ID: 1124896293

View in Genome Browser
Species Human (GRCh38)
Location 15:33780352-33780374
Sequence ATGGGTTGATGACCTTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 822
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 802}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124896293_1124896299 -2 Left 1124896293 15:33780352-33780374 CCCCTCAAAGGTCATCAACCCAT 0: 1
1: 0
2: 0
3: 19
4: 802
Right 1124896299 15:33780373-33780395 ATTTCATGTGCTGAGAGGAGAGG 0: 1
1: 0
2: 1
3: 26
4: 304
1124896293_1124896301 13 Left 1124896293 15:33780352-33780374 CCCCTCAAAGGTCATCAACCCAT 0: 1
1: 0
2: 0
3: 19
4: 802
Right 1124896301 15:33780388-33780410 AGGAGAGGAGCCACACAGGCAGG 0: 1
1: 0
2: 4
3: 51
4: 427
1124896293_1124896302 14 Left 1124896293 15:33780352-33780374 CCCCTCAAAGGTCATCAACCCAT 0: 1
1: 0
2: 0
3: 19
4: 802
Right 1124896302 15:33780389-33780411 GGAGAGGAGCCACACAGGCAGGG 0: 1
1: 0
2: 6
3: 41
4: 476
1124896293_1124896296 -7 Left 1124896293 15:33780352-33780374 CCCCTCAAAGGTCATCAACCCAT 0: 1
1: 0
2: 0
3: 19
4: 802
Right 1124896296 15:33780368-33780390 AACCCATTTCATGTGCTGAGAGG 0: 1
1: 0
2: 1
3: 7
4: 142
1124896293_1124896300 9 Left 1124896293 15:33780352-33780374 CCCCTCAAAGGTCATCAACCCAT 0: 1
1: 0
2: 0
3: 19
4: 802
Right 1124896300 15:33780384-33780406 TGAGAGGAGAGGAGCCACACAGG 0: 1
1: 0
2: 0
3: 34
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124896293 Original CRISPR ATGGGTTGATGACCTTTGAG GGG (reversed) Intronic
901829332 1:11882526-11882548 AAGGGCTGAGGAGCTTTGAGGGG - Intergenic
902919028 1:19655678-19655700 ATGGGCTGAAGTCCTTTCAGGGG + Intronic
905504864 1:38469938-38469960 ATGAGTTCATGCCCTTTGTGGGG - Intergenic
905888482 1:41504681-41504703 AGGAGTGAATGACCTTTGAGGGG - Intergenic
905896493 1:41549184-41549206 ATGAGTTCATGTCCTTTGTGGGG - Intronic
905963380 1:42065041-42065063 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
905965839 1:42094463-42094485 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
906574696 1:46877339-46877361 ATCTGGTGATGATCTTTGAGAGG - Intergenic
906597277 1:47090565-47090587 ATCTGGTGATGATCTTTGAGAGG + Intronic
906890739 1:49710269-49710291 ATGAGTTCATGTCCTTTGAAGGG + Intronic
906891046 1:49715276-49715298 ATGAGTACATGTCCTTTGAGGGG - Intronic
906893782 1:49748322-49748344 ATGAGTTCATGTCCTTTGAAGGG - Intronic
907143702 1:52212889-52212911 ATTGGGAGATGACATTTGAGTGG + Intronic
907821986 1:57979244-57979266 ATGAGTTCATGCCCTTTGCGGGG + Intronic
907837726 1:58126769-58126791 ATGGGTTCATGTCCTTTGTAGGG - Intronic
907840348 1:58151003-58151025 ATGGGTTCATGTCCTTTGTAGGG - Intronic
907860669 1:58349769-58349791 ATGAGTTCATGTCCTTTGAAGGG - Intronic
907992052 1:59592615-59592637 ATGAGTTCATGTCCTTTGTGGGG + Intronic
908610662 1:65856492-65856514 ATGAGTTCATGTCCTTTGAAGGG - Intronic
908665630 1:66486619-66486641 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
908681358 1:66665283-66665305 ATGGGTTCATGTCCTTTGCAGGG - Intronic
908692177 1:66794772-66794794 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
908925629 1:69251040-69251062 ATAGGTTGTTGACTTTTTAGAGG + Intergenic
908955916 1:69626884-69626906 ATGAGTTCATGTCCTTTGTGGGG - Intronic
909217200 1:72904760-72904782 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
909368730 1:74859921-74859943 ATGGGTTGATAAAGTTTGGGGGG - Intergenic
909449606 1:75784107-75784129 ATGAGTTCATGTCCTTTGTGGGG + Intronic
909668612 1:78163767-78163789 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
909747860 1:79121376-79121398 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
909944284 1:81646109-81646131 ATGGCCTCATGACCTTTGTGGGG + Intronic
910282256 1:85514214-85514236 ATGGGTTCATGTCCTTTGCAGGG + Intronic
910707337 1:90143803-90143825 TTAAGATGATGACCTTTGAGTGG + Intergenic
910954596 1:92688213-92688235 ATGGGTTCATGTCCTTTGCAGGG + Intronic
911139562 1:94484466-94484488 ATGAGTTCATGTCCTTTGTGGGG + Intronic
911458748 1:98161861-98161883 ATGGGTTCATGTCCTTTGTAAGG + Intergenic
911787701 1:101971048-101971070 CTGTTTTGATGACTTTTGAGTGG + Intronic
911929415 1:103883233-103883255 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
911974738 1:104477559-104477581 ATGTGTTCATGTCCTTTGAAAGG - Intergenic
913388641 1:118286580-118286602 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
913506404 1:119520024-119520046 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
914980337 1:152409737-152409759 ATGGGTTGATGACCACTCAAGGG - Exonic
915008909 1:152666342-152666364 ATGAGTTCATGTCCTTTGGGGGG - Intergenic
915997871 1:160582681-160582703 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
916645308 1:166778880-166778902 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
917053536 1:170952430-170952452 ATGAGTTCATGTCCTTTGTGGGG + Intronic
917355900 1:174125778-174125800 ATGAGATCATGTCCTTTGAGGGG - Intergenic
917718798 1:177765212-177765234 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
918631481 1:186724157-186724179 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
919377612 1:196814375-196814397 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
919387126 1:196936272-196936294 ATGAGTTCATGTCCTTTGAAGGG - Intronic
921489180 1:215753491-215753513 ATGAGTTCATGTCCTTTGTGGGG + Intronic
922383328 1:225055846-225055868 ATGAGTTCATGTCCTTTGTGGGG - Intronic
922390516 1:225137287-225137309 TGAGGTTGCTGACCTTTGAGTGG + Intronic
924179446 1:241425291-241425313 ATGGGTTCATATCCTTTGCGGGG - Intergenic
1063761088 10:9077794-9077816 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1063893710 10:10656551-10656573 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1064470585 10:15631396-15631418 ATGAGTTCATGTCCTTTGCGGGG + Intronic
1065051541 10:21797643-21797665 ATGGGTTAATGACCTTATGGCGG + Intronic
1065946561 10:30610373-30610395 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1066502581 10:36008422-36008444 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1066516201 10:36163547-36163569 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1066599423 10:37088593-37088615 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1066638435 10:37531316-37531338 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1066639730 10:37543770-37543792 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1067153682 10:43757027-43757049 ATGAGTTGATGTCCTTTGCAGGG - Intergenic
1067261217 10:44693529-44693551 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1067365020 10:45618706-45618728 ATGGTTTGATGAACTGTCAGTGG - Intronic
1067770978 10:49125171-49125193 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1068169564 10:53375902-53375924 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1068274279 10:54772944-54772966 ATGAGATCATGACCTTTGAAGGG + Intronic
1068285935 10:54934909-54934931 ATGAGTTCATGTCCTTTGAAGGG + Intronic
1068338982 10:55676500-55676522 ATGAGTTCATGACCTTTGCAGGG - Intergenic
1068467863 10:57418253-57418275 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1068513382 10:57995071-57995093 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1068652111 10:59534032-59534054 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1069302786 10:66928629-66928651 ATGGGTTGATTATGTATGAGAGG - Intronic
1069353205 10:67554070-67554092 ATGGGTTGATGTCCTTTGTAGGG - Intronic
1069354174 10:67564323-67564345 ATGGGTTGATGTCCTTTGTAGGG + Intronic
1069355388 10:67579364-67579386 ATGGGTTGATGTCCTTTGTAGGG - Intronic
1070377671 10:75849433-75849455 ATGAGATCATGTCCTTTGAGGGG + Intronic
1070394003 10:75996012-75996034 ATGGGTTGGTGAGTTTGGAGAGG - Intronic
1071481300 10:86067043-86067065 ATGGTTTGAGGACCATTAAGGGG - Intronic
1071720830 10:88144640-88144662 CTGGGTTTATGTCCTTTGCGTGG - Intergenic
1072288706 10:93942137-93942159 ATGGGTTGATGGTTTTTGACAGG - Intronic
1073464530 10:103686574-103686596 AGGAGGTGATGCCCTTTGAGGGG - Intronic
1073914035 10:108381241-108381263 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1073941154 10:108699960-108699982 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
1073975633 10:109097603-109097625 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1074255102 10:111794235-111794257 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1074337824 10:112595992-112596014 ATGGGTTCATGTCCTTTGTAGGG + Intronic
1075363983 10:121866356-121866378 CTGGGTTTATGACATTGGAGAGG - Intronic
1076089410 10:127668681-127668703 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
1076097839 10:127746959-127746981 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1077768374 11:5187269-5187291 ATGGTTTCAAGACCTTTGAATGG - Intergenic
1078336946 11:10472123-10472145 ATGGGTTCATGTCCTTTGCAGGG + Intronic
1079125410 11:17714875-17714897 ATGGGCTGAGGGACTTTGAGGGG - Intergenic
1079344912 11:19643475-19643497 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1079461981 11:20689596-20689618 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1079518298 11:21293760-21293782 ATGGGTTCATGTCCTTTGCCAGG + Intronic
1079544389 11:21615047-21615069 ATGGGTAGATGACATTGGAAGGG - Intergenic
1079821879 11:25141724-25141746 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1079864564 11:25718899-25718921 ATGAGTTGATGTCCTTTGTAGGG - Intergenic
1080095232 11:28397918-28397940 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1080140363 11:28911210-28911232 ATAGCTTGGTGACATTTGAGAGG - Intergenic
1080211180 11:29787394-29787416 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1080212228 11:29799461-29799483 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1080982750 11:37428207-37428229 ATGAGTTCATGACCTTTGTAGGG - Intergenic
1080999870 11:37655726-37655748 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1081142668 11:39521805-39521827 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1081165006 11:39797780-39797802 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1081681827 11:45011725-45011747 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1081723696 11:45309836-45309858 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1081790944 11:45784272-45784294 ATGAGTTCATGACCTTTGCAGGG + Intergenic
1082184405 11:49162745-49162767 TGAGGTTGGTGACCTTTGAGTGG + Intronic
1082885135 11:58073963-58073985 ATGAGTTCATGTCCTTTGCGAGG - Intronic
1083373142 11:62197580-62197602 ATGAGTTCATGACCTTTGCAGGG - Intergenic
1083515608 11:63255514-63255536 ATGGGTTCATGTCCTTTGTAGGG - Intronic
1085828191 11:79870524-79870546 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1085988749 11:81814106-81814128 ATGAGATGATGTCCTTTGATGGG + Intergenic
1086570524 11:88278868-88278890 ATGAGATCATGTCCTTTGAGGGG + Intergenic
1086599249 11:88612278-88612300 ATGGGTTCATGTCCTTTGTAGGG - Intronic
1086640947 11:89155310-89155332 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1086681943 11:89682623-89682645 TGAGGTTGGTGACCTTTGAGTGG - Intergenic
1086758187 11:90592169-90592191 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1086805403 11:91235191-91235213 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1087100987 11:94364576-94364598 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1087103729 11:94390000-94390022 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1087103925 11:94392153-94392175 ATGAGTTCATGTCCTTTGCGGGG + Intronic
1087413283 11:97820212-97820234 ATGTGTTGAGGACATTTCAGAGG + Intergenic
1087560552 11:99784459-99784481 ATGGGTTCATGTCCTTTGCAGGG - Intronic
1088303024 11:108379307-108379329 ATGGGTTCATGTCCTTTGTAGGG + Intronic
1088681163 11:112243033-112243055 ATGAGTTCATGTCCTTTGCGGGG + Intronic
1088970372 11:114769641-114769663 ATGGGTTCATGTCCTTTGCAAGG + Intergenic
1089415636 11:118287502-118287524 ATGGGTATATGCCATTTGAGTGG - Intergenic
1090680484 11:129050952-129050974 ATGGGTTCATGTCCTTTGCAGGG - Intronic
1090812188 11:130254904-130254926 ATGGGTTCATGTCCTTTGCAGGG + Intronic
1091245401 11:134089619-134089641 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1091438040 12:488995-489017 ATGGGTTCATGTCCTTTGCAGGG + Intronic
1092000652 12:5029296-5029318 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1092322780 12:7496155-7496177 ATGAGTTTATGTCCTTTGAAGGG + Intronic
1092638006 12:10472973-10472995 ATGAGTTCATGACCTTTGTAGGG - Intergenic
1093678143 12:21968035-21968057 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1093827411 12:23710551-23710573 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1094036424 12:26076576-26076598 ATGAGTTGATGTCCTTTGCAGGG - Intronic
1094073852 12:26450818-26450840 AGGGGTTGAGAACCTTAGAGTGG + Intronic
1094112954 12:26880778-26880800 ATGAGTTGATGTCCTTTGCAGGG - Intergenic
1094275773 12:28673302-28673324 ATGAGTTCATGACCTTTGTAGGG - Intergenic
1094280910 12:28736806-28736828 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
1095060944 12:37687436-37687458 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1095077717 12:37952663-37952685 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1095325571 12:40887844-40887866 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1095661988 12:44747129-44747151 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1095799007 12:46252168-46252190 ATGAGTTCATGTCCTTTGAAGGG + Intronic
1095845787 12:46742809-46742831 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1095866130 12:46974102-46974124 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1096960832 12:55575484-55575506 ATGAGTTGATGTCCTTTGTAGGG + Intergenic
1098294075 12:68986154-68986176 ATGGGCTGATTAGCTTTGGGTGG + Intergenic
1098798810 12:74926859-74926881 ATGAGTTCATGTCCTTTGAATGG + Intergenic
1098820257 12:75218924-75218946 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1099018108 12:77370093-77370115 ATGAGTTCATGACCTTTGCAGGG - Intergenic
1099047987 12:77747713-77747735 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1099303629 12:80928018-80928040 ATGAGTTGATGTCCTTTGCAGGG - Intronic
1099423500 12:82494093-82494115 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1099460968 12:82920461-82920483 ATGGTTTGATGTTCTTTGAAAGG - Intronic
1099485738 12:83227148-83227170 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1099488717 12:83260287-83260309 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1099524301 12:83700188-83700210 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1099534732 12:83829354-83829376 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1099625626 12:85069251-85069273 ATGGGTTCATGTCCTTTGTGGGG - Intronic
1099886977 12:88543422-88543444 ATGAGTTCATGTCCTTTGAAGGG - Intronic
1099892783 12:88610236-88610258 ATGAGTTTATGACCTTTGCTGGG + Intergenic
1100022688 12:90089425-90089447 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1100653482 12:96616192-96616214 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1102153685 12:110706827-110706849 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1102730055 12:115100962-115100984 ATGAGTTCATGTCCTTTGCGAGG + Intergenic
1102753642 12:115319059-115319081 ATGAGTTCATGACCTTTGCAGGG + Intergenic
1102755910 12:115340226-115340248 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1104129250 12:125876978-125877000 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1106545029 13:30723259-30723281 ATGTGTTGATGATTTTTGTGAGG + Intronic
1106839545 13:33672195-33672217 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1107222501 13:38001527-38001549 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1107805434 13:44149431-44149453 ATGAGTTAATGTCCTTTGTGGGG + Intronic
1108074262 13:46662681-46662703 ATTGGTTGCTGACCGTTGGGGGG + Intronic
1108188590 13:47913779-47913801 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1108295563 13:49013908-49013930 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1108307482 13:49152829-49152851 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1108309571 13:49174094-49174116 ATGGGGTGACGATCTTTGATAGG - Intronic
1108593483 13:51931319-51931341 ATGAGTTGATGTCCTTTGCAGGG + Intergenic
1108806050 13:54157810-54157832 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1109399648 13:61808741-61808763 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1109539035 13:63748786-63748808 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1109544809 13:63831043-63831065 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1109867463 13:68284243-68284265 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1109870614 13:68327640-68327662 ATGAGTTGATGTCCTTTGTAGGG - Intergenic
1110122000 13:71894152-71894174 ATGAGTTGATGTCCTTTGTAGGG + Intergenic
1110154154 13:72293670-72293692 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1110186106 13:72676622-72676644 ATGAGTTGATGTCCTTTGTAGGG + Intergenic
1110257996 13:73453295-73453317 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1110364176 13:74662644-74662666 ATGAGTTTATGTCCTTTGCGGGG - Intergenic
1110534716 13:76638073-76638095 ATAGGTTGGTGCCCTCTGAGTGG - Intergenic
1111142256 13:84134511-84134533 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1111252169 13:85615764-85615786 ATGAGTTCATGACCTTTGCAGGG - Intergenic
1111257900 13:85696693-85696715 ATGAGTTTATGTCCTTTGAAGGG - Intergenic
1111281003 13:86024945-86024967 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1111402805 13:87763030-87763052 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1111782162 13:92741896-92741918 ATGGGTTCATGTCCTTTGTAGGG - Intronic
1111839077 13:93426548-93426570 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1111874853 13:93880395-93880417 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1111952348 13:94718869-94718891 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1111953499 13:94730569-94730591 ATGAGTTGATGTCCTTTGCAGGG + Intergenic
1113348273 13:109502619-109502641 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1114880436 14:26778208-26778230 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1114904160 14:27103600-27103622 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1114952878 14:27779257-27779279 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1115036626 14:28865112-28865134 ATGCGTTCATGTCCTTTGAAGGG - Intergenic
1115873896 14:37838964-37838986 ATGGGTTCATGTCCTTTGCAGGG - Intronic
1115881105 14:37920356-37920378 ATGAGTTTATGTCCTTTGTGGGG - Intronic
1116527636 14:45926785-45926807 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1116615341 14:47129402-47129424 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1116994868 14:51312534-51312556 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1118094967 14:62526192-62526214 ATGAGTTCATGACCTTTGTAGGG + Intergenic
1119013297 14:71020093-71020115 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1119184294 14:72628530-72628552 ATCTATTGATGACCTTTGACTGG - Intronic
1119896551 14:78224586-78224608 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1120149728 14:81019770-81019792 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1120218569 14:81706740-81706762 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1120508885 14:85388329-85388351 ATGACTTGATGAACTTAGAGAGG - Intergenic
1120548079 14:85834507-85834529 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1122467170 14:101941740-101941762 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1122592633 14:102866108-102866130 ATGAGTTCATGACCTTTGCAGGG + Intronic
1123388539 15:19845383-19845405 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1124896293 15:33780352-33780374 ATGGGTTGATGACCTTTGAGGGG - Intronic
1126127879 15:45312709-45312731 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1126128604 15:45318991-45319013 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1126202287 15:46000251-46000273 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1126243585 15:46475067-46475089 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1126248233 15:46536552-46536574 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1126972089 15:54127385-54127407 ATGAGTTCATGACCTTTGCAGGG + Intronic
1127168771 15:56276489-56276511 ATGGGTTCATGTCCTTTGCAGGG - Intronic
1127337199 15:57999893-57999915 ATGGGATCATGACCTTTGCAGGG + Intronic
1127718946 15:61680975-61680997 ATTAGTTGATGCCCTTTGGGTGG - Intergenic
1128012725 15:64313430-64313452 ATGGGTTCATGTCCTTTGCAGGG + Intronic
1130453181 15:84078206-84078228 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1130934355 15:88456025-88456047 TTGGGTTGCTGACCTTTCAGCGG + Intergenic
1131083678 15:89557502-89557524 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1131941410 15:97570167-97570189 ATGAGTTAATGTCCTTTGTGGGG - Intergenic
1132078578 15:98845274-98845296 AGGGCATGATAACCTTTGAGGGG + Intronic
1132224645 15:100131047-100131069 ATGGGTTCATGTCCTTTGCAGGG + Intronic
1133826884 16:9285869-9285891 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1135870258 16:26143345-26143367 ATGAGTTCATGTCCTTTGAGGGG - Intergenic
1135978324 16:27126154-27126176 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1137285354 16:47011353-47011375 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1137326562 16:47443578-47443600 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1137528888 16:49263675-49263697 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1138326535 16:56176097-56176119 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1138701982 16:58873450-58873472 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1138765855 16:59602349-59602371 ATGGCTTTATGACCTTTGGCTGG + Intergenic
1139130394 16:64135646-64135668 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
1139258271 16:65564283-65564305 ATGAGTTCATGACCTTTGCAGGG - Intergenic
1139385668 16:66567467-66567489 ATGAGTTCATGTCCTTTGCGGGG - Intronic
1140147944 16:72330350-72330372 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1140668864 16:77254645-77254667 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1141048425 16:80738177-80738199 ATGGGTTCATGTCCTTTGCAGGG - Intronic
1141297888 16:82786815-82786837 ATGAGTTCATGACCTTTGTAGGG - Intronic
1141610850 16:85180352-85180374 CTCGGTGGGTGACCTTTGAGGGG - Intronic
1142931321 17:3286226-3286248 ATGAGTTCATGACCTTTGCAGGG - Intergenic
1144456214 17:15420886-15420908 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1146260108 17:31415417-31415439 ATGGCTTGGGGACCTTGGAGTGG - Intronic
1149134409 17:53347345-53347367 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1149939990 17:60854209-60854231 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1150626525 17:66845122-66845144 ATGAGTTCATGTCCTTTGCGGGG + Intronic
1153114734 18:1641491-1641513 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1153129995 18:1844578-1844600 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1153138989 18:1950271-1950293 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
1153572932 18:6491591-6491613 ATGGGTTGATGTTTTTTTAGGGG - Intergenic
1154401061 18:14037905-14037927 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1155559707 18:27062472-27062494 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1155837467 18:30603972-30603994 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1156043936 18:32856964-32856986 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1157080839 18:44523407-44523429 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1157086215 18:44582502-44582524 ATGGGATGATGGCCTTTTTGTGG + Intergenic
1158058952 18:53315274-53315296 ATGGGTTCATGTCCTTTGCAGGG - Intronic
1158486764 18:57874191-57874213 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1158765520 18:60446480-60446502 TGGGGTTGCTGACCTTTGAATGG + Intergenic
1158833964 18:61310910-61310932 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1159313496 18:66739940-66739962 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1160230059 18:77041608-77041630 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1160351516 18:78185110-78185132 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1160466219 18:79078972-79078994 ATGAGTTCATGTCCTTTGCGTGG - Intronic
1161992542 19:7692992-7693014 AGGTGTTGCTGACCTTGGAGGGG - Intronic
1165295691 19:34924213-34924235 ATGGAGTGATCACTTTTGAGGGG + Intergenic
1166591128 19:44000222-44000244 ATGGGTTCATGTCCTTTGTATGG - Intergenic
1167275753 19:48538227-48538249 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1168372213 19:55845337-55845359 ATGAGTTCATGTCCTTTGTGGGG - Intronic
925213258 2:2069383-2069405 ATGAGTTCATGTCCTTTGAAGGG - Intronic
925657211 2:6162711-6162733 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
925698700 2:6611176-6611198 ATGAGTTGATGTCCTTTGTAGGG - Intergenic
925956689 2:8973199-8973221 ATGAGTTCATGTCCTTTGTGGGG + Intronic
926074172 2:9927181-9927203 ATGAGTTCATGACCTTTGCAGGG - Intronic
926534007 2:14087423-14087445 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
927409859 2:22812475-22812497 ATGTATTTATGACCTTTGAATGG + Intergenic
928457741 2:31438639-31438661 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
928462955 2:31492532-31492554 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
928463897 2:31502122-31502144 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
930323847 2:49888010-49888032 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
930959485 2:57242098-57242120 ATGAGTTCATGTCCTTTGAGGGG + Intergenic
931482255 2:62653309-62653331 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
931491167 2:62749296-62749318 ATGAGTTCATGTCCTTTGAAGGG - Intronic
933202214 2:79464294-79464316 ATGAGTTCATGTCCTTTGCGGGG - Intronic
933335725 2:80956334-80956356 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
933444904 2:82367509-82367531 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
934801885 2:97171381-97171403 ATGAGTTCATGTCCTTTGAAGGG + Intronic
934802456 2:97178508-97178530 ATGAGTTCATGTCCTTTGAAGGG + Intronic
935509744 2:103956518-103956540 ATGTGTTTATTACATTTGAGTGG - Intergenic
936173399 2:110196834-110196856 ATGAGTTCATGTCCTTTGAAGGG + Intronic
936553459 2:113471793-113471815 ATGGGTTCATGTCCTTTGTAGGG - Intronic
936781575 2:116039346-116039368 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
936839162 2:116748883-116748905 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
937519623 2:122696249-122696271 ATGAGTTTATGACCTTTGTAGGG - Intergenic
938303984 2:130237766-130237788 ATGAGTTGATGTCCTTTGTAGGG + Intergenic
938477769 2:131631811-131631833 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
938975597 2:136474493-136474515 ATGAGTTGATGTCCTTTGCAGGG + Intergenic
939190627 2:138912898-138912920 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
939351607 2:141045100-141045122 ATGAGTTCATGTCCTTTGTGGGG + Intronic
939353417 2:141070114-141070136 ATGAGTTCATGTCCTTTGTGGGG - Intronic
939424454 2:142016508-142016530 ATGAGTTCATGACCTTTGCAGGG + Intronic
939759019 2:146151437-146151459 ATGAGTTTATGTCCTTTGTGGGG - Intergenic
940029979 2:149251618-149251640 ATGGGTTCATGTCCTTTGCAAGG - Intergenic
940593506 2:155761062-155761084 ATGAGTTAATGTCCTTTGAAGGG + Intergenic
940694609 2:156962649-156962671 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
941214171 2:162685027-162685049 ATGAGTTCATGTCCTTTGCGGGG + Intronic
941524324 2:166587048-166587070 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
941779812 2:169431980-169432002 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
942227852 2:173832297-173832319 AACGGTTGAAGACCTTTGAGGGG + Intergenic
942429570 2:175896190-175896212 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
942490680 2:176486732-176486754 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
942538818 2:176994352-176994374 ATGAGTTCATGTCCTTTGCGAGG + Intergenic
942581990 2:177429466-177429488 TGAGGTTGCTGACCTTTGAGTGG + Intronic
942584490 2:177459995-177460017 ATGAGTTCATGTCCTTTGTGGGG + Intronic
942733128 2:179081182-179081204 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
942858893 2:180585929-180585951 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
942955386 2:181766942-181766964 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
942968799 2:181931416-181931438 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
943139946 2:183969917-183969939 ATGAGTTGATGTCCTTTGTAGGG - Intergenic
943159547 2:184230263-184230285 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
943161902 2:184265159-184265181 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
943324100 2:186477439-186477461 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
944009625 2:194958071-194958093 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
944056620 2:195528762-195528784 ATGAGTTGATGTCCTTTGTAGGG + Intergenic
944093525 2:195941201-195941223 ATGAGTTCATGTCCTTTGCGGGG + Intronic
944327111 2:198418990-198419012 ATGGGTTCATGTCCTTTGTAGGG - Intronic
944612675 2:201427482-201427504 ATGAGTTCATGTCCTTTGTGGGG - Intronic
944630368 2:201618390-201618412 ATGAGTTCATGTCCTTTGTGGGG + Intronic
945350723 2:208775964-208775986 ATGAGTTCATGACCTTTGTAGGG + Intronic
945353215 2:208806463-208806485 ATGGGTTCATGTCCTTTGTAGGG + Intronic
945574159 2:211509013-211509035 ATGGGTTCATGTCCTTTGCAGGG + Intronic
946511434 2:220361162-220361184 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
948021874 2:234740200-234740222 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
948240101 2:236423881-236423903 ATGAGTTCATGTCCTTTGAAGGG + Intronic
1168932983 20:1638931-1638953 ATGAGTTCATGTCCTTTGCGGGG - Intronic
1169702719 20:8466154-8466176 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1170246925 20:14231450-14231472 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1170247383 20:14237855-14237877 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1170455062 20:16524856-16524878 ATGAGTTGATGTCCTTTGCAGGG + Intronic
1170497979 20:16945373-16945395 AAGGGTAAATGACCTTAGAGAGG - Intergenic
1170529663 20:17278400-17278422 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1170795418 20:19542760-19542782 ATGGGTTTATGATCTCAGAGGGG - Intronic
1171065934 20:22015263-22015285 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1171065979 20:22015665-22015687 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1171434792 20:25113031-25113053 ATGAGTTTATGTCCTTTGTGGGG + Intergenic
1172866938 20:38107577-38107599 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1173011055 20:39182498-39182520 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1173301598 20:41808571-41808593 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1173776794 20:45715021-45715043 TGTGGTTGCTGACCTTTGAGTGG - Intergenic
1173969160 20:47137819-47137841 ATGGGTTCATGTCCTTTGTAGGG + Intronic
1175571921 20:60029796-60029818 ATGAGTTCATGTCCTTTGCGGGG - Intronic
1177568953 21:22860981-22861003 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1177678641 21:24335826-24335848 ATGAGTTGATGTCCTTTGTAGGG - Intergenic
1177849379 21:26328324-26328346 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1177877448 21:26651238-26651260 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1177924725 21:27199858-27199880 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1178184197 21:30200800-30200822 ATGAGTTGATGTCCTTTGCAGGG - Intergenic
1178813191 21:35903561-35903583 ATGAGTTGATGTCCTTTGCAGGG + Intronic
1179188662 21:39105190-39105212 ATGTATTGAAGCCCTTTGAGAGG - Intergenic
1181374376 22:22444230-22444252 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1182870844 22:33646265-33646287 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1182906455 22:33941673-33941695 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1183425703 22:37738265-37738287 ATGGATGGATGAACTTTGGGTGG + Intronic
949147395 3:719125-719147 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
950376239 3:12574594-12574616 ATGGTTTGAAGTCCTTTGTGTGG + Intronic
950596266 3:13985450-13985472 ATGAGTTCATGTCCTTTGTGGGG - Intronic
951390751 3:22100514-22100536 ATGAGTTCATGACCTTTGTAGGG + Intronic
951474180 3:23087624-23087646 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
952000110 3:28775292-28775314 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
952019386 3:28998740-28998762 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
952078464 3:29728036-29728058 ATGAGTTCATGTCCTTTGCGGGG + Intronic
952133021 3:30385989-30386011 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
952202764 3:31148221-31148243 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
953508317 3:43508624-43508646 ATGAGTTCATGTCCTTTGTGGGG + Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
954951072 3:54474228-54474250 ATGAGTTCATGTCCTTTGCGGGG + Intronic
955166713 3:56522005-56522027 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
956241560 3:67136317-67136339 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
956471786 3:69574666-69574688 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
956629963 3:71306739-71306761 ATGGATTGGTGACATTTGAAAGG - Intronic
957134194 3:76263899-76263921 ATGAGTTCATGTCCTTTGAAAGG + Intronic
957383852 3:79470240-79470262 ATGAGTTGATGTCCTTTGTAGGG + Intronic
957647682 3:82954140-82954162 ATGAGTTTATGTCCTTTGTGGGG - Intergenic
957780279 3:84810074-84810096 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
957962767 3:87280328-87280350 ATGAGTTGATGTCCTTTGCAGGG + Intergenic
958105611 3:89068919-89068941 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
958130541 3:89415091-89415113 CTGCCTTGATGACCTTTCAGAGG + Intronic
958589340 3:96134894-96134916 ATGGGTTGATGTTATTTGATTGG + Intergenic
958996374 3:100910089-100910111 ATGAGTTCATGTCCTTTGCGGGG + Intronic
959688744 3:109176240-109176262 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
959949200 3:112160580-112160602 ATGAGTTCATGTCCTTTGTGGGG - Intronic
959953331 3:112206673-112206695 ATGGGTTCATGTCCTTTGTAGGG + Intronic
961151774 3:124644637-124644659 ATGAGTTCATGTCCTTTGCGGGG - Intronic
961466605 3:127085592-127085614 ATGGGTTTATGAGCTCTGAGGGG - Intergenic
962818839 3:139026934-139026956 ATGGGTTCATGTCCTTTGTAGGG - Intronic
962829684 3:139129083-139129105 ATGGGGTGATGACATTGGAAGGG + Intronic
963109591 3:141676009-141676031 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
963316249 3:143762021-143762043 ATGGGTTCATGTCCTTTGTAGGG + Intronic
963679275 3:148353076-148353098 ATGGGTTCATGTCCTTTGTAAGG + Intergenic
963766117 3:149337689-149337711 ATGAGTTCATGTCCTTTGTGAGG + Intergenic
964560920 3:157995260-157995282 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
965147231 3:164922465-164922487 ATGGGTTCATGTCCTTTGTAAGG + Intergenic
965182859 3:165426866-165426888 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
965489500 3:169319254-169319276 ATGAGTTCATGTCCTTTGCGGGG + Intronic
966251585 3:177871454-177871476 ATGGGTTTATGTCCTTTGCAGGG + Intergenic
966532709 3:180998491-180998513 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
966673706 3:182561278-182561300 ATGGGTCTATGATCTCTGAGAGG - Intergenic
967198780 3:187052608-187052630 ATGAGTTCATGTCCTTTGTGGGG - Intronic
968095915 3:195930765-195930787 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
969807730 4:9623757-9623779 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
970154875 4:13131497-13131519 ATGAGTTGATGTCCTTTGTAGGG - Intergenic
970305524 4:14728019-14728041 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
970815129 4:20146207-20146229 ATGGGTTCATGTCCTTTGCAAGG + Intergenic
970864814 4:20746207-20746229 ATGAGTTCATGTCCTTTGTGGGG + Intronic
971000716 4:22319245-22319267 ATGAGTTGATGTCCTTTGCAGGG + Intergenic
971160584 4:24129826-24129848 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
971674796 4:29612384-29612406 ATGCGTTCATGTCCTTTGCGGGG - Intergenic
971768802 4:30869594-30869616 ATGGGTTCATGTCCTTTGCAGGG - Intronic
971771888 4:30907929-30907951 ATGAGTTCATGTCCTTTGTGGGG + Intronic
971814054 4:31464563-31464585 ATGGGCTGATTGGCTTTGAGTGG - Intergenic
971946895 4:33290135-33290157 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
971971766 4:33630351-33630373 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
972104891 4:35471441-35471463 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
972165728 4:36281845-36281867 CTTGGGTGATGACCTTTGTGAGG + Intronic
972958288 4:44419531-44419553 ATGAGTTCATGTCCTTTGAAGGG + Intronic
973305099 4:48638786-48638808 ATGTGTTCATGTCCTTTGCGGGG + Intronic
973540998 4:51935386-51935408 ATGAGTTGATGTCCTTTGTAGGG - Intergenic
973625541 4:52768484-52768506 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
974119302 4:57619644-57619666 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
974145967 4:57947917-57947939 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
974562352 4:63538220-63538242 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
975012441 4:69374195-69374217 ATGAGTTCATGTCCTTTGTGGGG + Intronic
975067542 4:70086576-70086598 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
975235115 4:71985540-71985562 ATGGGTCTATGATCTCTGAGAGG - Intergenic
975291735 4:72685410-72685432 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
975503652 4:75115308-75115330 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
975994822 4:80302076-80302098 ATGGGATCATGTCCTTTGCGTGG - Intronic
976493317 4:85697345-85697367 ATGAGTTCATGTCCTTTGTGGGG - Intronic
976684614 4:87798234-87798256 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
977448405 4:97161864-97161886 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
977464141 4:97362024-97362046 ATGAGTTCATGTCCTTTGTGGGG - Intronic
978188507 4:105885864-105885886 ATGAGTTCATGTCCTTTGTGGGG + Intronic
978275185 4:106940789-106940811 ATGGGTTCATGTCCTTTGTAAGG + Intronic
978743392 4:112164279-112164301 ATGAGTTCATGTCCTTTGTGAGG + Intronic
979048801 4:115903452-115903474 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
979117709 4:116848711-116848733 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
979487987 4:121290599-121290621 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
979687499 4:123526980-123527002 ATGGGTTGATGGTTTGTGAGAGG + Intergenic
979698387 4:123639886-123639908 ATGAGTTGATGTCCTTTGTAGGG - Intergenic
979750172 4:124269681-124269703 ATGAGTTCATGTCCTTTGTGAGG - Intergenic
979777728 4:124612244-124612266 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
980503474 4:133685488-133685510 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
980654774 4:135767342-135767364 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
981391846 4:144200140-144200162 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
981668706 4:147260339-147260361 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
982371293 4:154636723-154636745 ATGAGTTCATGTCCTTTGTGGGG + Intronic
982742106 4:159068340-159068362 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
983183143 4:164671928-164671950 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
983686304 4:170412899-170412921 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
984108628 4:175581166-175581188 ATGGGTTCATGTCCTTTGTGGGG - Intergenic
984433535 4:179679965-179679987 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
985430875 4:189878800-189878822 ATGAGTTGATGTCCTTTGTAGGG + Intergenic
986330087 5:6711611-6711633 ATGAGATCATGACCTTTGTGGGG - Intergenic
986479426 5:8170866-8170888 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
986542194 5:8856860-8856882 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
986659623 5:10047359-10047381 ATGTGATGGAGACCTTTGAGAGG - Intergenic
986820955 5:11466256-11466278 ATGGTTTTATGTCCTTTGGGAGG - Intronic
986866527 5:11995783-11995805 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
986915333 5:12613081-12613103 TGAGGTTGCTGACCTTTGAGTGG + Intergenic
987996572 5:25289960-25289982 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
988123490 5:26998408-26998430 ATGAGTTCATGTCCTTTGAAGGG + Intronic
988135527 5:27165744-27165766 ATGAGTTTATGTCCTTTGAAGGG - Intergenic
988352590 5:30130700-30130722 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
988724728 5:33915012-33915034 ATGAGTTTATGCCCTTTGCGGGG - Intergenic
988834906 5:35022403-35022425 ATGAGTTCATGTCCTTTGAAGGG + Intronic
988971310 5:36471112-36471134 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
989083537 5:37651273-37651295 ATGAGTTCATGTCCTTTGCGGGG - Intronic
989226999 5:39040147-39040169 ATGAGTTCATGTCCTTTGTGGGG + Intronic
989272882 5:39553473-39553495 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
989805545 5:45599239-45599261 ATGAGTTGATGTCCTTTGCAGGG + Intronic
989827414 5:45874610-45874632 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
989861648 5:46385546-46385568 ATGAGTTCATGACCTTTGTAGGG - Intergenic
989863736 5:46420207-46420229 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
990013229 5:51025673-51025695 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
990449269 5:55919648-55919670 ATGGTTTTATTACCTTTGAGGGG + Intronic
990612478 5:57471899-57471921 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
990627483 5:57630883-57630905 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
990685267 5:58293835-58293857 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
991110213 5:62891183-62891205 ATGAGTTGATGTCCTTTGCAGGG - Intergenic
991233796 5:64369140-64369162 ATGAGTTCATGTCCTTTGTGGGG + Intronic
991546337 5:67785833-67785855 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
992016754 5:72583126-72583148 ATGAGTTCATGACCTTTGTAGGG + Intergenic
992603899 5:78435536-78435558 ATGAGTTCATGTCCTTTGCGGGG - Intronic
993247895 5:85475344-85475366 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
993698029 5:91084909-91084931 ATGAGTTCATGTCCTTTGTGGGG + Intronic
993897156 5:93549794-93549816 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
994155329 5:96497171-96497193 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
994838090 5:104883191-104883213 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
994970314 5:106729697-106729719 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
995016367 5:107314120-107314142 TTGAGTTGCTGACCTTAGAGAGG + Intergenic
995302712 5:110602971-110602993 ATGAGTTCATGTCCTTTGTGGGG + Intronic
995325709 5:110887360-110887382 ATGAGTTCATGACCTTTGCAGGG - Intergenic
995746845 5:115413401-115413423 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
996960228 5:129237897-129237919 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
996986913 5:129578752-129578774 ATGAGTTCATGTCCTTTGTGGGG - Intronic
996989413 5:129610600-129610622 ATGAGTTCATGTCCTTTGTGGGG - Intronic
997060878 5:130501019-130501041 ATGAGTTGATGTCATTTGTGGGG - Intergenic
998247479 5:140520609-140520631 ATGAGTTCATGTCCTTTGTGGGG + Intronic
998555226 5:143116701-143116723 TTGGTCTGATGTCCTTTGAGAGG - Intronic
998907767 5:146924850-146924872 ATGAGTTGATGTCCTTTGCAGGG - Intronic
999469306 5:151837640-151837662 ATGAGTTCATGTCCTTTGTGGGG + Intronic
999805691 5:155079055-155079077 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
999862279 5:155661188-155661210 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
999953693 5:156677345-156677367 ATGGGTTCATGTCCTTTGCAGGG + Intronic
1000283728 5:159807340-159807362 ATGGGTTCATGTCCTTTGCAAGG + Intergenic
1000362354 5:160459728-160459750 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1001354465 5:171006426-171006448 ATGAGTTGATGTCCTTTGTAGGG + Intronic
1002127384 5:177056595-177056617 ATGGGTTCATGTCCTTTGTAGGG + Intronic
1002967337 6:1979042-1979064 ATGAGTTGCTGACCTTTGGATGG - Intronic
1003531968 6:6944657-6944679 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1003819216 6:9877267-9877289 ATGGGTTCATGTCCTTTGCAGGG - Intronic
1004035628 6:11920295-11920317 ATGGCATGATGTGCTTTGAGAGG + Intergenic
1004785916 6:18967078-18967100 ATGAGTTCATGACCTTTGTAGGG - Intergenic
1005222042 6:23598064-23598086 ATGAGTTCATGACCTTTGTAGGG + Intergenic
1006048698 6:31322254-31322276 TGAGGTTGCTGACCTTTGAGTGG - Intronic
1006894612 6:37459345-37459367 ACGAGTTGATGACTTTTGACTGG + Intronic
1006999761 6:38299167-38299189 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1007195472 6:40056322-40056344 TAAGGTTGTTGACCTTTGAGTGG - Intergenic
1008175656 6:48265081-48265103 ATGAGTTCATGTCCTTTGAAAGG - Intergenic
1008350900 6:50489020-50489042 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1008715223 6:54280875-54280897 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1008737716 6:54566183-54566205 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1009727225 6:67551209-67551231 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1009742672 6:67767596-67767618 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1009818535 6:68769368-68769390 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1010321467 6:74515090-74515112 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1010355852 6:74932306-74932328 ATGGTTTCATTACCTTTGATAGG - Intergenic
1010508414 6:76688180-76688202 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
1010592861 6:77730938-77730960 ATGGGTTCATGTCCTTTGTAGGG - Intronic
1010878247 6:81136373-81136395 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1010913508 6:81587556-81587578 ATGAGTTCATGTCCTTTGAAGGG - Intronic
1011024873 6:82856755-82856777 ATGAGTTCATGACCTTTGTAGGG + Intergenic
1011105316 6:83773180-83773202 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1011718219 6:90128892-90128914 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1011848385 6:91594637-91594659 ATGAGTTCATGTCCTTTGAACGG + Intergenic
1011985343 6:93436725-93436747 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1012115965 6:95299042-95299064 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1012391938 6:98751384-98751406 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
1012502134 6:99900131-99900153 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1012590251 6:100971440-100971462 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1012627712 6:101424480-101424502 ATGGGTTCATGTCCTTTGTAGGG - Intronic
1013906664 6:115227891-115227913 ATGAGTTCATGACCTTTGTAGGG + Intergenic
1013950680 6:115777789-115777811 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1014062568 6:117090145-117090167 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
1014485674 6:121996269-121996291 ATGAGTTCATGACCTTTGTAGGG - Intergenic
1014585096 6:123188295-123188317 ATGAGTTCATGTCCTTTGACAGG + Intergenic
1014784891 6:125607611-125607633 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1015214066 6:130729877-130729899 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1015696051 6:135981114-135981136 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1016106076 6:140163961-140163983 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1016155624 6:140804400-140804422 ATTTGTTAATGACCTTTGAGAGG + Intergenic
1016412366 6:143796721-143796743 ATGAGTTGATGTCCTTTGCAGGG - Intronic
1016617020 6:146062173-146062195 ATGAGTTCATGTCCTTTGCGGGG + Intronic
1017058762 6:150461083-150461105 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1017297739 6:152818265-152818287 ATGAGTTCATGACCTTTGTAGGG + Intergenic
1017592330 6:155990885-155990907 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1018283189 6:162209787-162209809 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1020420749 7:8001783-8001805 ATGAGTTCATGACCTTTGCAAGG + Intronic
1020429150 7:8101950-8101972 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1020717094 7:11688217-11688239 ATGAGTTGATGTCCTTTGTAGGG - Intronic
1020760375 7:12261589-12261611 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1020923591 7:14296017-14296039 ATGAGTTCATGACCTTTGCAGGG - Intronic
1021132637 7:16929619-16929641 TTTGATGGATGACCTTTGAGGGG - Intergenic
1021319152 7:19189355-19189377 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1022655280 7:32313583-32313605 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1022885429 7:34638680-34638702 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1023065664 7:36374849-36374871 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1023457064 7:40350948-40350970 ATGGGTTCATGTCCTTTGCTGGG - Intronic
1023568638 7:41549892-41549914 ATGAGTTGATGTCCTTTGCAGGG - Intergenic
1023581565 7:41689805-41689827 AGTGGTTGATGACTGTTGAGTGG + Exonic
1024105859 7:46085692-46085714 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1024407903 7:49003917-49003939 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1024601979 7:50990371-50990393 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1024693761 7:51833780-51833802 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1024938444 7:54737194-54737216 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1025077898 7:55958667-55958689 ATGAGTTCATGACCTTTGCAGGG + Intronic
1028236654 7:88371101-88371123 ATGAGTTCATGACCTTTGCAGGG - Intergenic
1028241484 7:88426246-88426268 ATTGGTTCATGAGCTTTGGGGGG - Intergenic
1028373980 7:90125882-90125904 ATGAGTTCATGACCTTTGCAGGG + Intergenic
1028471825 7:91214046-91214068 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1028967121 7:96814727-96814749 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1028968508 7:96829767-96829789 ATGAGATGATGTCCTTTGAAGGG + Intergenic
1030426585 7:109386334-109386356 ATGAGTTCATGCCCTTTGTGGGG + Intergenic
1030767605 7:113430661-113430683 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1030774255 7:113513984-113514006 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1030904690 7:115168080-115168102 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1031017148 7:116587394-116587416 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1031276915 7:119736271-119736293 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1031613225 7:123851553-123851575 ATGAGTTCATGTCCTTTGCGGGG - Intronic
1031710535 7:125040555-125040577 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1031737561 7:125385535-125385557 ATGAGTTCATGACCTTTGTAGGG + Intergenic
1033046679 7:137968521-137968543 ATGGGTTCATGTCCTTTGCAGGG - Intronic
1033827811 7:145213473-145213495 ATGGGTTCATGTCCTTTGCAAGG - Intergenic
1033902753 7:146162837-146162859 ATGAGTTCATGTCCTTTGAAGGG + Intronic
1033996262 7:147353457-147353479 ATGGGTTCATGTCCTTTGCAGGG - Intronic
1034332796 7:150297449-150297471 ATGGGTTCATGAACTATTAGAGG + Intronic
1034358699 7:150475035-150475057 ATGAGTTCATGTCCTTTGAAGGG - Intronic
1034665241 7:152812429-152812451 ATGGGTTCATGAACTATTAGAGG - Intronic
1036113451 8:5931970-5931992 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1036991857 8:13607242-13607264 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
1037030157 8:14094447-14094469 ATGAGTTCATGTCCTTTGCGGGG - Intronic
1037060469 8:14503127-14503149 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1037063142 8:14541454-14541476 ATGAGTTCATGTCCTTTGCGGGG - Intronic
1037165572 8:15824450-15824472 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1037195893 8:16188822-16188844 ATGAGTTGATGTCCTTTGCAGGG - Intronic
1038559186 8:28555839-28555861 ATGGGTGGATGTTCCTTGAGTGG - Exonic
1039648088 8:39308947-39308969 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1039670409 8:39590265-39590287 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1040085144 8:43332276-43332298 ATGAGTTGATGTCCTTTGTAGGG + Intergenic
1040274489 8:46000416-46000438 ATGAGTTCATGCCCTTTGTGGGG - Intergenic
1040403886 8:47080829-47080851 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1040541186 8:48357558-48357580 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1040751344 8:50712815-50712837 ATGAGTTCATGTCCTTTGCGGGG - Intronic
1041575245 8:59386778-59386800 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1041580243 8:59450400-59450422 ATGAGTTCATGTCCTTTGAAAGG + Intergenic
1041634249 8:60124980-60125002 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1041749887 8:61249231-61249253 ATGGGTTCATGTCCTTTGCAGGG - Intronic
1042458652 8:69036452-69036474 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1042644767 8:70974553-70974575 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1042852995 8:73235167-73235189 ATGAGTTCATGACCTTTGCAGGG - Intergenic
1043178171 8:77047965-77047987 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1043324691 8:79034908-79034930 TGGGGTTGCTGACCTTTGAATGG - Intergenic
1043398481 8:79860703-79860725 ATGAGTTCATGCCCTTTGTGGGG - Intergenic
1043806634 8:84680161-84680183 ATGAGTTCATGACCTTTGTAGGG - Intronic
1043807415 8:84689389-84689411 ATGAGTTCATGACCTTTGTAGGG - Intronic
1044401368 8:91776463-91776485 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1044718061 8:95119336-95119358 ATGAGTTGATGTCCTTTGTAGGG - Intergenic
1044763367 8:95546496-95546518 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1044767707 8:95594199-95594221 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1045166376 8:99610417-99610439 ATGAGTTCATGTCCTTTGCGGGG + Intronic
1045764224 8:105647688-105647710 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1046066892 8:109207973-109207995 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1046081047 8:109370819-109370841 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1046120318 8:109838183-109838205 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1046124803 8:109892426-109892448 ATGAATTAATGACCTTTCAGAGG - Intergenic
1046565446 8:115893676-115893698 ATGAGTTCATGACCTTTGTAGGG + Intergenic
1046779907 8:118203892-118203914 ATGAGTTCATGTCCTTTGAAGGG - Intronic
1046975868 8:120276647-120276669 ATGAGTTCATGTCCTTTGAAGGG - Intronic
1047062876 8:121248080-121248102 ATGAGTTCATGTCCTTTGAAAGG + Intergenic
1047580190 8:126205425-126205447 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1047584754 8:126259030-126259052 ATGAGTTCATGTCCTTTGAGGGG - Intergenic
1048021057 8:130539475-130539497 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1048090173 8:131231924-131231946 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1048562471 8:135556046-135556068 ATGGGTTCATGTCCTTTGTAGGG - Intronic
1048823969 8:138405524-138405546 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1049136122 8:140901968-140901990 ATGAGTTGATGTCCTTTGCAGGG - Intronic
1050188496 9:3000064-3000086 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1050590546 9:7155668-7155690 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1050866632 9:10508625-10508647 ATGAGTTGATGTCCTTTGTAGGG + Intronic
1050963905 9:11772027-11772049 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1050966002 9:11803527-11803549 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1050985659 9:12078799-12078821 ATGAGTTCATGACCTTTGTAGGG - Intergenic
1051081722 9:13301809-13301831 ATGAGTTGATGTCCTTTGTAGGG - Intergenic
1051497233 9:17737032-17737054 ATGAGTTCATGTCCTTTGCGGGG + Intronic
1051505150 9:17818846-17818868 ATGAGTTGATGTCCTTTGCAGGG - Intergenic
1051905496 9:22090138-22090160 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1052152242 9:25131422-25131444 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1052249283 9:26378352-26378374 ATGGGTTCATGTCCTTTGTGGGG + Intergenic
1052381915 9:27780811-27780833 ATGAGTTCATGACCTTTGCAGGG - Intergenic
1052498763 9:29261494-29261516 ATGGGATGATGATGTCTGAGTGG - Intergenic
1054700642 9:68409555-68409577 ATGAGTTCATGACCTTTGTAGGG + Intronic
1054932136 9:70646399-70646421 ATGAGTTCATGACCTTTGCAGGG + Intronic
1054992489 9:71345420-71345442 ATGAGTTCATGTCCTTTGCGGGG + Intronic
1055079914 9:72258703-72258725 ACGGGTGGAGGACCTTTCAGTGG + Intergenic
1055130404 9:72768153-72768175 ATGGGTTCATGTCCTTTGCAGGG + Intronic
1055385676 9:75759537-75759559 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1055863330 9:80781869-80781891 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1056003018 9:82237462-82237484 ATGAGTTCATGTCCTTTGAATGG - Intergenic
1056049371 9:82752151-82752173 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1056065903 9:82934212-82934234 ATGAGTTCATGACCTTTGTAGGG + Intergenic
1057151490 9:92799951-92799973 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1057503801 9:95616459-95616481 ATGAGATGCTGTCCTTTGAGGGG - Intergenic
1057954651 9:99397919-99397941 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
1058081434 9:100704790-100704812 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1058102703 9:100934893-100934915 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1058563652 9:106257625-106257647 ATGAGTTCATGTCCTTTGAAGGG - Intergenic
1058942457 9:109826044-109826066 ATGGGTTCATGTCCTTTGTAGGG + Intronic
1060340239 9:122768577-122768599 TTGGGTTGCTGACCTTTGAATGG - Intergenic
1060610488 9:124959846-124959868 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1061190802 9:129081480-129081502 ATGGGTTGAGGATCTGTGTGAGG + Intronic
1203465911 Un_GL000220v1:86876-86898 ATGAGTTCATGTCCTTTGTGTGG + Intergenic
1203378409 Un_KI270435v1:3498-3520 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1203385293 Un_KI270438v1:45056-45078 ATGAGTTGATGTCCTTTGTAGGG + Intergenic
1203358665 Un_KI270442v1:191067-191089 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1203683367 Un_KI270757v1:9035-9057 ATGAGTTGATGTCCTTTGTAGGG + Intergenic
1185484539 X:472499-472521 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1185716202 X:2344544-2344566 ATGGGTTCATGTCCTTTGCAGGG + Intronic
1185726815 X:2428450-2428472 ATGGGTTCATGTCCTTTGCAGGG + Intronic
1185916472 X:4041113-4041135 ATAGGTTAATGCCCTTGGAGGGG - Intergenic
1186158102 X:6746728-6746750 ATGAGATCATGACCTTTGTGGGG - Intergenic
1186237491 X:7529274-7529296 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1186775307 X:12858609-12858631 ATGAGTTGATGTCCTTTATGGGG - Intergenic
1187210094 X:17221556-17221578 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1187837861 X:23454026-23454048 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1188017068 X:25117451-25117473 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1188123624 X:26339783-26339805 ATGAGTTGATGTCCTTTGTAGGG + Intergenic
1188361934 X:29265782-29265804 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1188578794 X:31685411-31685433 ATGTGATGATGACATTTGAGTGG - Intronic
1189084123 X:38002176-38002198 ATGAGTTGATGTCCTTTGTAGGG - Intronic
1189196727 X:39159863-39159885 ATGTGGAGATGAGCTTTGAGGGG - Intergenic
1189594835 X:42553148-42553170 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1189623740 X:42872449-42872471 ATGAGTTCATGGCCTTTGTGGGG - Intergenic
1190510915 X:51173536-51173558 ATGGGTTGGTGCCCTCTGCGTGG + Intergenic
1190587337 X:51959676-51959698 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1191015568 X:55806376-55806398 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1191066383 X:56352491-56352513 ATGAGTTGATGTCCTTTGTAGGG - Intergenic
1191195535 X:57718092-57718114 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1191940892 X:66480844-66480866 ATGAGTTCATGTCCTTTGCGGGG - Intergenic
1191945066 X:66524593-66524615 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1191959684 X:66687302-66687324 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1191964343 X:66740685-66740707 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1191989962 X:67024478-67024500 ATGGGATTATGTCCTTTGCGTGG - Intergenic
1192054734 X:67761410-67761432 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1192060510 X:67820573-67820595 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1192061953 X:67837229-67837251 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1192074067 X:67972801-67972823 ATGAGTTAATGTCCTTTGCGTGG + Intergenic
1192101572 X:68270419-68270441 ATGAGTTCATGTCCTTTGTGGGG + Intronic
1192389092 X:70706138-70706160 ATGGGTTCATGTCCTTTGTAGGG + Intronic
1192620446 X:72674117-72674139 ATGAGTTCATGTCCTTTGTGGGG - Intronic
1192637521 X:72833467-72833489 ATGAGTTCATGTCCTTTGCGGGG + Intronic
1192640623 X:72858940-72858962 ATGAGTTGATGTCCTTTGCAGGG + Intergenic
1192641088 X:72861836-72861858 ATGAGTTGATGTCCTTTGCAGGG - Intergenic
1192644193 X:72887347-72887369 ATGAGTTCATGTCCTTTGCGGGG - Intronic
1192675357 X:73190424-73190446 ATGAGTTGATGTCCTTTGCAGGG + Intergenic
1192679326 X:73235401-73235423 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1192870939 X:75183333-75183355 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1192921946 X:75715958-75715980 ATGAGTTGATGTCCTTTGTAGGG - Intergenic
1192926116 X:75757144-75757166 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1192973290 X:76255680-76255702 ATGGGTTCATGTCCTTTGCAGGG - Intergenic
1193045757 X:77051921-77051943 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1193074356 X:77339779-77339801 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1193081728 X:77412793-77412815 TTGATTTGATGACCTTTGAGAGG + Intergenic
1193454485 X:81713531-81713553 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1193683339 X:84548747-84548769 ATGAGTTCATGACCTTTGTAGGG + Intergenic
1194009935 X:88549084-88549106 ATGAGTTCATGCCCTTTGTGGGG + Intergenic
1194022913 X:88715887-88715909 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1194028318 X:88781725-88781747 ATGAGTTCATGCCCTTTGTGGGG - Intergenic
1194337193 X:92662885-92662907 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1194811788 X:98396505-98396527 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1194834913 X:98670337-98670359 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1194892835 X:99402053-99402075 ATGAGTTAATGTCCTTTGTGGGG - Intergenic
1194907340 X:99594300-99594322 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1195100019 X:101546034-101546056 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1195103317 X:101577451-101577473 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1195261580 X:103137214-103137236 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1195960369 X:110379794-110379816 ATGCATGGATGGCCTTTGAGTGG + Intronic
1195983343 X:110602910-110602932 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1196067214 X:111477534-111477556 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1196144633 X:112303437-112303459 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1196524565 X:116717255-116717277 ATGAGTTCATGACCTTTGTAGGG + Intergenic
1196606402 X:117662399-117662421 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1197087202 X:122492784-122492806 ATGTGTTCATGACCTTTGCAGGG - Intergenic
1197649566 X:129050065-129050087 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1197949222 X:131876034-131876056 ATGAGTTGATGTCCTTTGTAGGG + Intergenic
1198281173 X:135144228-135144250 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1198289786 X:135228288-135228310 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1198346607 X:135766080-135766102 ATGAGTTCATGTCCTTTGAAGGG + Intronic
1198348514 X:135783367-135783389 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1198350418 X:135800633-135800655 ATGAGTTCATGTCCTTTGAAGGG + Intronic
1198352326 X:135817903-135817925 ATGAGTTCATGTCCTTTGAAGGG + Intronic
1198354235 X:135835173-135835195 ATGAGTTCATGTCCTTTGAAGGG + Intronic
1198356144 X:135852423-135852445 ATGAGTTCATGTCCTTTGAAGGG + Intronic
1198358057 X:135869701-135869723 ATGAGTTCATGTCCTTTGAAGGG + Intergenic
1198501679 X:137255794-137255816 GTGGGTAGATGACATTTAAGGGG - Intergenic
1198700973 X:139397843-139397865 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1199101699 X:143809056-143809078 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1199477112 X:148257878-148257900 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1199703741 X:150405910-150405932 GAGGGTTGGTGACCTTAGAGTGG - Intronic
1199803830 X:151277688-151277710 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1199836146 X:151593555-151593577 ATGGGTTCATGTCCTTTGCGGGG - Intronic
1200454729 Y:3376008-3376030 ATGGGTTCATGTCCTTTGCAGGG + Intergenic
1200645621 Y:5779617-5779639 ATGAGTTCATGTCCTTTGCGGGG + Intergenic
1200713947 Y:6516411-6516433 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1200760614 Y:7035628-7035650 AAGGGTTCATGTCCTTTGTGGGG + Intronic
1201019878 Y:9644743-9644765 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1201535908 Y:15048025-15048047 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1201597442 Y:15686894-15686916 ATGGGTTCATGTCCTTTGTGGGG + Intergenic
1201615648 Y:15895137-15895159 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1201666734 Y:16466055-16466077 ATGAGTTCATGTCCTTTGTGGGG + Intergenic
1201736147 Y:17264202-17264224 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1201750628 Y:17428005-17428027 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1201761249 Y:17541225-17541247 ATGGGTTCATGTCCTTTGTAGGG + Intergenic
1201840303 Y:18364765-18364787 ATGGGTTCATGTCCTTTGTAGGG - Intergenic
1201928107 Y:19312040-19312062 ATGAGTTCATGTCCTTTGTGGGG - Intergenic
1201965291 Y:19726377-19726399 ATGAGTTCATGACCTTTGCAGGG + Intronic
1202091824 Y:21198855-21198877 ATGAGTTCATGTCCTTTGACAGG - Intergenic
1202464281 Y:25139624-25139646 ATGAGTTCATGTCCTTTGTGGGG + Intergenic