ID: 1124890185

View in Genome Browser
Species Human (GRCh38)
Location 15:33725446-33725468
Sequence CCGCCAGAGACTGCCTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124890177_1124890185 17 Left 1124890177 15:33725406-33725428 CCCTATGACATTCAGTTCCCAGC 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1124890185 15:33725446-33725468 CCGCCAGAGACTGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 131
1124890179_1124890185 0 Left 1124890179 15:33725423-33725445 CCCAGCTGAACGCCTACTACACC 0: 1
1: 0
2: 1
3: 2
4: 46
Right 1124890185 15:33725446-33725468 CCGCCAGAGACTGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 131
1124890180_1124890185 -1 Left 1124890180 15:33725424-33725446 CCAGCTGAACGCCTACTACACCC 0: 1
1: 0
2: 0
3: 0
4: 45
Right 1124890185 15:33725446-33725468 CCGCCAGAGACTGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 131
1124890178_1124890185 16 Left 1124890178 15:33725407-33725429 CCTATGACATTCAGTTCCCAGCT 0: 1
1: 0
2: 1
3: 17
4: 141
Right 1124890185 15:33725446-33725468 CCGCCAGAGACTGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124890185 Original CRISPR CCGCCAGAGACTGCCTGTGC AGG Intronic
900090734 1:919331-919353 GCACCTGAGGCTGCCTGTGCAGG + Intergenic
900164482 1:1239332-1239354 CCTCCAGCGCCTGCCTGTCCTGG + Intergenic
900594796 1:3475865-3475887 CAGCCAGAGGCTGGCTGGGCAGG + Intronic
901463489 1:9405623-9405645 CTGCCAGCGCCTGCCTGAGCTGG - Intergenic
901749228 1:11395838-11395860 CAGCGAGGGGCTGCCTGTGCTGG - Intergenic
902223691 1:14982924-14982946 CAGCCAGAGGATGCCTGTGCGGG - Intronic
902511975 1:16971617-16971639 CCGCCAGAGGGTGCGTGGGCTGG + Exonic
903008349 1:20313030-20313052 CAGCCAGAGGCTGCCTGGGCTGG + Intronic
903657267 1:24956994-24957016 CCCACAGGGACTGCATGTGCTGG + Intronic
904994642 1:34621724-34621746 TCTCCATAAACTGCCTGTGCAGG - Intergenic
915367693 1:155324760-155324782 CCGCCGGAGACAACTTGTGCGGG + Intronic
916651565 1:166839309-166839331 CCGCCAGGGACTGCCCGGACCGG + Intergenic
918301326 1:183206817-183206839 CCAACAGAGACAGCCTGTGTAGG + Intronic
921670297 1:217917458-217917480 CCGCCAGGGCCTGTCTGAGCAGG - Intergenic
923519785 1:234726522-234726544 CCGCCAGAGGCTGCTTTTCCAGG - Intergenic
1063713799 10:8507167-8507189 CCACCAGGGACTGGCTGTTCTGG + Intergenic
1067142894 10:43671026-43671048 ACGCAAGAGATTGCCTGTGATGG - Intergenic
1067298481 10:44989648-44989670 CTTCCTGTGACTGCCTGTGCAGG + Exonic
1071088267 10:81889407-81889429 CTGCCAGAGAGTGCCTGTCATGG + Intronic
1076722777 10:132400030-132400052 ACCCCAGACACTGCCTGTCCCGG + Intronic
1084850720 11:71937749-71937771 CTGCCAGAGAATGCCTCTGGGGG + Intronic
1084864558 11:72045214-72045236 CCACCAGAGAATGACTGTGGTGG + Intronic
1087950988 11:104220123-104220145 CTACCAGAGACTGGCTGTGATGG + Intergenic
1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG + Intronic
1091685065 12:2555659-2555681 CCCGCAAAGACTGCCTGTGAGGG - Intronic
1091795290 12:3294494-3294516 CTGCCAGAGCCAGCCTGGGCAGG - Intergenic
1092114483 12:5989163-5989185 GAGCCAGGGACAGCCTGTGCAGG + Intronic
1092118091 12:6023787-6023809 CCACCTGAGGCTGCCTTTGCAGG - Exonic
1092298075 12:7217899-7217921 CAGCCAGGGACTGACTGTGAAGG - Intronic
1096684609 12:53279728-53279750 CCTCCAGAGCCTGCATGGGCTGG - Exonic
1096804799 12:54134091-54134113 CCACCAGAGAGGCCCTGTGCGGG - Intergenic
1097221641 12:57454740-57454762 CCCCCTGACCCTGCCTGTGCTGG - Intronic
1104674783 12:130705087-130705109 CCCCCAGAGGCAGCCGGTGCTGG - Intronic
1106309765 13:28543849-28543871 TCACCAGAGCCTGCCTATGCTGG + Intergenic
1107442598 13:40441436-40441458 CCTCCAGAGCCTGTCAGTGCTGG - Intergenic
1112265019 13:97915700-97915722 CCACCACAGCCAGCCTGTGCTGG - Intergenic
1112506476 13:99979299-99979321 CCGGGAGAGGCTGCCTGAGCCGG + Intergenic
1113286465 13:108854242-108854264 CCACCACAGTCTCCCTGTGCTGG + Intronic
1117293194 14:54353516-54353538 CCTCCAGAGCCAGCATGTGCTGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1121224448 14:92311058-92311080 CTGCCAGAGCCAGCCTGGGCTGG + Intergenic
1122016820 14:98803460-98803482 CAGGCAGAGGCTGCCTGTGTTGG - Intergenic
1122686918 14:103513100-103513122 TGGCATGAGACTGCCTGTGCTGG + Intergenic
1124109151 15:26771832-26771854 CGGACAGAGACTGGCGGTGCCGG + Intronic
1124890185 15:33725446-33725468 CCGCCAGAGACTGCCTGTGCAGG + Intronic
1127735488 15:61835193-61835215 CAGCCACAGAGTGCCAGTGCAGG + Intergenic
1130223900 15:82044072-82044094 GCTCCAGAGGCTGCCTGGGCCGG + Exonic
1134195304 16:12155071-12155093 CTGCCAGTGGCTGCCTCTGCTGG + Intronic
1134475224 16:14567740-14567762 CCTCCATTGTCTGCCTGTGCCGG - Intronic
1136110603 16:28062256-28062278 CCTCCAGAGGCAGCCTGGGCTGG - Intronic
1139315038 16:66060673-66060695 CAGCTAGAGACTGCCTGAGCTGG - Intergenic
1141740099 16:85885346-85885368 CAGCCAGAGCCTGGCTGTACAGG - Intergenic
1142307557 16:89294057-89294079 CCCCCAGAGACTTCCTGGGTGGG + Intronic
1142372496 16:89690890-89690912 CCCCCAGCACCTGCCTGTGCAGG + Intronic
1142603990 17:1071646-1071668 CCGCAAGCCACTGCGTGTGCAGG + Intronic
1143314718 17:6023649-6023671 CCTGCAGAGACTGGCTGTGAAGG + Intronic
1143713258 17:8748472-8748494 TCACCAGACACTGCCTGTCCTGG + Intergenic
1143717530 17:8785718-8785740 CTGCCAGAGGCTGTCTGGGCTGG + Intergenic
1144742293 17:17590849-17590871 AGGCCAGAGAGTGCCTGTCCTGG - Intronic
1148755988 17:49973197-49973219 GCGCCAGGTACTGCGTGTGCTGG - Exonic
1149349097 17:55769367-55769389 CAGCCAGACACTGTCTGTCCAGG + Intronic
1151678103 17:75610244-75610266 GCGGCAGAGACTGCAGGTGCAGG + Intergenic
1152328101 17:79654240-79654262 TGGTCAGAGACTGGCTGTGCTGG - Intergenic
1152478623 17:80535195-80535217 CCTCCAGCGCCTGCTTGTGCTGG - Intergenic
1154027631 18:10723669-10723691 CCCCCAGAGACTGCCTGGAGAGG - Intronic
1154314984 18:13297406-13297428 CTTCCAGAAAGTGCCTGTGCTGG - Intronic
1159697873 18:71583610-71583632 CCCCCAGAGACTGCATGTCTTGG - Intergenic
1160845135 19:1162949-1162971 GCCCCAGGGACAGCCTGTGCTGG + Intronic
1163374796 19:16923383-16923405 CAGCCAGACACAGCCTGTGAGGG + Intronic
1163453104 19:17390727-17390749 CCGCCAGAGCGTCCCTTTGCTGG + Intergenic
1166747142 19:45146775-45146797 CCCCCAGAGTCTTCCAGTGCTGG - Exonic
1167137077 19:47623178-47623200 CCGTCAGCGACCTCCTGTGCTGG + Intronic
1167483796 19:49748373-49748395 CCTGCAGAGACTGCACGTGCTGG + Exonic
925920124 2:8632558-8632580 CCTTCAGTGACTGCCTGTCCTGG - Intergenic
926120595 2:10239412-10239434 CCTCCAGAGGCTGGCCGTGCTGG + Intergenic
927944010 2:27123847-27123869 CCGCCATAGGCGGCCTGTGCAGG - Exonic
928186135 2:29113017-29113039 CCCCCAAAGACAGCCTGTGTAGG + Intronic
932728439 2:74199347-74199369 CCACCAGAGCCTGTCAGTGCCGG + Intronic
937463424 2:122109303-122109325 CAGCCAGTGCCTGCCTGTGCTGG + Intergenic
946856218 2:223952328-223952350 CCCACAGAGACTGCCTGTTGAGG - Intergenic
1168892943 20:1306366-1306388 CAGCCAGAGACTTCCTGAGCAGG - Exonic
1174282384 20:49448632-49448654 CAGCCAGAAACTGTCAGTGCTGG + Intronic
1174420027 20:50393497-50393519 CCTCCATACACTGCCTGTCCTGG + Intergenic
1174460732 20:50680617-50680639 TGGCCAAAGGCTGCCTGTGCTGG + Intronic
1175312440 20:58020995-58021017 ACCCCACAGTCTGCCTGTGCTGG - Intergenic
1176022885 20:62971078-62971100 CTGCCCGAGGCTGTCTGTGCTGG - Intergenic
1176189286 20:63800318-63800340 CGGCCAGGGGCTGCCTGGGCTGG + Intronic
1177714425 21:24821025-24821047 CTGCCTGAGAGTGCCTGTTCTGG + Intergenic
1180108600 21:45637034-45637056 CCGGCACAGACTGCGGGTGCAGG - Intergenic
1180569523 22:16702203-16702225 CCACCTGAGGCTGCCTTTGCAGG - Intergenic
1180895565 22:19329518-19329540 GAGCCAGAGACTTGCTGTGCAGG - Intergenic
1182808633 22:33096994-33097016 TCCCCAGAGACTTCTTGTGCTGG + Intergenic
1183587015 22:38758710-38758732 CCGCCAAGGCCTGCCTGTGATGG - Intronic
1184411773 22:44330336-44330358 CCCCCAGAGAGTCCCTGTGTGGG + Intergenic
949281478 3:2352494-2352516 CTGCCAGGGGCTGGCTGTGCCGG - Intronic
954840766 3:53509421-53509443 GCCCCAGACACTGCCTGGGCTGG + Intronic
956865750 3:73367018-73367040 CCTTCAGAGACTGCCTCTTCTGG - Intergenic
968356152 3:198109135-198109157 GCGGCAGAGTCTGCCTCTGCAGG - Intergenic
968817987 4:2831629-2831651 CCGCCAGTGTCAGCCTGTGAGGG - Exonic
968949779 4:3684432-3684454 CCTCCAGGGCCTGTCTGTGCTGG + Intergenic
969244182 4:5921879-5921901 TGGCCAGAGGCTGCCTGTGAAGG + Intronic
971691994 4:29848834-29848856 CCGCCCCGGACTCCCTGTGCTGG - Intergenic
973588143 4:52412828-52412850 CAGCCAGAGACTGCAAGTTCTGG + Intergenic
974231284 4:59117834-59117856 TCGCCAGAGCCTGACTATGCTGG + Intergenic
980720267 4:136686618-136686640 CAGGCAGAGACAGCTTGTGCAGG + Intergenic
985538357 5:476626-476648 GCTCCAGAGACTGCATGTCCAGG + Exonic
986016036 5:3757872-3757894 CCTACAGAGATGGCCTGTGCAGG - Intergenic
997192008 5:131946038-131946060 CCTCACAAGACTGCCTGTGCTGG - Intronic
997264862 5:132489697-132489719 CCTCCAGAGACTGGCTGGGAGGG - Intronic
999243269 5:150139611-150139633 CAGCCACAGACTTGCTGTGCGGG + Intronic
1000252681 5:159510445-159510467 CAGCCTGACACTGCCTCTGCTGG + Intergenic
1003607752 6:7580111-7580133 CCTCCAGGGACTGCTTGTGCCGG - Exonic
1005959187 6:30684181-30684203 CACCCAGAGACAGCCTTTGCTGG + Intronic
1019083916 6:169456605-169456627 GCTCCAGAGGCTGCCTGTCCTGG - Intergenic
1019635728 7:2074654-2074676 TCGCCAGGGAGTGCCTGTCCTGG - Intronic
1019702906 7:2482693-2482715 CAGCCAGTCACTGTCTGTGCTGG + Intergenic
1019734773 7:2645207-2645229 CCTCCACACACTTCCTGTGCCGG - Intronic
1020885776 7:13817406-13817428 CAGGCAGAGACAGCTTGTGCAGG - Intergenic
1026302722 7:69111858-69111880 TCGCAAGAGACAGCCTGTGAAGG + Intergenic
1028418586 7:90607400-90607422 CTTCCAGAGAGTGCCTGAGCTGG + Intronic
1033285515 7:140037670-140037692 CCAGCAGAGCCTGCCTGTGTTGG - Intronic
1034972987 7:155430771-155430793 CCTCCACAGCCTTCCTGTGCGGG - Intergenic
1038425535 8:27461826-27461848 CCCCCAGTGGCCGCCTGTGCAGG - Intronic
1040579316 8:48683292-48683314 CAGCCACATACTTCCTGTGCAGG - Intergenic
1040586884 8:48752036-48752058 TCGCCAGAGACTGAATCTGCAGG + Intergenic
1049185945 8:141253613-141253635 CAGCCAGTGACTGTCAGTGCTGG + Intronic
1049405562 8:142450484-142450506 CCGCCAGCGTCTGTGTGTGCTGG - Intronic
1049816549 8:144605767-144605789 CCGCCGCAGACTGGCTGGGCAGG + Intronic
1058472551 9:105295772-105295794 GCGCCAAAGACTGATTGTGCAGG + Intronic
1058650851 9:107174655-107174677 ACCACAGAGGCTGCCTGTGCCGG - Intergenic
1060038614 9:120280935-120280957 CCACCACAGCCTGCCTGTGATGG - Intergenic
1060666802 9:125436614-125436636 CTGACGGAGGCTGCCTGTGCGGG + Intergenic
1061485072 9:130916397-130916419 CCCCAAGTGACTGCCTGTGCCGG + Intronic
1062032464 9:134367817-134367839 CTGCCAGAGACAGGCTGGGCAGG - Intronic
1062043575 9:134415143-134415165 CCGCCTGAGTCTCCCTGTGTGGG + Intronic
1062247049 9:135574489-135574511 CAGGCAGACACTGCCTCTGCTGG + Intergenic
1062652917 9:137587479-137587501 CCTCCAGAGGCTGCCGGTCCTGG + Intronic
1198266650 X:135015797-135015819 CCTGATGAGACTGCCTGTGCTGG + Intergenic
1199977078 X:152900461-152900483 CCGCCAGGGACTGGCAGTGGGGG - Intergenic
1200757166 Y:7000885-7000907 GAGCCAGAGACTGCGTGTGACGG - Intronic