ID: 1124895411

View in Genome Browser
Species Human (GRCh38)
Location 15:33771926-33771948
Sequence CATGAAGTCAGGCTCAGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124895411 Original CRISPR CATGAAGTCAGGCTCAGAGC TGG Exonic
900162562 1:1231443-1231465 CTTGATGTCTGGCTCAGAGGCGG - Intronic
900936420 1:5769021-5769043 CCTGAAGGCAGTCTCAGTGCTGG - Intergenic
902577338 1:17386609-17386631 CATGAGGCCTGGCTCAGGGCTGG + Intronic
903182346 1:21611359-21611381 CATCACGCCAGGCTCAGCGCTGG - Intronic
903789040 1:25880188-25880210 AAAGGAGTCAGGCTCTGAGCTGG + Intergenic
903917101 1:26772627-26772649 CATGAGGTAAGGCCAAGAGCAGG + Exonic
903938780 1:26914360-26914382 CAGGAAGCCAGCCCCAGAGCTGG + Intronic
904504053 1:30936226-30936248 GATGAAGTCTGGCACAGAGTGGG + Intronic
904505517 1:30949655-30949677 GATGAAGTCTGGCACAGAGTGGG + Intronic
905536801 1:38728722-38728744 AAGGAACTCAGGCTCAGAGCTGG - Intergenic
906483112 1:46213916-46213938 CCTGTAGTGAGGCTCAGAGTTGG + Intronic
907394316 1:54178679-54178701 CATGATGCCAGGCACAGAACAGG - Intronic
907438474 1:54464127-54464149 CAGGAAGTGAGGTTCAGAGAGGG + Intergenic
907470903 1:54672945-54672967 CATCAAGTTAGTCTCAGAGGTGG + Intronic
907560295 1:55381672-55381694 CATAAAGCCTGGCACAGAGCAGG + Intergenic
908419357 1:63944769-63944791 CATGATGTCAGTGTCAGAGCTGG - Intronic
910270915 1:85392919-85392941 CATGAAGTCAGGATCTGTGAAGG - Intronic
910449853 1:87334152-87334174 CATTAATTAAGGCTCAGGGCTGG - Intronic
911652324 1:100403820-100403842 CAGTAAGGCAGGCTCAGCGCTGG - Intronic
911740529 1:101382341-101382363 CAGGAAGTCAGAGTCAGAGGAGG - Intergenic
912084941 1:105988433-105988455 CATGTAGTAAGTCACAGAGCTGG - Intergenic
915640128 1:157218479-157218501 CAAGAAGTCAGGATCAGAGCTGG + Intergenic
917636673 1:176943895-176943917 CAGGAAGTCAGGGTCAGGGGTGG + Exonic
919531399 1:198725611-198725633 AATAAAGTCAGGCTCAGTACAGG - Intronic
919810650 1:201406997-201407019 CTTTGAGTCAGGCCCAGAGCAGG + Exonic
919837509 1:201585145-201585167 CCTGAAGTCAGGCACTGGGCTGG + Intergenic
922339501 1:224644064-224644086 CATGAAGTCAGGGACCGAGTGGG + Intronic
923516076 1:234698908-234698930 CATGGAGTCAGGCTCATAACAGG + Intergenic
1063477722 10:6343395-6343417 GATGTAGGCAGGCTCAAAGCAGG + Intergenic
1063529239 10:6814952-6814974 CGTGAAAACAGGCTCAGAGAAGG - Intergenic
1063932711 10:11045239-11045261 CCTGAGCTCAGGCTAAGAGCTGG + Intronic
1064332096 10:14403565-14403587 CAGGGCCTCAGGCTCAGAGCGGG - Intronic
1065454635 10:25894202-25894224 CATGAAGTCTGGATCACATCTGG - Intergenic
1067497920 10:46775568-46775590 GATGAAGTCAGGCTTGGGGCAGG + Intergenic
1067596728 10:47564846-47564868 GATGAAGTCAGGCTTGGGGCAGG - Intergenic
1068819970 10:61363693-61363715 AATGAAATCAGGCTCTGAGTGGG + Intergenic
1068849152 10:61716319-61716341 TTAGAAGTCAGGCTCAGAACTGG + Intronic
1069910439 10:71755523-71755545 CATAAACTGAGGCTCAGAGAGGG + Intronic
1069990183 10:72310414-72310436 CATGAGGTGAGGCTGACAGCCGG - Intergenic
1070140069 10:73732408-73732430 GATGAAGTCAGGCTTGGGGCAGG - Intergenic
1070829073 10:79407738-79407760 CAGGAAGTTAGGGTCAGAGCTGG + Intronic
1070842155 10:79494787-79494809 CTTGAAGCCAGGCCCAGAGGTGG - Intergenic
1073479735 10:103778989-103779011 CCAGGAGCCAGGCTCAGAGCTGG - Intronic
1074311621 10:112327674-112327696 CAAGAAGTCAGGACCAGAGCTGG + Intergenic
1074428533 10:113373188-113373210 CTTTAAGTCATGCTCAGAGGGGG + Intergenic
1074805629 10:117048447-117048469 GATGAAGTCTGCCTCAGAGAAGG - Intronic
1074945288 10:118275339-118275361 CAAGAAAACAGGCTCAGAGAGGG - Intergenic
1074993238 10:118731035-118731057 AATGAAGTAAGCCTCAGCGCAGG - Intronic
1075167083 10:120078588-120078610 CACGAACTCAGCCTCAGAGCTGG - Intergenic
1075689365 10:124385257-124385279 CATGAAGACAGGCCCAGGGAGGG - Intergenic
1075735863 10:124664277-124664299 CCTGAAGGGAGGTTCAGAGCTGG + Intronic
1075923604 10:126233375-126233397 CATCAAGTCAGCCTCAGACAAGG + Intronic
1076612743 10:131736796-131736818 CAGGGAGTCAGGCTCAGGGTTGG + Intergenic
1076782243 10:132730769-132730791 CTTGCGGTCAGGCTCACAGCAGG - Intronic
1077046201 11:546677-546699 CATGAAGTCAGGCCTGCAGCAGG + Intronic
1077250374 11:1558200-1558222 GATGAAGTCAGGCTTGGGGCAGG + Exonic
1077520242 11:3028910-3028932 CCCAAACTCAGGCTCAGAGCTGG + Intronic
1078026516 11:7700773-7700795 CCTGAAGTCAGTCTCATTGCTGG - Intronic
1078072670 11:8127821-8127843 AATGAATGCAGGCTCAGAACTGG - Intronic
1078101062 11:8330595-8330617 CAGGAAGTCACACTCGGAGCTGG - Intergenic
1078720050 11:13875901-13875923 CCAGAGGTCAGGCTCAGGGCAGG + Intergenic
1081891041 11:46542712-46542734 CATGGATTCCGCCTCAGAGCGGG + Exonic
1083889025 11:65586646-65586668 AATGAGGCCAGGCTGAGAGCAGG + Intronic
1084458420 11:69282606-69282628 CAGGAAGCCAGGCTCAGTGCAGG - Intergenic
1084541891 11:69792237-69792259 GAGGAAGTGAGGCTCAGAGAAGG - Intergenic
1085045034 11:73347761-73347783 CATGAAGTCTGTCTGACAGCTGG + Intronic
1085048130 11:73365052-73365074 CAGCAAGTCAGTCACAGAGCTGG - Intronic
1085048341 11:73366342-73366364 CAGGAAGTGATGCACAGAGCAGG + Intronic
1087683792 11:101241418-101241440 CAAGAAGTCAAGCACAGCGCCGG + Intergenic
1090501814 11:127268292-127268314 CAAGTAGCCAGGCTCAAAGCTGG + Intergenic
1090900677 11:131027930-131027952 CTTGAAGGCAGGGACAGAGCTGG + Intergenic
1091146898 11:133287945-133287967 CTTGAAGACAGGCTCACAGCTGG + Intronic
1092058026 12:5523194-5523216 AATGAAGTCAGGGTCACAGAAGG + Intergenic
1101253187 12:102955006-102955028 AGTGAGGTCAGGCTCAGGGCTGG + Intronic
1102073525 12:110041789-110041811 CCTGAAGTCAGGGTCACATCAGG - Exonic
1102825394 12:115944132-115944154 CATGAACTGAGGCCCAGAGAGGG - Intergenic
1102954077 12:117048271-117048293 CAGGAAGCCAGGCTCACACCAGG + Intronic
1107784895 13:43945263-43945285 CATGAAGTCAGGCTGAGATGAGG - Intergenic
1107991680 13:45824337-45824359 AATGTAGTCAGGCCCACAGCAGG + Intronic
1115641228 14:35336893-35336915 CAGGAAGCCAGGCCCTGAGCAGG - Intergenic
1117937117 14:60919148-60919170 CAAGAGGTCTGGCTCAGAGCTGG + Intronic
1118684307 14:68276028-68276050 CATGAAAACAGGCTCCCAGCTGG - Intronic
1119123068 14:72097860-72097882 GATGATATCAGGCTAAGAGCTGG - Intronic
1119532556 14:75373235-75373257 CATGAGGTCCTGCTGAGAGCAGG + Intergenic
1124895411 15:33771926-33771948 CATGAAGTCAGGCTCAGAGCTGG + Exonic
1125317525 15:38447055-38447077 CATGGAGTTATGCTAAGAGCAGG - Intergenic
1125639798 15:41221088-41221110 CATGATGCCTGGCTCAGAGTGGG - Intronic
1125971518 15:43915766-43915788 CATAAAGCCAGGCTGAGAGAAGG - Intronic
1126297553 15:47157582-47157604 AATGAAGTCAAGCTGAGACCAGG + Intergenic
1128219360 15:65957415-65957437 CATGAAGTCTGTCTCTGAGGCGG + Intronic
1128330395 15:66751766-66751788 CATGGTGCCAGGCACAGAGCAGG + Intronic
1128453109 15:67818559-67818581 CATGAAGGCAAGCTTAGAGGAGG + Intergenic
1128668740 15:69558515-69558537 CATGGAGCCAGGAGCAGAGCAGG + Intergenic
1132532226 16:458120-458142 CATAAAGTCAGGCTCAAACAGGG - Intronic
1132936477 16:2483829-2483851 CAAGAAGGCAGGCTGGGAGCAGG + Intronic
1132945445 16:2529460-2529482 CACGAAGTCTGGGACAGAGCCGG - Exonic
1133328190 16:4955096-4955118 CATGAACTCAGTCCCAGGGCAGG - Intronic
1133575580 16:7086036-7086058 GATGGAGACAGCCTCAGAGCTGG - Intronic
1135278136 16:21130853-21130875 GAGGAAGTCAGTCTTAGAGCTGG - Intronic
1136500596 16:30668095-30668117 CATGAAGTTAGGGTCAGGTCGGG + Intronic
1136710813 16:32234917-32234939 CACCCAGTCATGCTCAGAGCTGG - Intergenic
1136757098 16:32694494-32694516 CACCCAGTCATGCTCAGAGCTGG + Intergenic
1136811011 16:33175881-33175903 CACCCAGTCATGCTCAGAGCTGG - Intergenic
1136817487 16:33285961-33285983 CACCCAGTCATGCTCAGAGCTGG - Intronic
1136824051 16:33342490-33342512 CACCCAGTCATGCTCAGAGCTGG - Intergenic
1136999641 16:35217329-35217351 CATCCAGTCATGCTCAGAGATGG - Intergenic
1137017604 16:35393142-35393164 CACCCAGTCATGCTCAGAGCTGG + Intergenic
1137031885 16:35531998-35532020 CACCCAGTCATGCTCAGAGCTGG + Intergenic
1138432966 16:56981282-56981304 CTTGGAGTCAGGCACAGGGCGGG + Intronic
1138483158 16:57317444-57317466 CATGAGCTGAGGCTCAGAGGTGG + Intergenic
1138927347 16:61608899-61608921 CAGGAAGTCTGGAACAGAGCAGG - Intergenic
1203059247 16_KI270728v1_random:954845-954867 CACCCAGTCATGCTCAGAGCTGG + Intergenic
1142536477 17:620326-620348 CATGAGACCAGCCTCAGAGCAGG - Intronic
1142720571 17:1773053-1773075 CATGGAGTCTGGGTCACAGCTGG + Intronic
1143383516 17:6510860-6510882 GATGAAGTCAGGGGAAGAGCCGG + Intronic
1143818543 17:9540612-9540634 CATGGAGTCTGGCCAAGAGCGGG - Intronic
1144662447 17:17080050-17080072 CATGGGGGCAGGCCCAGAGCTGG + Intronic
1144970503 17:19106258-19106280 GATTGACTCAGGCTCAGAGCTGG + Intergenic
1144990806 17:19232420-19232442 GATTGACTCAGGCTCAGAGCTGG + Intronic
1145889137 17:28402714-28402736 CAGGGAGTCAGGATCAGAGAGGG - Exonic
1145989871 17:29072909-29072931 CATGAAGACAGGGACCGAGCAGG + Intergenic
1147144641 17:38477970-38477992 AGGGAAGTGAGGCTCAGAGCGGG - Intronic
1147321774 17:39650998-39651020 CATGCAGTCTGGCACAGATCTGG + Intronic
1147414176 17:40276589-40276611 CACCAAGTCAGGCACAGAACAGG - Intronic
1148969980 17:51471288-51471310 CATGGTGTCAGGCACATAGCTGG + Intergenic
1149290081 17:55209443-55209465 CATGAAGGAAGGGCCAGAGCTGG + Intergenic
1149868507 17:60163388-60163410 GATGAACTGAGGCCCAGAGCAGG - Intronic
1150932019 17:69595491-69595513 CAGGCAGTGTGGCTCAGAGCTGG + Intergenic
1151427692 17:74041696-74041718 CTGGAAGCCAGCCTCAGAGCCGG + Intergenic
1151785433 17:76272750-76272772 GATGATGTCATGCTCAGAGCTGG - Intergenic
1152311592 17:79554542-79554564 AATGAAGTCAGGCTCACAGCGGG - Intergenic
1155394783 18:25375990-25376012 CATACAGTAAGGGTCAGAGCTGG - Intergenic
1156230080 18:35145040-35145062 CATGGGGTCTGGCTCAGAGTTGG - Intergenic
1156703955 18:39857441-39857463 CATGAAGTCAAGCACAGTGGAGG - Intergenic
1158419286 18:57278652-57278674 CAGGGAGTTAGGCTCAGGGCAGG - Intergenic
1160171059 18:76555247-76555269 GATGAAGGCAGCCTGAGAGCTGG - Intergenic
1160516070 18:79479938-79479960 CATGAAGTCTGGCTCAAGTCTGG - Intronic
1160698480 19:495633-495655 AAGGAAGCCAGGCTCAGAGATGG + Intronic
1162354789 19:10175870-10175892 CATAAAGTCAGCCTCAGACCAGG + Intronic
1163086072 19:14980179-14980201 GAGGAAGCCAGGCTCAGAGAGGG - Intronic
1163261008 19:16190019-16190041 TTTGAAGTGAGGATCAGAGCAGG + Intronic
1163399245 19:17082130-17082152 CTGGGAGCCAGGCTCAGAGCTGG + Intronic
1164636282 19:29793679-29793701 CATGAACACAGGCGCAGAGCAGG - Intergenic
1164791006 19:30980738-30980760 CATAAAGGGAGGCCCAGAGCAGG - Intergenic
1165231122 19:34387568-34387590 CATGGATCCAGGCTCAGTGCTGG + Intronic
1167494523 19:49809713-49809735 AAGGAACTCAGGCTCAGAGAGGG - Intronic
1168115388 19:54219399-54219421 CACAAACTGAGGCTCAGAGCAGG + Intronic
1168482642 19:56734690-56734712 CGTGAAGTTAGGGTGAGAGCAGG + Intergenic
925158331 2:1663814-1663836 CATGCTGTCAGTCTGAGAGCAGG - Intronic
925438824 2:3866500-3866522 CATGCAGCCAGGCATAGAGCCGG - Intergenic
925837312 2:7958978-7959000 CATAAAGTATGGCTTAGAGCAGG - Intergenic
926877307 2:17495703-17495725 CATGTATTCAGGGTCAGAGTGGG - Intergenic
929098217 2:38284205-38284227 CAAGAAGTCAGATTCAGAGCAGG + Intergenic
929596788 2:43181024-43181046 CGTAATGTCAGGCACAGAGCAGG - Intergenic
929959259 2:46484154-46484176 CATACAGGCAGGGTCAGAGCAGG + Intronic
931632954 2:64317548-64317570 CATGACTCCAGGCTGAGAGCTGG - Intergenic
932323049 2:70835855-70835877 CAGGAAGTCAGTCCCACAGCAGG + Intergenic
932488242 2:72099939-72099961 CCTGAAGTGAGGCACTGAGCAGG + Intergenic
932942700 2:76187674-76187696 CATACAAACAGGCTCAGAGCTGG - Intergenic
934605685 2:95693603-95693625 CAGGGAGCCAGGCTCTGAGCAGG - Intergenic
935678166 2:105613955-105613977 CATGAGGTGAGGGACAGAGCTGG + Intergenic
936252133 2:110875071-110875093 CCTGAAGGCAGCCTCTGAGCCGG + Intronic
936539148 2:113336129-113336151 CAGGGAGCCAGGCTCTGAGCAGG - Intergenic
938181823 2:129191169-129191191 GGTGACCTCAGGCTCAGAGCTGG - Intergenic
939083959 2:137695157-137695179 CAAGAAGTAAGGCTCAGTTCAGG + Intergenic
939497348 2:142939836-142939858 CGTGGAGTCAGGCTCAGTGTAGG + Intronic
940585948 2:155649913-155649935 TAGGAAGTCAGGCACAGACCAGG - Intergenic
944181488 2:196900205-196900227 CAGGAACTCAGGCTGAGAGTGGG - Intronic
946404733 2:219486324-219486346 CATGAAGCCAGGCTGTGTGCAGG + Intronic
947550469 2:231041838-231041860 CATGATGTCATGCTCAGAAAAGG + Intronic
947731029 2:232431773-232431795 CAGCAAGTCTGGCACAGAGCAGG + Intergenic
948128850 2:235585356-235585378 CAGGAGGTCAGGGTCAGAGCAGG - Intronic
948313175 2:237004928-237004950 CATGAAGACAGGCGCAGAGTGGG + Intergenic
1170137786 20:13094202-13094224 CAGTAAGTCAGGAGCAGAGCTGG - Intronic
1170281395 20:14653034-14653056 CATGAGCTAAGGCTCAGAGAGGG - Intronic
1170344087 20:15364068-15364090 CATAAAGTCAGGCTCACATCTGG - Intronic
1172784474 20:37458046-37458068 GATGTAGTCAGGCTGACAGCTGG + Intergenic
1172803191 20:37592636-37592658 CATGAAGTTCGGCACAGAGCAGG - Intergenic
1172879594 20:38190931-38190953 CAGCAAGTCAGAGTCAGAGCAGG + Intergenic
1172885717 20:38229585-38229607 CATGAAGCCAAGCCCAGAGCAGG + Intronic
1173575548 20:44110996-44111018 CATGAAGTTACTCTCACAGCCGG - Intergenic
1173683165 20:44901614-44901636 CATGAAGGCAGTCACAGAACAGG + Exonic
1174201257 20:48808162-48808184 CCTGAGGTCAGCCCCAGAGCAGG - Intronic
1174262924 20:49310316-49310338 CAGCAAGTCAGGAGCAGAGCTGG + Intergenic
1175220532 20:57414160-57414182 GGGGAAGACAGGCTCAGAGCGGG + Intergenic
1175507348 20:59495314-59495336 CAGGAGGTCAGGATCAGTGCAGG - Intergenic
1175883162 20:62272036-62272058 CATGAAGGGATGCTCAGAGCAGG + Intronic
1175895391 20:62333651-62333673 GATGAAGGCAGGCTCCGTGCTGG + Exonic
1177634740 21:23772734-23772756 CATGAACTCAGGCTTAAAGTAGG + Intergenic
1178432631 21:32529916-32529938 CATGGTGTCTGGCACAGAGCAGG - Intergenic
1179150835 21:38806558-38806580 CAGGAAGTCACCCTCAAAGCCGG - Intronic
1181694072 22:24584318-24584340 CAGCAAGTCAGGAGCAGAGCGGG + Intronic
1183426584 22:37742906-37742928 GATGAAGTGAAGCTCAGAGAGGG + Intronic
1184255075 22:43281889-43281911 CCTGAAGCCAGGCCCAAAGCTGG - Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950139148 3:10603171-10603193 AATGAAGCCAGGCCCAGAGAAGG - Intronic
950198160 3:11024010-11024032 CATGAAGCCAGGCACATAGTAGG - Intronic
950310578 3:11954328-11954350 CATGGAGTCTGGCACAGGGCAGG + Intergenic
952604727 3:35131359-35131381 GATACAGTGAGGCTCAGAGCAGG + Intergenic
953374877 3:42420212-42420234 AGTGATGTCAGGCTCTGAGCTGG - Intergenic
953510872 3:43537575-43537597 CATGATCTCAGGCTCAGAGCAGG + Intronic
954123178 3:48512495-48512517 CACAAAGTCAAGCCCAGAGCAGG + Intergenic
954286007 3:49619760-49619782 CATGAAGTCAGACCCAGAGAAGG + Intronic
955236855 3:57147219-57147241 CATGTGGCCAGGCACAGAGCTGG + Intronic
955930275 3:64049325-64049347 CATGAGGAAAGGCTCAGAGAGGG + Intergenic
960373234 3:116866758-116866780 GATGAAGTCAGATACAGAGCTGG + Intronic
960433764 3:117600940-117600962 GATGTATTCAGGCTCAGAGAGGG + Intergenic
960665534 3:120105209-120105231 CATGAAGGTATGCTCTGAGCAGG + Intergenic
961496908 3:127299915-127299937 CATGGAGTGAGGATGAGAGCCGG + Intergenic
962226137 3:133611445-133611467 CATGAAGTTAGTCTTACAGCAGG - Intronic
962709295 3:138071970-138071992 CATGAAATGAGGATCAGAGAAGG + Intronic
966741773 3:183240957-183240979 CATGGAGCCAGGCTCATAGTAGG - Intronic
967320035 3:188185881-188185903 CATGAAGCCTGGCACATAGCGGG + Intronic
967969135 3:194986335-194986357 CATGATGTCAGTCCCAGAGGTGG + Intergenic
968463493 4:737649-737671 GATGAAGTTGGGCTGAGAGCAGG - Intronic
968958262 4:3730124-3730146 CCTGGAGTCAGGGTCAGAGTCGG - Intergenic
969377922 4:6775416-6775438 CAGGATGTCAGCCTCAGAGCAGG - Intergenic
973299609 4:48565955-48565977 CATGAAGGCTGGCACAGAGGTGG + Intronic
973977172 4:56273544-56273566 ATTGAAGTCAGTATCAGAGCTGG + Intronic
974295430 4:59993189-59993211 CACTATGTCAGGCACAGAGCTGG - Intergenic
976850802 4:89542372-89542394 TATGAGGTCTGGCTCAGTGCTGG - Intergenic
983680394 4:170346527-170346549 CATGAAGTTAGGCTGAAAACAGG - Intergenic
984022816 4:174506519-174506541 CATCAAGTAAGCCTCAGAGCTGG - Intronic
984402696 4:179287298-179287320 CAGGAAGTCAAGGTGAGAGCAGG + Intergenic
984843489 4:184090391-184090413 CATGAAGCCCGGCACATAGCAGG - Exonic
985841074 5:2306259-2306281 AATTAACTCAGGCCCAGAGCTGG - Intergenic
986442955 5:7797561-7797583 TATGAAGTCTGGCACACAGCAGG + Intronic
987673407 5:21044268-21044290 CCTGGAGTCAGGCGCTGAGCAGG + Intergenic
990475995 5:56162329-56162351 CTAGAAGTCAGCCTCAGAGCAGG - Intronic
991649382 5:68836586-68836608 CACGAAGTCAGGCTCATTCCTGG + Intergenic
995831592 5:116361137-116361159 CAGGGAGTCTGGCCCAGAGCCGG + Intronic
996707166 5:126509065-126509087 CAGGAAGTCAGCTTCACAGCAGG + Intergenic
998311872 5:141140606-141140628 CATGAAGTCTGGCTCCAACCGGG + Intronic
999075633 5:148792917-148792939 CAAGAAGCCTGACTCAGAGCAGG - Intergenic
999125213 5:149241247-149241269 CATGAAGGCAGGATCTGGGCTGG - Intronic
999462205 5:151767381-151767403 TATGAAAACAGGCTCAGAGAGGG - Intronic
1001307810 5:170588558-170588580 GAGAAAGGCAGGCTCAGAGCAGG + Intronic
1003173531 6:3738312-3738334 CATGGAATGAGGCTTAGAGCAGG - Intronic
1005154072 6:22783635-22783657 CAAGAAGTCTGGCACAGATCTGG - Intergenic
1005654685 6:27923140-27923162 CATGATGTAATGCACAGAGCAGG - Intergenic
1006479731 6:34282303-34282325 CAGAAAGACAGGCTCAGATCAGG + Exonic
1007177484 6:39906755-39906777 CAGGAAGCCAGACACAGAGCGGG - Exonic
1007725845 6:43915173-43915195 CAGGAAGGCAGGCTGAGAGTGGG - Intergenic
1010560608 6:77344338-77344360 CTTGAAGTCAGGGTCACATCAGG + Intergenic
1013426834 6:110019627-110019649 AGGGAAGTCAGGGTCAGAGCTGG + Intergenic
1016809287 6:148244174-148244196 CATGGATGCAGGCTTAGAGCTGG - Intergenic
1018908882 6:168090529-168090551 CATGAATGCAGCATCAGAGCCGG - Intergenic
1018925801 6:168206294-168206316 CATGAAGTCAGGCTTCAGGCTGG + Intergenic
1019616458 7:1965096-1965118 CATGGTGTCTGGCTCACAGCAGG + Intronic
1019785504 7:2974571-2974593 CATTCAGTCAACCTCAGAGCAGG + Intronic
1022324784 7:29321429-29321451 GAGGAAGCCAGGCACAGAGCAGG + Intronic
1022753511 7:33258691-33258713 CAGGAGGTGAGGCACAGAGCTGG - Intronic
1024396240 7:48870870-48870892 CATGAAGTCAGGTATATAGCAGG - Intergenic
1024541330 7:50477273-50477295 CCTGAATGCAGGCTCAGAGACGG + Intronic
1024862082 7:53856412-53856434 AATGATGTTAGTCTCAGAGCTGG - Intergenic
1025810720 7:64873815-64873837 CATGAAGTCAGGAAAAGAGAAGG - Intronic
1026915492 7:74117590-74117612 CATGAACACAGGTTCAGGGCAGG + Intronic
1027675295 7:81150059-81150081 CATGTATACATGCTCAGAGCTGG + Intergenic
1029124200 7:98285864-98285886 CCTGAAGCCATGCTCAGCGCAGG - Intronic
1029528535 7:101110063-101110085 GATGAAGTCTGGTTAAGAGCTGG + Intergenic
1029848660 7:103440139-103440161 CATGAAGTCAGGGGCATAGGGGG + Intronic
1030074172 7:105722179-105722201 CATGAAGACAGGCTGAGGGCAGG + Intronic
1031834217 7:126662917-126662939 CATGAAGCCAGGCACGAAGCTGG + Intronic
1031973019 7:128077376-128077398 CATCAAGCCAGGCACAGACCAGG - Intronic
1033528441 7:142240420-142240442 CATGGAGTAAGGCTCAGAAGGGG + Intergenic
1034728197 7:153360138-153360160 CATCTGGACAGGCTCAGAGCTGG + Intergenic
1035422470 7:158741190-158741212 CAGGAAGACAGACGCAGAGCTGG - Intronic
1035472729 7:159120407-159120429 CATGAAGGCAGGGACAGAGGGGG + Intronic
1035693954 8:1579961-1579983 CATCAGGTCAGGTGCAGAGCTGG - Intronic
1038431749 8:27505790-27505812 CCTGGAGTCAGCCTCAGAGCAGG + Intronic
1038577398 8:28717024-28717046 CATGAAGTTGGGCTCAGACATGG - Exonic
1039522588 8:38183972-38183994 CGTTAAGTCAGGATCTGAGCAGG + Intronic
1039934916 8:42034006-42034028 CTTGAAGTCAGCCTGGGAGCAGG + Intronic
1044556966 8:93573402-93573424 CATGAAGTCAGGGAAAGAGAAGG - Intergenic
1047677965 8:127223630-127223652 CATGATGTCAGGCTCCTAGTAGG + Intergenic
1047722038 8:127649987-127650009 CATGAACCCAGATTCAGAGCTGG + Intergenic
1049148633 8:141020184-141020206 CAGGTGGACAGGCTCAGAGCAGG - Intergenic
1049356662 8:142192558-142192580 CATGAAGGCAGCCTCAGCACTGG + Intergenic
1050062200 9:1721153-1721175 CAGCTAGTCAGGCGCAGAGCAGG - Intergenic
1050417220 9:5430249-5430271 CATGAAGTCAGGGTCTGTGAAGG - Intronic
1050737272 9:8778494-8778516 CATGAAGTCAGTTTCAGTGTTGG - Intronic
1051497145 9:17736030-17736052 CAGGAAGTCAGCCCCAGTGCAGG + Intronic
1052741346 9:32395634-32395656 GATGAGGTCAGGCTCAGGGCCGG + Intronic
1053481586 9:38420299-38420321 CATGAACTGAGGCTCAGAGGTGG - Intronic
1053598376 9:39585953-39585975 CATGCAGTCAGACTCATGGCAGG - Intergenic
1053856409 9:42342962-42342984 CATGCAGTCAGACTCATGGCAGG - Intergenic
1055357371 9:75451274-75451296 GATGATGTGGGGCTCAGAGCAGG - Intergenic
1055925940 9:81509826-81509848 CATGAAGTCCTTCTCAGGGCAGG - Intergenic
1056729619 9:89154384-89154406 CATGCATTCCGGCTCAGAGTTGG - Intronic
1057114982 9:92512565-92512587 GATGGAGACAGGCTCAGAGGAGG - Intronic
1057184497 9:93049401-93049423 CATGGGGCCAGGCACAGAGCAGG - Intergenic
1057196748 9:93119806-93119828 CCAGAAGTCAGGGTCAGAGCTGG + Intergenic
1057305987 9:93912303-93912325 CATGAATCCAGGCCCAGGGCAGG + Intergenic
1057797872 9:98171415-98171437 CATGGCATCAGGCTCAGAGTGGG - Intronic
1059465473 9:114466559-114466581 CATCAAGTCAGAGGCAGAGCTGG - Intronic
1061000215 9:127898747-127898769 GACGAAGTCAGGCTCAGCCCTGG - Intronic
1061060245 9:128246646-128246668 CATGATGTCTAGCTCAAAGCAGG - Intronic
1061544056 9:131293678-131293700 CAGCAAGTAAGGGTCAGAGCAGG - Intronic
1061875912 9:133543899-133543921 CTTGAAGACAGGCTCTGAGCTGG + Intronic
1186564366 X:10646334-10646356 CTTGAAGTCAGGCAAAAAGCTGG - Intronic
1186885080 X:13904888-13904910 GATAGAGTGAGGCTCAGAGCAGG + Intronic
1187777379 X:22777069-22777091 TATGATGTCAGGCACGGAGCAGG - Intergenic
1188438395 X:30189340-30189362 CATGGGATCAGGCTCAGAGTGGG - Intergenic
1189492719 X:41482532-41482554 CCTGAACACAGTCTCAGAGCGGG - Intergenic
1195959731 X:110373389-110373411 CATAAAACCTGGCTCAGAGCAGG + Intronic
1196248089 X:113424517-113424539 CATGAAGTAATACTCAGAGTAGG + Intergenic
1198079762 X:133228128-133228150 CAGGAAGTCAGGCTGGGAGCTGG + Intergenic
1198631994 X:138650084-138650106 CATGAGTTCAGGCTGAGACCTGG - Intronic
1199257328 X:145731726-145731748 CACGTAGTCAAGGTCAGAGCTGG - Intergenic
1199852667 X:151736687-151736709 CAGGCAGTCAGGCTCAGGGACGG + Intergenic