ID: 1124888435

View in Genome Browser
Species Human (GRCh38)
Location 15:33709395-33709417
Sequence CAGCATGTACAGTAGCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124888434_1124888435 3 Left 1124888434 15:33709369-33709391 CCAAATACATAGATTCAGTTGAG 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1124888435 15:33709395-33709417 CAGCATGTACAGTAGCTGAAAGG 0: 1
1: 0
2: 1
3: 16
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124888435 Original CRISPR CAGCATGTACAGTAGCTGAA AGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900590727 1:3458392-3458414 CAGCATGGCCAGCTGCTGAAAGG + Intronic
900594491 1:3474551-3474573 CAGCACGTACAGCCCCTGAACGG - Intronic
901204713 1:7487581-7487603 CAGCAGGTCCAGCATCTGAATGG - Intronic
904096385 1:27981479-27981501 CAGCAGGAACAATATCTGAAGGG + Intronic
907898186 1:58712916-58712938 AAGCATGCACAGTGGCTGTAGGG - Intergenic
909360632 1:74755602-74755624 CAGCATTTATAATAGCTAAAAGG - Intronic
912557330 1:110525554-110525576 CAGCATGGACAGCCTCTGAAAGG - Intergenic
916156844 1:161859303-161859325 AAGCATGTACAGAAGTTTAAGGG - Intronic
918712296 1:187746740-187746762 CAACATGTTCAGCAGCAGAAAGG + Intergenic
920389715 1:205591871-205591893 CAGCGTGTACCGTAGCTGTTAGG + Intronic
920723818 1:208415032-208415054 CAGCAAGTACAGGGGCTGGAAGG - Intergenic
920893743 1:210022197-210022219 CAGCATGTACAGTTGTCAAAGGG + Intronic
922531904 1:226351282-226351304 AAGCAAGTGCAGTAGTTGAAAGG + Intergenic
1063296641 10:4813242-4813264 CAGCCAGTACAGTAGGAGAAAGG - Intronic
1064565532 10:16635488-16635510 CAGAATGTATAGTAGCAGCATGG - Intronic
1065008862 10:21403903-21403925 CCACATGTACAGTAAATGAATGG - Intergenic
1067933767 10:50590217-50590239 CAGCATGTACGATCCCTGAATGG - Exonic
1069880956 10:71592904-71592926 CAGCTGGGACAGCAGCTGAAAGG - Intronic
1070018811 10:72563293-72563315 CACTATGCACAATAGCTGAAAGG + Intronic
1071738124 10:88325072-88325094 CATCATTTACAATAGCTAAAAGG - Intronic
1071824435 10:89310691-89310713 CTGTATGTAAAGCAGCTGAAGGG - Intronic
1072195075 10:93110599-93110621 CAGCATTCACAATATCTGAAAGG - Intergenic
1074328981 10:112484123-112484145 CAGCAGGTACACTAGATTAAAGG + Intronic
1075131651 10:119745109-119745131 TAGCGTATACAGCAGCTGAAAGG - Intronic
1080109715 11:28552427-28552449 CAGCATGTACGTTTGCTGATGGG + Intergenic
1088400115 11:109414459-109414481 AATTATGTACAGTATCTGAAGGG + Intergenic
1090896496 11:130980684-130980706 CAGCATGAACAGCAGCAGCAGGG + Intergenic
1091007636 11:131967876-131967898 CAGCATGTTCAGAATCTGAGAGG + Intronic
1094159692 12:27377462-27377484 CAGGATGTACAGCAGAGGAAGGG - Intronic
1096599517 12:52719422-52719444 CAGCAAGTACAGTAGCACCATGG + Intergenic
1099347990 12:81526622-81526644 CAGGATGTCAAATAGCTGAATGG + Intronic
1101699134 12:107155142-107155164 CAGCATTCACAATAGCTGAAAGG - Intergenic
1105407725 13:20145675-20145697 CAGCATGTACAGAGGCCTAAAGG - Intronic
1107374620 13:39788591-39788613 CAGCATGTAGAGTTGCTGTGTGG + Intronic
1107378481 13:39830551-39830573 CATCATGTACCGTGGCAGAAGGG - Intergenic
1107807687 13:44170106-44170128 AAAGATATACAGTAGCTGAATGG - Intergenic
1108240042 13:48454802-48454824 CAGCAAGTGCAGTGGCTGTAGGG + Intronic
1112937337 13:104817385-104817407 CAGCATGCACAGCAGGGGAAGGG + Intergenic
1114069484 14:19096239-19096261 CAGCCTCTACAGGAGCTCAAAGG + Intergenic
1114092778 14:19303764-19303786 CAGCCTCTACAGGAGCTCAAAGG - Intergenic
1114204206 14:20553100-20553122 CATCATTTACAGTAGCCAAATGG + Intergenic
1115204371 14:30886287-30886309 CATCATGTGCAGCAGCTGCAGGG - Exonic
1115782106 14:36781278-36781300 AAGAATGTAAAGTGGCTGAACGG - Intronic
1117240726 14:53829686-53829708 CACCATCTGCAGTAGTTGAAGGG - Intergenic
1117740199 14:58810608-58810630 CAGCAGGCACAGGAGATGAATGG + Intergenic
1118452165 14:65913047-65913069 AAACTTGTAAAGTAGCTGAAAGG + Intergenic
1120395788 14:83965433-83965455 AAGAATTTATAGTAGCTGAAAGG - Intergenic
1120797064 14:88645621-88645643 CAGCAAGTAGAGAAGGTGAAGGG - Intronic
1123154843 14:106214102-106214124 CACCACTTACAGTAGTTGAATGG - Intergenic
1124141957 15:27084968-27084990 GGACATGTACAGTAGTTGAAGGG + Intronic
1124888435 15:33709395-33709417 CAGCATGTACAGTAGCTGAAAGG + Intronic
1128680907 15:69650657-69650679 CAGCATGTACAGAAGCCCTAAGG - Intergenic
1128924927 15:71646488-71646510 CAGCTTAAACAGTAGCTGATTGG - Intronic
1129255242 15:74330586-74330608 CAGCATGGTCAGTAGCAGGAAGG - Intronic
1131178707 15:90225717-90225739 CAGCCTGTACAGGAGCTGTGGGG + Exonic
1132952696 16:2573143-2573165 CATCATGCACAGTAGCCAAAAGG + Intronic
1132961655 16:2627027-2627049 CATCATGCACAGTAGCCAAAAGG - Intergenic
1133293039 16:4735130-4735152 GAGCATGTACAGTAGCTCAAAGG - Intronic
1135167590 16:20154173-20154195 CAGCATTCACAGTAGCCAAAAGG - Intergenic
1138057240 16:53847873-53847895 TATCATGTACAATAGCTCAAGGG - Intronic
1139451029 16:67028573-67028595 CAGCAGGTAGTGTAGCTGAGTGG + Intergenic
1142007318 16:87695652-87695674 CAGCAGGTACTGTATCTGTAGGG + Intronic
1143959985 17:10708733-10708755 CAGCCTGTTCTGGAGCTGAAAGG + Intronic
1144642300 17:16944244-16944266 CAGCATGTACAGGTGCTGCTAGG - Intronic
1148691061 17:49527264-49527286 CTGCCTGGTCAGTAGCTGAATGG - Intergenic
1150990215 17:70249191-70249213 CAGCATGGACATTATCTGAATGG + Intergenic
1156583490 18:38406633-38406655 CAGCCTGAACAGCAGCTGATAGG - Intergenic
1160007102 18:75075602-75075624 CAGCATGTCCAGGAGCAGAGGGG - Intergenic
1166331675 19:42081357-42081379 CAGTATGTACAGATGCTTAAGGG - Exonic
925211607 2:2053001-2053023 CATAATTCACAGTAGCTGAAAGG + Intronic
925232013 2:2241678-2241700 CATAATTCACAGTAGCTGAAAGG + Intronic
925575261 2:5353584-5353606 CAACATCTACTGAAGCTGAAAGG + Intergenic
925741533 2:7009300-7009322 CATCTTGTTCTGTAGCTGAAGGG + Intronic
926566140 2:14476489-14476511 AAAGATGTAAAGTAGCTGAATGG - Intergenic
928316460 2:30250394-30250416 CAGCAGGTAGAGGAGATGAAAGG - Intronic
930555804 2:52894486-52894508 CAGCATGTTCAATTACTGAAAGG + Intergenic
930721213 2:54640017-54640039 CAGCATGTATAGTCTCTGCATGG + Intronic
930792621 2:55350286-55350308 CAACATTTACAATGGCTGAAAGG + Intronic
933148534 2:78886454-78886476 CATCATGTCCAGTTGATGAATGG - Intergenic
934854289 2:97719302-97719324 CAGCATGTACAGCTACTGACAGG + Intronic
936495095 2:113012943-113012965 CAGCATCAAAAGTTGCTGAATGG + Intergenic
939063392 2:137451957-137451979 CAGCATGTATAGAGGCTGAATGG - Intronic
939244579 2:139607424-139607446 AAACATATAGAGTAGCTGAAAGG - Intergenic
939576690 2:143903610-143903632 GAGGCTGTACAGCAGCTGAAGGG + Intergenic
942426970 2:175870293-175870315 AAGCATGTGCAGTACATGAAAGG - Intergenic
944605940 2:201351370-201351392 CAGCAGGTGCAGTAGATGAGAGG + Exonic
945522574 2:210846528-210846550 CAGCAAGTACCGTATCAGAAAGG - Intergenic
1168922030 20:1546517-1546539 CAGCATTCACACTATCTGAAAGG - Intronic
1169025529 20:2367718-2367740 TAGCATTTACAATAGCTGAAAGG - Intergenic
1173237590 20:41261720-41261742 CAGCATGTACAGAAATTAAAAGG - Intronic
1173270076 20:41525817-41525839 CTGCATACAGAGTAGCTGAAAGG - Intronic
1175372728 20:58503085-58503107 CAGCATTTACAGTCCCTGAAAGG + Intronic
1175514580 20:59560927-59560949 CAGAATTCAGAGTAGCTGAAGGG - Intergenic
1181079402 22:20403954-20403976 CAGCATGTGCAGAAGCTCAGAGG - Intronic
949241292 3:1875709-1875731 CAATATCTACATTAGCTGAAAGG - Intergenic
953899440 3:46831333-46831355 TAGCATGTACAGTGGCTCAGAGG - Intronic
954044025 3:47914063-47914085 CAGCATCTACATTACCTGAGAGG - Intronic
955127191 3:56124546-56124568 CCACACTTACAGTAGCTGAAAGG + Intronic
961765835 3:129210166-129210188 CATCATTTACAATAGCTGAAAGG + Intergenic
962663199 3:137626403-137626425 CAGCAGGTTCAGTGTCTGAAAGG + Intergenic
967317037 3:188159396-188159418 CAGGATGTTCAGTAGCTGTTTGG + Intronic
970608490 4:17704488-17704510 CACCTTGTAGAGTAGCTGCAAGG - Intronic
973733489 4:53846302-53846324 CAGCCTATATAGTAGCTGATAGG - Intronic
973804653 4:54513984-54514006 CAGCATTCAAAGTAGCAGAAAGG + Intergenic
973829555 4:54744911-54744933 CTCCATGGACAGGAGCTGAAGGG - Intergenic
975892492 4:79046340-79046362 CAGCAGGCACAGAAGCAGAAGGG - Intergenic
977303846 4:95298906-95298928 CAGCATGAAGAATAGCTGAAAGG + Intronic
977453809 4:97232171-97232193 TACCATGTAAAGTAGCTCAAAGG + Intronic
979137255 4:117125275-117125297 CAGCATGTACAGTATCAGCAGGG - Intergenic
979295512 4:119028501-119028523 CAACATGTAAAGTATGTGAATGG - Intronic
980736655 4:136899092-136899114 CAGCAGTTACAGTAACTGAAGGG + Intergenic
982059067 4:151584808-151584830 CAGCATATACAAAAGCTCAAAGG - Intronic
982605263 4:157507916-157507938 CATCATGGTCAGCAGCTGAAAGG + Intergenic
983454018 4:167940219-167940241 CAGCATGTACAGGATCTCAAGGG + Intergenic
984450963 4:179900891-179900913 CTGCCTGTACTGTAGCTGCAAGG - Intergenic
984900955 4:184585955-184585977 CAGAATATACAGGAGCTAAATGG - Intergenic
987592125 5:19943245-19943267 AAGCATATACAGTTGCTGTATGG + Intronic
987957746 5:24762946-24762968 CAGCATGGGCAGAAGCTGTAAGG + Intergenic
989465747 5:41753446-41753468 CAGCATGAACAAAAGCTGAAAGG - Intronic
989735965 5:44706818-44706840 CTTTATGAACAGTAGCTGAATGG + Intergenic
993710027 5:91215372-91215394 CAATATGTACATTAGATGAAAGG - Intergenic
995792888 5:115911721-115911743 CAGCATGTATAATATTTGAAAGG - Intronic
995808067 5:116076569-116076591 GGGCATGTCCAGTAGCTGAGGGG + Intergenic
1001136448 5:169106641-169106663 CAGTATGTACAGTAGCATCAGGG - Intronic
1003700692 6:8461570-8461592 CATCTTGTACAGTAGCTCACAGG + Intergenic
1006388641 6:33746222-33746244 CAGCATCTACAGCAGCTGCCTGG - Intronic
1007756234 6:44101503-44101525 CAGCACCCACAGTATCTGAAGGG + Intergenic
1008378864 6:50820821-50820843 CAGAAAGTAAAGTAGCTAAATGG + Intronic
1009321041 6:62288368-62288390 CAGAATGTTTAGTAGTTGAAGGG + Intergenic
1009658383 6:66576051-66576073 CAGAATGTGCTGTAGCAGAATGG - Intergenic
1010480557 6:76347806-76347828 AAGCATGTACAGTAACTGCAAGG + Intergenic
1015879453 6:137856644-137856666 GAGCATTGACAGTAGTTGAAGGG + Intergenic
1016381520 6:143487663-143487685 CAGCATGAACAGTAGCAGACAGG - Intronic
1016393413 6:143597719-143597741 CAGCATGTTCAGTGGCTTAAAGG - Intronic
1020624608 7:10561919-10561941 CCACATGTACAGTAAATGAATGG - Intergenic
1021439643 7:20663308-20663330 CATCATCTACAGTAGCCAAAAGG + Intronic
1022127963 7:27376248-27376270 CTGCATGTTCAGTAGCTAGAGGG + Intergenic
1022838101 7:34136092-34136114 CAGCATGGACAGTAGCCACAGGG + Intronic
1030043782 7:105476238-105476260 CAGCATTCACAATAGCCGAAAGG - Intronic
1030991686 7:116308751-116308773 CAGCATATATACTAGTTGAAGGG - Intronic
1032255644 7:130295112-130295134 CAGCATCAACAGTAGCTGGCAGG + Intronic
1035578539 8:725049-725071 CAGCAGGTACAGAAGCCGGAGGG - Intronic
1035630014 8:1100110-1100132 CAGCATGTACAGTGTGTGTAGGG + Intergenic
1037679618 8:21085907-21085929 CATGATGAAGAGTAGCTGAAAGG + Intergenic
1039479278 8:37859790-37859812 CAGCATCTGCAGCAGCTGGAAGG + Exonic
1039536179 8:38315496-38315518 CTGCATCTGCAGTAGCTGAAGGG + Exonic
1041866941 8:62584786-62584808 CAGGATTTACAGTAGCAGAAGGG - Intronic
1044423712 8:92027488-92027510 CAGCATATAAAGCAACTGAAAGG - Intronic
1049204406 8:141356924-141356946 CAGCATGCACAGGAGCTCCAAGG - Exonic
1051215642 9:14794574-14794596 CATCCTCTACAGTAGCTAAAAGG + Intronic
1053416403 9:37949584-37949606 CAGCATGGACAGAAGCAGCAAGG + Intronic
1054949496 9:70834372-70834394 CAGTAGGTTCTGTAGCTGAATGG - Intronic
1056281660 9:85047232-85047254 GAGCATGCATAGTACCTGAAAGG - Intergenic
1059430552 9:114247657-114247679 CAGCTTGGACAGTAGCGGGAAGG + Intronic
1060608811 9:124941619-124941641 CATCATCTACAGTAGGTGACAGG - Intronic
1186911394 X:14171425-14171447 AAAGATGTACAGTGGCTGAATGG - Intergenic
1188675169 X:32930654-32930676 CAACATGTACAAAAGCTTAAAGG - Intronic
1189081293 X:37975368-37975390 CAGCATGTACTGGAGCAGCAGGG + Intronic
1189400138 X:40660303-40660325 CAGCATATACAGAAGTAGAATGG - Intronic
1190245680 X:48688841-48688863 CAGAACGTCCAGTAGCTGGAGGG - Exonic
1191193966 X:57701254-57701276 AAGCATGTTGAGTGGCTGAATGG - Intergenic
1191269223 X:58441277-58441299 CAAAATGTACAGTTGCAGAATGG + Intergenic
1192570983 X:72204377-72204399 AAGGATATATAGTAGCTGAAGGG + Intronic
1199201369 X:145093883-145093905 CAGCAGATACAGTGGTTGAAAGG + Intergenic
1199691439 X:150311868-150311890 CAGTATGTAAAGTAGATGCAAGG + Intergenic