ID: 1124889118

View in Genome Browser
Species Human (GRCh38)
Location 15:33715718-33715740
Sequence CTCCAGAGGATGCAGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 899
Summary {0: 20, 1: 59, 2: 144, 3: 207, 4: 469}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124889118_1124889124 19 Left 1124889118 15:33715718-33715740 CCATGTTGCTGCATCCTCTGGAG 0: 20
1: 59
2: 144
3: 207
4: 469
Right 1124889124 15:33715760-33715782 CACATGGCAGAATCAATTGAAGG 0: 1
1: 1
2: 2
3: 20
4: 194
1124889118_1124889122 3 Left 1124889118 15:33715718-33715740 CCATGTTGCTGCATCCTCTGGAG 0: 20
1: 59
2: 144
3: 207
4: 469
Right 1124889122 15:33715744-33715766 AGGAACACTGTGTCCTCACATGG 0: 32
1: 86
2: 204
3: 394
4: 763
1124889118_1124889125 20 Left 1124889118 15:33715718-33715740 CCATGTTGCTGCATCCTCTGGAG 0: 20
1: 59
2: 144
3: 207
4: 469
Right 1124889125 15:33715761-33715783 ACATGGCAGAATCAATTGAAGGG 0: 1
1: 0
2: 0
3: 21
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124889118 Original CRISPR CTCCAGAGGATGCAGCAACA TGG (reversed) Intronic