ID: 1124896400

View in Genome Browser
Species Human (GRCh38)
Location 15:33781182-33781204
Sequence TGTGATCCTGCCTAAGGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124896393_1124896400 28 Left 1124896393 15:33781131-33781153 CCAAGGCAGGTTGTAAATCTGCT 0: 1
1: 0
2: 1
3: 12
4: 121
Right 1124896400 15:33781182-33781204 TGTGATCCTGCCTAAGGATAAGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124896400 Original CRISPR TGTGATCCTGCCTAAGGATA AGG Intronic
903338183 1:22638546-22638568 TGTGTTCCTGCCCAAGGCTGAGG - Intronic
904399851 1:30248901-30248923 AGTGAACCTGCCCAAGGATGTGG - Intergenic
907862263 1:58364842-58364864 TGAGATCCTGGCTGAGGAAAAGG - Intronic
911012823 1:93299712-93299734 TGAGACCCTGCCTAAGAAAAAGG - Intergenic
912112938 1:106365650-106365672 TATGTTTCTCCCTAAGGATATGG - Intergenic
917107567 1:171508650-171508672 TGTGTTCCTTCATAAGAATATGG + Intronic
919078429 1:192840155-192840177 TGAGGTCCTGCCCAAGGCTATGG + Intergenic
922499938 1:226089478-226089500 TGTGTTCCAGCCTATGGAAAAGG - Intergenic
1063990122 10:11552503-11552525 TGAAATCCTGCCTACGGATAGGG + Intronic
1073755063 10:106572651-106572673 TGTGATGCTGCCCAAGCAGAGGG - Intergenic
1074768383 10:116717193-116717215 TGGCATCCTGACTAAGGATGCGG - Intronic
1079749614 11:24180582-24180604 TGTAATGCAGCCTAAGTATACGG + Intergenic
1083841516 11:65307564-65307586 GGGGAGCCTGCCTAAGAATAAGG - Intergenic
1088208915 11:107430261-107430283 TGTGAGCCTGTATATGGATAGGG + Intronic
1090190884 11:124767152-124767174 TGTCATCCTTCATAAGGATTTGG - Exonic
1091401024 12:180775-180797 TGTGACCCTGCATAGGGATGGGG + Intergenic
1098483185 12:70989627-70989649 TGTGACTTTGCCTAATGATATGG + Intergenic
1100000949 12:89834750-89834772 TTTCTTCCTGCCTAAGGACATGG + Intergenic
1102915553 12:116749664-116749686 TGTGACCCTGTTTAAAGATAGGG - Intronic
1103680537 12:122690234-122690256 AGTGCTCCTGCAAAAGGATAGGG + Intergenic
1105514793 13:21079393-21079415 GGTGTTCCTTCCTAAGGTTAGGG - Intergenic
1106631728 13:31481025-31481047 TATGAACCTGCCTAAATATAGGG + Intergenic
1111315065 13:86544942-86544964 TGTGATGGTGTCAAAGGATAGGG - Intergenic
1115747073 14:36448893-36448915 GGAGAACCTGCCTGAGGATATGG + Intergenic
1119919296 14:78431389-78431411 TGTGATGTTCCCTAAGGGTATGG + Intronic
1123859289 15:24447111-24447133 TGGGTTCTTGCCTAAGGATGTGG - Intergenic
1124086328 15:26553745-26553767 TGTGCTCCTGACTAAGGACAGGG - Intronic
1124896400 15:33781182-33781204 TGTGATCCTGCCTAAGGATAAGG + Intronic
1131576791 15:93600394-93600416 TGTGAATCTTCCAAAGGATAGGG + Intergenic
1133084821 16:3353872-3353894 TGAGATCCTGGCCAAGGAAAGGG + Intergenic
1137645334 16:50068174-50068196 TGTGCTAGTCCCTAAGGATATGG - Intronic
1140842000 16:78848542-78848564 TGTGGTGTTGCCTAAGGGTACGG + Intronic
1142501104 17:333758-333780 TGTGAACCTGACTATGGAAAAGG - Exonic
1146138611 17:30345155-30345177 TGTAATCCTACCTAATGATGTGG - Intergenic
1148543988 17:48502948-48502970 TGTGAGACTGCATAAGGAAAGGG + Intergenic
1149901976 17:60488842-60488864 TGTGATCTTGACTAATGTTAAGG - Intronic
1151361112 17:73589585-73589607 TTTTATCCTGCCTAAGGCTGCGG - Intronic
1152209750 17:78996815-78996837 TATGCTCCTGGCTAAGGGTAAGG + Intronic
1156495600 18:37523466-37523488 TGTAATCCTGACCAAGGGTAAGG + Intronic
1166159904 19:40944695-40944717 TGTGATCCTTCCTCAGGACACGG + Intergenic
927359843 2:22220368-22220390 TGTCATGCTGCCAAAAGATATGG + Intergenic
929096180 2:38265206-38265228 TGACATTGTGCCTAAGGATATGG - Intergenic
930782432 2:55235940-55235962 AGTGATCCTCCCAAAGCATAGGG - Intergenic
930861930 2:56083412-56083434 CGTGATACTGACTAAGAATAGGG + Intergenic
933691417 2:85182019-85182041 TCAGATCCTGCCAAAGGACAGGG + Intronic
934131619 2:88954413-88954435 TTTGATCCTTCCTAAGAAGATGG - Intergenic
935002460 2:99032696-99032718 GTTGATCCTGCCTACTGATAAGG + Intronic
935337154 2:102027023-102027045 TGTGTTCCAGCCTCAGGACAGGG + Intronic
938569949 2:132553775-132553797 TGTCATCCTGCCTTAGCAGAAGG + Intronic
939297599 2:140289953-140289975 TCTGATCCTGCCTTTGGAGAGGG + Intronic
939864392 2:147456567-147456589 TGAGACCTTGGCTAAGGATATGG - Intergenic
943883894 2:193185956-193185978 TCTGAGCCTGCCAAAGGCTAAGG + Intergenic
1169023757 20:2349891-2349913 TGTGACCCCGCTTAAGAATAGGG + Intergenic
1170112959 20:12825269-12825291 TGTTATCCTGCCTGATGATACGG - Intergenic
1170818891 20:19739421-19739443 TGTGATTCTGCCAAAGGCTGAGG + Intergenic
1170894875 20:20403897-20403919 TGTGAGATTGCCTGAGGATATGG - Intronic
1175266130 20:57704564-57704586 TGGGATCCTGCCCAAAGAGAAGG - Intronic
1175657003 20:60779682-60779704 TGTGAGACTGCCTTAGGATGTGG - Intergenic
1181901674 22:26161142-26161164 TGTGTGGCTGCCTAAGGAAATGG - Intergenic
1182023534 22:27100395-27100417 AGTCATCCTGCCTAAAGGTAAGG + Intergenic
950169844 3:10830857-10830879 TGTGATCAGGCCTGGGGATAAGG + Intronic
950563143 3:13747497-13747519 TGTGAGCCTGCCTGATGAGAAGG - Intergenic
952244083 3:31566268-31566290 TGTGATCATGCTTAAGAATGTGG + Intronic
957569853 3:81932544-81932566 TGAGTTCCTGCCTAAAAATAAGG + Intergenic
959057894 3:101586220-101586242 TGTTATCCCTCCTAGGGATATGG - Intronic
959352017 3:105277706-105277728 TGTTGTCCTGCCTATGGATTTGG - Intergenic
961114398 3:124316318-124316340 AGTGATCCTGCCTAAAGGTGAGG + Intronic
965847621 3:172983018-172983040 TGTGATCCTGCCTAAAGGCAAGG - Intronic
966650558 3:182296046-182296068 TGTGACCTTGGGTAAGGATATGG - Intergenic
970390895 4:15612559-15612581 TGTATTTCTGCCTAAGGATGAGG - Intronic
970752249 4:19377946-19377968 TCAGATGCTGGCTAAGGATAGGG - Intergenic
972008577 4:34144127-34144149 TCTGATCCTGTCTAGGAATATGG - Intergenic
979542385 4:121900176-121900198 TGTGAACCTGGCTTAGCATAAGG - Intronic
980389983 4:132132105-132132127 TCTGATCCTGCTTCAGGACATGG - Intergenic
989098105 5:37799672-37799694 TGTGCTCCTGCCTCAGGACCTGG - Intergenic
990640395 5:57777356-57777378 TGTTATCTTGCCTAAGGAACTGG - Intergenic
994899594 5:105754019-105754041 TGTGATCCTTCTTAAGGTTTTGG + Intergenic
995780536 5:115770537-115770559 TGAGCTCCAGCCTAAGGAGAAGG + Intergenic
998707183 5:144776261-144776283 TGTGCTCATGGCTAAGGCTAGGG + Intergenic
1002200242 5:177524006-177524028 TGTGTTCCTGCCCAAGGACATGG - Exonic
1003624229 6:7727609-7727631 TGTGAACCTGGGTAAGGATTTGG + Exonic
1004257821 6:14081135-14081157 TGTTATCGTGCATACGGATATGG + Intergenic
1005885615 6:30095535-30095557 TCTGATACTCTCTAAGGATATGG - Intergenic
1006885556 6:37379117-37379139 TGTGATCCTGCCTCAGCCTCCGG + Intronic
1008071575 6:47103828-47103850 TGCACTCCTGCCTAAGGACAGGG + Intergenic
1010570086 6:77464607-77464629 TGTGACCATGGCTAAGGACATGG - Intergenic
1015254681 6:131164705-131164727 TATGATCTTTCCTAAGAATAAGG - Intronic
1016291724 6:142534983-142535005 GGTGAAGCTGCCTAAGGCTATGG + Intergenic
1017723535 6:157261151-157261173 TGTGATGCTGCCTAACCACAGGG - Intergenic
1021483584 7:21144471-21144493 TGTGATCCAGCAAAAGGAAAAGG - Intergenic
1022995708 7:35753295-35753317 TGTAGTCCTGCCTAGGGATCAGG - Intergenic
1023592669 7:41796098-41796120 TCTGATCCTGCCTTTGGATCCGG + Intergenic
1024532704 7:50406655-50406677 TGTGCTCCTGGCTGAGGAAATGG - Intergenic
1028322506 7:89477637-89477659 TTTGATCCTCCCTATTGATAGGG - Intergenic
1030690272 7:112525506-112525528 TCTGAGCCTGGCAAAGGATAGGG - Intergenic
1035400653 7:158563184-158563206 TGTGGTCCTGCCTTGGGAGAAGG - Intronic
1037504839 8:19519363-19519385 TGTGATGGTGCTTCAGGATATGG - Intronic
1046743014 8:117848331-117848353 TGTACTTCTGCCTAAGGAAATGG - Intronic
1048220468 8:132536445-132536467 TGTGATCATGCCTTTAGATAAGG + Intergenic
1048653371 8:136506254-136506276 TGTGGTCCTGCATAAGCATTAGG - Intergenic
1049493471 8:142917162-142917184 TGTGATGCTGCCGGAGGATGTGG - Exonic
1050209377 9:3236090-3236112 TATGTTCCTCACTAAGGATAGGG + Intronic
1054715709 9:68556096-68556118 GGTGATGCTGCCTGAGCATAGGG - Intergenic
1056032913 9:82571625-82571647 TCAGATACAGCCTAAGGATAAGG + Intergenic
1058728994 9:107832036-107832058 TGTGCTCCTGCCTCGGGATCTGG - Intergenic
1185860927 X:3578769-3578791 TGGTATTCTGCCTAATGATATGG - Intergenic
1187597949 X:20795864-20795886 TGTGTTCCTCCATAAGGACAAGG + Intergenic
1198837467 X:140819954-140819976 TGTGATCCTGCCACATTATATGG + Intergenic
1200698873 Y:6385419-6385441 TGTCAGCCTGCCTAAGCAGAGGG + Intergenic
1201035239 Y:9779280-9779302 TGTCAGCCTGCCTAAGCAGAGGG - Intergenic