGGGAGCTCAAGGTGCTGATGG + Exonic
976868882 4:89766207-89766229 GGCTGAGCGCCTGTTGCTGAGGG - Intronic
978186135 4:105858649-105858671 TGGGGAACTCCCCTTGCTAAGGG - Intronic
982235614 4:153249013-153249035 GGGAGAACTCCTGTTGCTGGAGG + Intronic
985506607 5:285143-285165 GGGGGAGCTGATGTTGCAATTGG + Intronic
988330734 5:29836700-29836722 GGGGTAGATGCTGTTGCTATAGG + Intergenic
995404986 5:111784940-111784962 GGGGGAGCTGCTCTAGCCAAGGG + Intronic
997745916 5:136300382-136300404 TGGGGAGCTCAGATTGCTAAGGG - Intronic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1012390006 6:98727809-98727831 TGGGGAGATGCTGTTGGTAAGGG - Intergenic
1016601595 6:145867744-145867766 AGGGCAGCTTCTGGTGCTAATGG - Intronic
1021299590 7:18956556-18956578 GGAGGAGCTCTGGTTGCTTATGG - Intronic
1021763382 7:23923197-23923219 GTAGTAGCTCCTGTTGCTATAGG - Intergenic
1023175876 7:37434870-37434892 GGGGGAGTTACTGATGCTCAGGG - Intronic
1025087589 7:56035589-56035611 GGGGAGGGTCCTGTAGCTAAGGG - Intronic
1025899571 7:65732832-65732854 GGGGAGGGTCCTGTAGCTAAGGG - Intergenic
1031665386 7:124476886-124476908 GGAGGAGCTGCTGTTGCAAATGG + Intergenic
1034965458 7:155387969-155387991 GGGGGTGCTGTTGTGGCTAAGGG + Intronic
1049356910 8:142193506-142193528 GGGGGAGACACTCTTGCTAATGG - Intergenic
1050023251 9:1307047-1307069 GGAGGAGCTCCAGATGCAAATGG + Intergenic
1056795888 9:89658657-89658679 GAGGCAGATGCTGTTGCTAAGGG - Intergenic
1056843823 9:90020096-90020118 GGAGGAGTTGCTGTTGCTTATGG + Intergenic
1057441328 9:95085879-95085901 GGAGGAGCTCCTGTTGTTCTGGG + Intronic
1062040366 9:134401752-134401774 GGGGGAGCTCAGGGTGCTGATGG - Exonic
1188797150 X:34481251-34481273 GGGGGAGCTGCTGTGGGTGAAGG + Intergenic
1189675792 X:43459242-43459264 GCTGGTACTCCTGTTGCTAATGG + Intergenic
1195059223 X:101177698-101177720 GTGGTAGCTACTGTTGGTAAGGG + Intergenic
1198275353 X:135094207-135094229 GGGGGCACTCCTGTTGCCAAGGG - Intergenic
1198311178 X:135426504-135426526 GGGGGCACTCCTGTTGCCAAGGG + Intergenic
1198619154 X:138487743-138487765 GGAGGAGCTCCTGTGGCTAAAGG + Intergenic