ID: 1124896856

View in Genome Browser
Species Human (GRCh38)
Location 15:33785523-33785545
Sequence CAGTGAGCTTGGATGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 292}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124896856_1124896863 24 Left 1124896856 15:33785523-33785545 CCACTCCACATCCAAGCTCACTG 0: 1
1: 0
2: 1
3: 45
4: 292
Right 1124896863 15:33785570-33785592 CTAAAGACCAAAGGAAAGGAGGG 0: 1
1: 0
2: 3
3: 50
4: 522
1124896856_1124896864 25 Left 1124896856 15:33785523-33785545 CCACTCCACATCCAAGCTCACTG 0: 1
1: 0
2: 1
3: 45
4: 292
Right 1124896864 15:33785571-33785593 TAAAGACCAAAGGAAAGGAGGGG 0: 1
1: 0
2: 6
3: 62
4: 798
1124896856_1124896862 23 Left 1124896856 15:33785523-33785545 CCACTCCACATCCAAGCTCACTG 0: 1
1: 0
2: 1
3: 45
4: 292
Right 1124896862 15:33785569-33785591 CCTAAAGACCAAAGGAAAGGAGG 0: 1
1: 0
2: 1
3: 25
4: 294
1124896856_1124896860 20 Left 1124896856 15:33785523-33785545 CCACTCCACATCCAAGCTCACTG 0: 1
1: 0
2: 1
3: 45
4: 292
Right 1124896860 15:33785566-33785588 ATTCCTAAAGACCAAAGGAAAGG 0: 1
1: 0
2: 2
3: 25
4: 282
1124896856_1124896859 15 Left 1124896856 15:33785523-33785545 CCACTCCACATCCAAGCTCACTG 0: 1
1: 0
2: 1
3: 45
4: 292
Right 1124896859 15:33785561-33785583 AATTTATTCCTAAAGACCAAAGG 0: 1
1: 0
2: 2
3: 40
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124896856 Original CRISPR CAGTGAGCTTGGATGTGGAG TGG (reversed) Intronic
900469877 1:2848451-2848473 CAGTGACCAGGGATGGGGAGAGG + Intergenic
901021538 1:6258454-6258476 CACTGAGCTTGGAGGTGCCGGGG + Intronic
901227496 1:7622369-7622391 GAAAGAACTTGGATGTGGAGTGG - Intronic
902865124 1:19273073-19273095 CAGTGGGCATGGGTGTGGAAAGG - Intergenic
902867215 1:19287672-19287694 CAGTGGGCATGGGTGTGGAAAGG - Intronic
903185310 1:21625504-21625526 CACTCAGGTTGGATGTGGTGGGG - Intronic
903363330 1:22790776-22790798 TATTTAGCTTGGATGGGGAGAGG + Intronic
904841872 1:33377457-33377479 CTGTGTGCTTGGCAGTGGAGAGG + Intronic
907772622 1:57480891-57480913 CAGTGAGCTTGAATGGGAAGAGG - Intronic
907810366 1:57863702-57863724 AAGAGATCTTGGAGGTGGAGTGG + Intronic
912374292 1:109197885-109197907 AAGTGAGGTTGGATGTTGACAGG + Intronic
913984066 1:143549360-143549382 CAGTGAGCTTGGATAAGCAATGG - Intergenic
915346760 1:155201451-155201473 CAGTGAGCATGGATGTGGCAGGG + Exonic
915619477 1:157071670-157071692 CAAGGAGCTTGGTTGTGAAGAGG - Intergenic
915924403 1:160004980-160005002 GAGAGACCTTGGCTGTGGAGGGG - Intergenic
917014321 1:170512154-170512176 CAGTGTGATAGGATTTGGAGAGG + Intergenic
919607323 1:199700760-199700782 CAAAAAGGTTGGATGTGGAGAGG + Intergenic
920034213 1:203055603-203055625 AGGTGAGCTTAGGTGTGGAGCGG - Exonic
920228601 1:204455568-204455590 CACTGGTCTTGGATCTGGAGGGG + Intronic
920362849 1:205431049-205431071 CAGCGAGCTTGGGGGTGGGGCGG + Intronic
920837522 1:209525508-209525530 GAGTGAGATTGGAAGTGCAGGGG - Intergenic
922163297 1:223094297-223094319 GAGAGAGCTTGGGTGTGGATGGG - Intergenic
922674446 1:227542165-227542187 CAGTGGGCTCGGATCTCGAGCGG + Intergenic
1063218903 10:3948348-3948370 CAGTCCGGTGGGATGTGGAGAGG + Intergenic
1063462377 10:6222886-6222908 CAGTGATCATGGAGCTGGAGCGG + Exonic
1064980169 10:21158578-21158600 CAGTGAGAGCGGATGTGGTGGGG - Intronic
1067247697 10:44560010-44560032 CGAGGAGCTTGGATGTGGACAGG + Intergenic
1067508844 10:46878342-46878364 CAGTGAGAGAGGAGGTGGAGGGG + Intergenic
1067653405 10:48173508-48173530 CAGTGAGAGAGGAGGTGGAGGGG - Intronic
1068966126 10:62913662-62913684 CAGTGAGCTTACAGTTGGAGAGG - Intronic
1069493011 10:68877743-68877765 CTGTGAACTTGGAGGTGGGGTGG - Intronic
1069794133 10:71041571-71041593 CAGTGAGCTTGGCTGTGTGTTGG + Intergenic
1069825646 10:71253614-71253636 CAGGGAGCTTGGCAGGGGAGAGG - Intronic
1070765113 10:79051953-79051975 GAGTGGGTTGGGATGTGGAGGGG + Intergenic
1070809918 10:79292556-79292578 CAGTGTGCTTGGGTGTGGTGGGG + Intronic
1070824178 10:79381245-79381267 CAGGGACCATGGATGTGAAGGGG - Intergenic
1072770542 10:98134004-98134026 CTGTGGGCATGGATGAGGAGAGG + Intergenic
1073333655 10:102688289-102688311 AAATGAGCTTGGAGGTGGAGGGG - Intronic
1073368630 10:102966860-102966882 GAGTGAGGTGGGATGAGGAGTGG + Intronic
1074434490 10:113422332-113422354 CTGAGAGCTTTGATATGGAGAGG + Intergenic
1076820392 10:132935896-132935918 CAGTGTGTTTGGATGATGAGGGG - Intronic
1076820422 10:132936074-132936096 CAGTGTGTTTGGATGCCGAGGGG - Intronic
1076820492 10:132936431-132936453 CAGTGTGTTTGGATGCCGAGGGG - Intronic
1077028968 11:455026-455048 CAGTGGGCCTGTGTGTGGAGTGG + Intronic
1077506159 11:2930846-2930868 CAGTGGGCAGGGATGTGGTGTGG + Intergenic
1077895516 11:6450648-6450670 CAGTAAGCTGGGATGCTGAGTGG + Intronic
1078480676 11:11672618-11672640 CACTGAGCCTTGAGGTGGAGTGG + Intergenic
1078708038 11:13764225-13764247 GAGTTAGCTTGGCTGGGGAGTGG - Intergenic
1079895484 11:26113925-26113947 CAGTGAGGCTGGGTGGGGAGGGG + Intergenic
1080533969 11:33203794-33203816 GCGTGACCTTGGATATGGAGAGG - Intergenic
1080579534 11:33631016-33631038 CAATGAACTTGGATGGGAAGAGG + Intronic
1081840728 11:46199596-46199618 CACACAGCTAGGATGTGGAGGGG - Intergenic
1083148766 11:60776925-60776947 CAGTGTCCTTAGTTGTGGAGTGG - Intergenic
1083395916 11:62391862-62391884 CATTGAGCCTGGATGTGGGAGGG + Intronic
1083594422 11:63912099-63912121 CAGCGAGGTGGGAGGTGGAGGGG + Exonic
1084731424 11:71076100-71076122 CTGTGAGCTTGGGTGGGGAGGGG - Intronic
1086852633 11:91828356-91828378 GAGAGAGCTTGGAAGTGGTGAGG - Intergenic
1088649152 11:111942142-111942164 CAATGAGCCTGGGTGGGGAGAGG - Intronic
1088971648 11:114779550-114779572 CTGTGAGCTTTGATGTTGCGGGG + Intergenic
1089114513 11:116083448-116083470 CAGGGAGCTTGGAGCTGGGGAGG - Intergenic
1089261107 11:117224593-117224615 GACTGAGCGTGGAGGTGGAGTGG + Intronic
1089354201 11:117839309-117839331 CAGTGCCCTTAAATGTGGAGAGG + Intronic
1089792465 11:120954683-120954705 GGGTGTGTTTGGATGTGGAGGGG - Intronic
1090116178 11:123976911-123976933 CAGTGAGCTGGGCAGTGCAGGGG + Exonic
1090420135 11:126569020-126569042 CAGAGAGCTTGGGAATGGAGAGG + Intronic
1090450875 11:126805311-126805333 CAGTCAGCATTGATATGGAGAGG + Intronic
1091556228 12:1575615-1575637 CAGTGTGCTTGGAGCTGGAGAGG - Intronic
1092322040 12:7486664-7486686 CAGACAGCTGGGCTGTGGAGAGG - Exonic
1096727761 12:53578824-53578846 CAGTGTGCTTGGAGCTGGAGAGG - Intronic
1096975590 12:55697751-55697773 CAGGCAGCTTGGATATGGATGGG - Exonic
1100098796 12:91076977-91076999 CAGTGAGATAGGGTGTGAAGGGG + Intergenic
1101198431 12:102409392-102409414 CACTTTGCTTGGATCTGGAGAGG - Intronic
1101210783 12:102533558-102533580 CAGTGACCCTGGAGGTGGTGCGG + Intergenic
1101254151 12:102960990-102961012 CTAGGAGCTTGTATGTGGAGAGG - Intergenic
1101786329 12:107886760-107886782 AAATGAGCTGAGATGTGGAGTGG - Intergenic
1102299789 12:111762950-111762972 CAGTAAACTTGGTTGTGGGGAGG - Intronic
1102565001 12:113791034-113791056 CATTGAGCCTGGATGGGGAAGGG - Intergenic
1103193701 12:119024304-119024326 CAGTGAGCTTGGGTGAGGACAGG - Intronic
1103326906 12:120127801-120127823 CATTGAGCAAAGATGTGGAGCGG + Exonic
1103535314 12:121629841-121629863 AAGTGAGCTTGGGAGAGGAGAGG + Intronic
1103883764 12:124186072-124186094 CAGTGGGCTGGGGTGTGCAGGGG + Intronic
1103927643 12:124432740-124432762 CACTGTGGTTAGATGTGGAGAGG - Intronic
1104098457 12:125583344-125583366 CAGTCAGCTTGGGTGTGTAGAGG + Intronic
1104972436 12:132538074-132538096 GAGTGAGCTTGGGTGTGGCTGGG + Intronic
1105846513 13:24298674-24298696 CAGTGGGCAAGGATGGGGAGGGG - Intronic
1109441874 13:62384909-62384931 CAGTGAGCATGGAGATGAAGTGG - Intergenic
1109655926 13:65389734-65389756 CAGTCTGCTTGGAAGTGGAGGGG + Intergenic
1109831382 13:67794204-67794226 CAAAGAACTTGGATGTGCAGAGG + Intergenic
1112446877 13:99472225-99472247 AAGGGAGCTTGGTAGTGGAGAGG - Intergenic
1113395423 13:109942969-109942991 CAGTGAGCTTGGAGGAGGCCTGG + Intergenic
1113670200 13:112170963-112170985 CAGTGCGCATGGATGAGGAGGGG - Intergenic
1113850133 13:113413249-113413271 CAGCGAGGTTGGGCGTGGAGTGG - Intergenic
1115820961 14:37211919-37211941 CTGGGAGCTAGGACGTGGAGTGG - Intronic
1117282449 14:54254175-54254197 CAGGGAGCTTGAGTGAGGAGGGG - Intergenic
1117483443 14:56171382-56171404 CAGAGAGCCTGCATCTGGAGAGG - Intronic
1117499777 14:56340014-56340036 CAGTGAGGGTGGCTGAGGAGAGG - Intergenic
1120173478 14:81270012-81270034 TAGTGAGCTTGGAAATGGAGGGG - Intronic
1121413550 14:93763636-93763658 CAGTGGGGGTGGATGTGGGGTGG + Intronic
1122326768 14:100885340-100885362 CAGCCACCTTGGTTGTGGAGCGG + Intergenic
1122468226 14:101948720-101948742 CCGTGGGCTGGGTTGTGGAGCGG + Intergenic
1123799939 15:23809081-23809103 GAGTGATGTTGGATGTGGAATGG + Intergenic
1124857454 15:33404109-33404131 CAGTTAGCTTACATCTGGAGTGG + Intronic
1124896856 15:33785523-33785545 CAGTGAGCTTGGATGTGGAGTGG - Intronic
1127802124 15:62485822-62485844 CAGTTGGCTTGGGAGTGGAGAGG + Intronic
1127882111 15:63167205-63167227 CAGCGAGCTTGGAGGTGGGGAGG + Intergenic
1128088937 15:64905905-64905927 CAGTGAGCGTGTGTGTGGGGGGG + Intronic
1128749182 15:70136535-70136557 CAGTGACCTTGGAGGGAGAGGGG - Intergenic
1129771912 15:78208096-78208118 CAGTGAGCTGGGGTGGTGAGGGG + Exonic
1130877650 15:88028441-88028463 AAGTGATCTTGGATGGAGAGTGG + Intronic
1131186942 15:90282465-90282487 CTGTGAGCTGGGGTGAGGAGGGG + Intronic
1132019455 15:98347715-98347737 CAGTGCTCATGGATTTGGAGAGG + Intergenic
1132840136 16:1974846-1974868 CAGTGAGTTGGAAGGTGGAGGGG + Exonic
1133169273 16:3970982-3971004 CAGGGAGCTGGGATTTGGGGAGG + Intronic
1133907462 16:10035314-10035336 CAGTGAGGATGGGTGGGGAGTGG - Intronic
1134392326 16:13831189-13831211 CAGTGGGCTCTGAGGTGGAGGGG - Intergenic
1137466618 16:48715617-48715639 CTGTGAACTTGGAGTTGGAGGGG - Intergenic
1137479688 16:48841738-48841760 TGCTGAACTTGGATGTGGAGCGG + Intergenic
1138401187 16:56745532-56745554 GAGGCAGCTTGGATGTGGGGAGG + Intronic
1139326328 16:66155272-66155294 CAGTGAGCTTTGACGGGGACAGG + Intergenic
1141146317 16:81532716-81532738 CAGAGTGTTGGGATGTGGAGGGG + Intronic
1141367612 16:83457768-83457790 CAGGGATCTTGGATGCGGAGTGG - Intronic
1141524728 16:84604112-84604134 CAGGGAGCATGGGTGGGGAGTGG - Intronic
1141741476 16:85896111-85896133 CAGGGAGCTTGGATGTGAACTGG + Intergenic
1142502406 17:340345-340367 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502416 17:340381-340403 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502427 17:340417-340439 CAGTGAGTATGGATGTGGGGAGG - Intronic
1142502440 17:340453-340475 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502453 17:340489-340511 CAGTGAGTGTGGACGTGGGGAGG - Intronic
1142502466 17:340525-340547 CAGTGAGTGTGGACGTGGGGAGG - Intronic
1142502479 17:340561-340583 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502492 17:340597-340619 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502505 17:340633-340655 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502518 17:340669-340691 CAGTGAGTGTGGACGTGGGGAGG - Intronic
1142502530 17:340705-340727 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502543 17:340741-340763 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502554 17:340777-340799 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502567 17:340813-340835 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502580 17:340849-340871 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502593 17:340885-340907 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502606 17:340921-340943 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502618 17:340956-340978 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502631 17:340992-341014 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502643 17:341027-341049 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1142502665 17:341097-341119 CAGTGAGTGTGGATGTGGGGAGG - Intronic
1143518097 17:7430000-7430022 GTGTGAGCTTGGATGTGGGCTGG - Intergenic
1144221796 17:13106484-13106506 GAGTGAGGTTGAATGGGGAGAGG + Intergenic
1145003187 17:19319973-19319995 CAGGGAGCCTGGGTGTGCAGCGG + Intronic
1145973129 17:28968603-28968625 CAGGGAGCCTGGAAGTGGATGGG - Intronic
1146975506 17:37107911-37107933 CAGGGAGAGTGGCTGTGGAGCGG - Intronic
1147340982 17:39753248-39753270 CTGTGACCTTGGAGTTGGAGGGG + Intergenic
1147448247 17:40487991-40488013 CAGTGGCTTTGGAGGTGGAGTGG + Intronic
1147587398 17:41660290-41660312 CAGTGAGCAGGGAAGGGGAGGGG + Intergenic
1148533281 17:48415838-48415860 CAGAGAGCTTGGAGTTGGAGAGG + Intronic
1150966793 17:69979707-69979729 CAGAGAGCCTGGATGTGGTGAGG + Intergenic
1151230962 17:72684756-72684778 CAGAGAGCTGGGGAGTGGAGGGG + Intronic
1151501367 17:74491603-74491625 CAGGGAGCTTGGATTTACAGGGG - Intergenic
1152150784 17:78599670-78599692 CTGTGAGATTGGAGGTGGGGGGG - Intergenic
1153550643 18:6258415-6258437 CGGTGGGCATGGATGGGGAGAGG + Intronic
1153768621 18:8397905-8397927 CAGTGCACTAGGCTGTGGAGGGG - Intronic
1155498562 18:26465470-26465492 CAGTGCCCCTGGATGAGGAGGGG - Intronic
1156091992 18:33482554-33482576 CAGTGAGCATGGTACTGGAGAGG + Intergenic
1156326615 18:36079436-36079458 CAGTGAGGGCGGATGGGGAGGGG + Intergenic
1156948804 18:42868031-42868053 CAGTAAGTTTGGAAGTTGAGGGG + Intronic
1157537907 18:48474077-48474099 CAGTGGGCTGGGATGGGGGGTGG + Intergenic
1157651908 18:49341564-49341586 CACTGAGGGTGGATGTGGATGGG + Intronic
1157711192 18:49850829-49850851 CAGTGGGGTTGGATCTGGACAGG - Intronic
1159558538 18:69970074-69970096 TAGTGAGAATGGAGGTGGAGAGG - Intergenic
1159893831 18:73978217-73978239 CAGTGGGCATGGATGTGAACAGG - Intergenic
1162740286 19:12770128-12770150 GGGTCAGCTGGGATGTGGAGTGG + Intronic
1163374555 19:16922247-16922269 CAGTGAGCCCAGATGTGGTGTGG - Intronic
1163772905 19:19201600-19201622 CTGTGAGCTTGAATCGGGAGTGG - Exonic
1164512002 19:28905066-28905088 CAGGGAGCTGGGAGATGGAGAGG - Intergenic
1165424155 19:35736813-35736835 CAGAGAGCTTGGAGGGTGAGTGG + Exonic
1166889061 19:45979111-45979133 CAGTGAGCTGTGAGATGGAGAGG + Intergenic
1168012779 19:53546597-53546619 CAGTGTGCTTGGGTAAGGAGGGG + Intronic
926063360 2:9818914-9818936 CAGTCAGATTGTATGGGGAGGGG + Intergenic
928175911 2:29034235-29034257 CAGGGAGAGAGGATGTGGAGGGG - Intronic
932461093 2:71882559-71882581 CAGGGAGCTTGGATGGGGCCAGG + Intergenic
934573886 2:95388587-95388609 CAGTCACCTGGGATGTGGACTGG - Intergenic
934953259 2:98593657-98593679 CAGCCAGCTTGGAGGAGGAGAGG - Intronic
935436312 2:103038333-103038355 CAGTGAGCTTAAAGATGGAGAGG - Intergenic
936965327 2:118122378-118122400 CAGAGAGGTGGGATGTGGAGGGG - Intergenic
938188885 2:129256440-129256462 CCGTGAGCTTTGTTGTGGGGAGG + Intergenic
938562668 2:132488791-132488813 CAGTGAGGCGGGATGTGGATGGG - Intronic
938657391 2:133447956-133447978 CAGTGAGCTTAGAGCTGTAGAGG - Intronic
939081850 2:137672024-137672046 CAGGGAGTTTGGGTGGGGAGAGG + Intronic
940004561 2:148998952-148998974 CAGTGAGCGTGTATGTGTAGGGG - Intronic
944283827 2:197925321-197925343 CAGTTAGCTTGAATTTTGAGTGG + Intronic
944474594 2:200090761-200090783 CAGCTGGCTTGGATTTGGAGGGG - Intergenic
947866572 2:233402033-233402055 CACTGGGCTTGGCTGGGGAGAGG - Intronic
948172494 2:235916215-235916237 CAGTGACCTTGAATGAGGAAGGG - Intronic
948772890 2:240260619-240260641 CTGTGAACGTGAATGTGGAGAGG + Intergenic
949077397 2:242069493-242069515 CAGAGAGCTTGGGCGTGGGGGGG + Intergenic
1168918893 20:1514620-1514642 CAGTGACCTTGGATGTAGGAGGG - Intergenic
1169206193 20:3741675-3741697 CAGGGAGCTTGGGGGTGGGGAGG - Intronic
1169522666 20:6390147-6390169 AAGAAAGCATGGATGTGGAGTGG - Intergenic
1171102625 20:22399873-22399895 CAGTGGGCTTGGAAGTGCAAGGG - Intergenic
1171433956 20:25104777-25104799 CAGGCAGCCTGGCTGTGGAGGGG - Intergenic
1172295237 20:33805335-33805357 CAGACTGCTTAGATGTGGAGGGG + Intergenic
1173021729 20:39273178-39273200 CAGGCAGCGTAGATGTGGAGGGG - Intergenic
1173787304 20:45803505-45803527 CAGTGTGGCTGGAGGTGGAGAGG - Intronic
1174039466 20:47688657-47688679 GAGTGGGCTTGGGTTTGGAGGGG + Intronic
1174300783 20:49580503-49580525 CAGTGAGGTTGGATTTGAAGGGG - Intergenic
1174566543 20:51468841-51468863 CAGGGGCCTTGGATGAGGAGGGG + Intronic
1175153585 20:56954448-56954470 CAGTGAGAATGGAAGTGAAGTGG - Intergenic
1178238213 21:30868590-30868612 CAGTGATATTGGAGGTGAAGGGG - Intergenic
1178354434 21:31898683-31898705 CATTGAGCTTTGTTGTGGAGTGG + Intronic
1178921717 21:36743255-36743277 CACTGGGATTGGATGTGGATGGG - Intronic
1179673215 21:42964229-42964251 CTCTCAGCTTGGATGAGGAGTGG - Intergenic
1181415175 22:22754124-22754146 CAGGGACGGTGGATGTGGAGGGG - Intronic
1181487257 22:23239123-23239145 CTGTCAGCTTGGATGAGGGGAGG + Intronic
1182422098 22:30253716-30253738 CAGTGAGCTTGGCTGGGGGAGGG - Intergenic
1182573319 22:31255327-31255349 CAGTGAGGTTGGAGGCAGAGGGG - Intronic
1183228830 22:36568240-36568262 CAGGGAGGTTGGTTTTGGAGGGG + Intronic
1183340797 22:37280109-37280131 CTGGGAGCTTGGATTTGGGGAGG - Intergenic
1183646986 22:39132656-39132678 CATTTAGGTTGGATGGGGAGGGG + Exonic
1183807052 22:40220397-40220419 CAATGGGGTGGGATGTGGAGGGG - Intronic
1185348706 22:50322498-50322520 GAGGGAGCTGGGATGTTGAGAGG + Intronic
949320865 3:2809081-2809103 CAGTGAGCTTTTATTTGGGGAGG + Intronic
950090778 3:10292681-10292703 CAGAGAGGCTGAATGTGGAGAGG + Intronic
950155555 3:10719038-10719060 CAGTGAGCTTGGATGGAGAGTGG - Intergenic
953496565 3:43392721-43392743 GAGTGAGCAGGGATGAGGAGTGG - Intronic
955343909 3:58146971-58146993 CTGTGATCTTGGCTGTGAAGGGG - Exonic
956278426 3:67528990-67529012 CACTGAGGTTGGTTGTGGTGGGG - Intronic
956293771 3:67690310-67690332 GAGTGATCTTGGTTGGGGAGTGG - Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957679462 3:83414182-83414204 AAGGCAGCATGGATGTGGAGAGG - Intergenic
958036553 3:88176199-88176221 TAGTGAGCTTTGATGTGGCCTGG + Intergenic
959753002 3:109860338-109860360 CTGTTAGCTTAGATGTAGAGGGG - Intergenic
959968241 3:112380247-112380269 CAATGCCCTGGGATGTGGAGGGG - Intergenic
960702098 3:120449365-120449387 CATTGTGCTTGGAAGTGGTGTGG + Intronic
961394540 3:126578036-126578058 TTGAGAGGTTGGATGTGGAGGGG + Intronic
962293667 3:134160125-134160147 AACTGAACTTGGATGAGGAGGGG + Intronic
962917330 3:139916506-139916528 CAGTGATCTAGGATATGTAGAGG + Intergenic
963202046 3:142596237-142596259 CTGGGAGCGTGGATGGGGAGAGG - Intergenic
963271403 3:143289458-143289480 CAGTGAGCTTCGTTTTGGACAGG - Intronic
967154194 3:186677563-186677585 CAGTGACCTTGGTTATGGGGTGG - Exonic
967983510 3:195079202-195079224 CAGTGACCTTGGAGAAGGAGAGG + Intronic
971408487 4:26344744-26344766 CAGTGGGCTTTGAGGTGGGGTGG - Intronic
971910335 4:32788245-32788267 CAGTGAGCTAGTATTAGGAGGGG + Intergenic
972621510 4:40751501-40751523 CAGTGAGGGAGGATGGGGAGAGG + Intronic
976522320 4:86042890-86042912 CAGTCACCTTGGATGTGAAGGGG + Intronic
977222869 4:94358103-94358125 CACTGAGTTGGGATGAGGAGAGG + Intergenic
979504030 4:121474248-121474270 CAGTGGGACAGGATGTGGAGGGG - Intergenic
982089741 4:151870097-151870119 CAGTGGTCATGGATGGGGAGGGG - Intergenic
983512044 4:168619317-168619339 CAGTGGGCTGGAATGTGGAAGGG + Intronic
984594290 4:181649870-181649892 CAGTCAACTTGGATCAGGAGTGG + Intergenic
984851439 4:184156536-184156558 AACAGAGCTTGGATGTGGTGTGG + Intronic
987052211 5:14157056-14157078 CAGTGAGAATGGGTGTGTAGAGG + Intronic
987301388 5:16600650-16600672 CAGTGTGCTGGGCTGAGGAGTGG - Intronic
987370425 5:17187820-17187842 CCGTGAGCTTGGAGGAGGGGTGG + Intronic
989519789 5:42388019-42388041 GACTGATCTTTGATGTGGAGAGG - Intergenic
992024433 5:72656656-72656678 CAGTGTGCAGAGATGTGGAGTGG - Intergenic
994406443 5:99351877-99351899 CAGTGTGCTTGGATGTACACAGG - Intergenic
995115530 5:108473813-108473835 CAGTGATCTTTGTAGTGGAGGGG - Intergenic
997208579 5:132064755-132064777 CAGTGAGCCAGGCTGGGGAGAGG - Intergenic
997639121 5:135437134-135437156 ATGTGAGCTGGGAGGTGGAGGGG + Intergenic
997804946 5:136907572-136907594 GAGTGAGCAAGGAGGTGGAGAGG - Intergenic
998127722 5:139635651-139635673 CTGTGACCTAGAATGTGGAGAGG - Intergenic
998569035 5:143240477-143240499 AAGTGAGCTCGGAGGTGGTGGGG - Intergenic
999128806 5:149266925-149266947 CAGTCAGCTTGGAAATGGAGTGG - Intergenic
999443070 5:151617412-151617434 CAGAGAGCTGGGTTGCGGAGGGG + Intergenic
1004027603 6:11834294-11834316 CAGCCAGCTTGCAGGTGGAGAGG + Intergenic
1004330951 6:14720620-14720642 AAGTGAGCTTTGAAGTTGAGTGG + Intergenic
1005659717 6:27984256-27984278 CAGTGATCCTGCATGTAGAGTGG - Intergenic
1006387920 6:33742256-33742278 CAGTCTGCTTGGACGGGGAGTGG + Intronic
1006514646 6:34539195-34539217 CAGTGAGCATGGAGGTTGTGGGG - Intronic
1006636846 6:35467445-35467467 CATTGAGCAGGGAAGTGGAGGGG - Intergenic
1006922573 6:37636407-37636429 CAATGAATTTGGAAGTGGAGAGG - Exonic
1007733290 6:43964944-43964966 CATTGACCTTGGGTGTGGGGTGG + Intergenic
1007742248 6:44019737-44019759 TATTGAGCTAGGATATGGAGAGG - Intergenic
1009456421 6:63861823-63861845 CAGTGAACTTGGTTCTGGTGAGG - Intronic
1011155809 6:84329795-84329817 CAGGGAGCAGGGATGGGGAGGGG + Intergenic
1011360093 6:86514582-86514604 CTGTGACTTTGGTTGTGGAGTGG - Intergenic
1014928141 6:127299327-127299349 CAGTGGGGTAAGATGTGGAGGGG + Intronic
1015629323 6:135215657-135215679 CAGTGGGAGGGGATGTGGAGTGG - Intronic
1016639860 6:146336143-146336165 CAATCAGTTTGGATGTGGAGTGG + Intronic
1018887597 6:167953702-167953724 CAGAGAGCTCTGATGGGGAGGGG - Intronic
1019193102 6:170265474-170265496 CAGTGAGACCAGATGTGGAGGGG - Intergenic
1019619235 7:1981585-1981607 GAGTGAGCTGGGCTTTGGAGTGG - Intronic
1021912969 7:25404938-25404960 CAGCGAGCTTGCATGTTGTGAGG - Intergenic
1023527028 7:41115491-41115513 CCCTGAGCTTGGAGGTGGACAGG + Intergenic
1023817378 7:43961443-43961465 CAGTGGGCTGGGAGGTGGCGAGG - Intergenic
1028396007 7:90369397-90369419 CAGAGAGGTTGGATCTAGAGAGG + Intronic
1028998959 7:97132678-97132700 CAGTGAGGTAGGATTGGGAGGGG + Intronic
1029742003 7:102496317-102496339 CAGTGGGCTGGGAGGTGGCGAGG - Intronic
1029759992 7:102595482-102595504 CAGTGGGCTGGGAGGTGGCGAGG - Intronic
1031643207 7:124190616-124190638 CACTGTGCTTGGCTGGGGAGAGG + Intergenic
1032079495 7:128851606-128851628 CTGTGATCTTGGCTGTGAAGGGG - Exonic
1032976241 7:137226582-137226604 CAGTTGGCTTTGATGTAGAGGGG + Intergenic
1033052217 7:138015765-138015787 GAGTGAGATTGGAGGTAGAGAGG - Intronic
1034004949 7:147460812-147460834 CAGTGACATTGGATGTGCATGGG + Intronic
1035535952 8:391378-391400 CAGAGAGCTTGGGCGTGGGGGGG + Intergenic
1037555456 8:20017955-20017977 TAGTGAGCTGGGGAGTGGAGTGG + Intergenic
1037725859 8:21482274-21482296 CAGTGGGCTTGGCTTGGGAGGGG + Intergenic
1037803309 8:22046516-22046538 CTATGAGCTTGGCTGTGGTGGGG - Exonic
1039714942 8:40098059-40098081 CAGTGAGGTGGGATGGGCAGGGG + Intergenic
1039881851 8:41630117-41630139 CAGTGACAGTGGGTGTGGAGTGG - Intergenic
1042526363 8:69768754-69768776 CAGTGTGATTGTATGTGGAGAGG - Intronic
1043760651 8:84063532-84063554 CTGTGAGCTGGGATTAGGAGAGG + Intergenic
1044820691 8:96153997-96154019 CAGTGGGCTGGGAAGTGGAGTGG + Intronic
1045345010 8:101286042-101286064 CAGTTAGCTTGGATTTTGAAGGG - Intergenic
1045525128 8:102934828-102934850 GAGAGAGCTTGCATGTGAAGTGG + Intronic
1045595542 8:103650722-103650744 CAGGCAGTTTGGATGAGGAGGGG - Intronic
1046890013 8:119412570-119412592 CAGTGGGACAGGATGTGGAGTGG + Intergenic
1047220910 8:122917392-122917414 CTGTGGGCTTGGGTGTGGTGGGG - Intronic
1048037768 8:130693565-130693587 CAGTGTGCTTGAATGCTGAGGGG + Intergenic
1048298489 8:133234202-133234224 CAGTGAGCTTGGCTGTCAATGGG + Intergenic
1048324864 8:133431042-133431064 CATTGAGCTAGGATCTGGTGAGG + Intergenic
1048507756 8:135035916-135035938 CAGTGAGCTTGGCTTGGCAGGGG + Intergenic
1049208266 8:141373348-141373370 CAGGGAGCATGGATGTCCAGGGG + Intergenic
1049586640 8:143435513-143435535 CAGGGAGCTTGGGCGTGCAGTGG - Intergenic
1049788138 8:144461087-144461109 CAGTGTGCCTGGGTGGGGAGAGG - Intronic
1050456054 9:5835568-5835590 AAGTGAGCTGGGATGTTCAGAGG + Intergenic
1051035580 9:12741004-12741026 CAGTGTGCTGGAATGAGGAGTGG + Intergenic
1051480734 9:17557095-17557117 CAGTCAGCTGGGTTGAGGAGAGG + Intergenic
1053061664 9:35036594-35036616 CTGTGAGCGTGGTTTTGGAGAGG - Intergenic
1055785755 9:79867101-79867123 CATGGAGATTGCATGTGGAGGGG - Intergenic
1056190196 9:84177298-84177320 CAGGGAACTTGGATTTTGAGGGG + Intergenic
1056617253 9:88179143-88179165 CAGGAAGCGTGGCTGTGGAGCGG + Intergenic
1057103210 9:92384667-92384689 CAGTGAACATGGATGTGTATGGG + Exonic
1058397463 9:104570847-104570869 CAGGGAGCTTATATGTGTAGTGG - Intergenic
1058495701 9:105557147-105557169 CAGTAAGCTTGTATGTGCATAGG + Intergenic
1058915346 9:109559487-109559509 CAGTGAGGCTGGATTTGGTGGGG - Intergenic
1059788713 9:117616509-117616531 CTGTGTGCTTGGTGGTGGAGTGG + Intergenic
1061230937 9:129315508-129315530 CAGGGGGCTGGGAGGTGGAGCGG - Intergenic
1187279913 X:17850345-17850367 CAGTGGGCATGGCTGAGGAGAGG + Intronic
1187826358 X:23335523-23335545 CAGTGGGCTTGGGGGTGGGGAGG + Intronic
1189657216 X:43257330-43257352 CAGTGAGTTGGGATGAGGAACGG + Intergenic
1189711443 X:43816794-43816816 CAGTGGCATTGGATTTGGAGTGG + Intronic
1192965846 X:76175899-76175921 CAGAAGGCTTGGATGGGGAGTGG + Intronic
1195960219 X:110378377-110378399 TGGGGAGATTGGATGTGGAGTGG - Intronic
1196510745 X:116509086-116509108 TAGTGAGATTGGGTGTGGAGTGG - Intergenic
1197719951 X:129738501-129738523 CAGTCAGCTTGGAGGAAGAGAGG + Intergenic
1198642161 X:138768146-138768168 GAGTGACCATGGCTGTGGAGAGG - Intronic
1198694707 X:139323602-139323624 CAGAAAGCTTGGATGTTAAGGGG + Intergenic
1198824976 X:140689960-140689982 GATTGAGGTTGGATGTGGAAGGG + Intergenic
1199395986 X:147338798-147338820 CAGTCAGTTAGCATGTGGAGGGG - Intergenic
1200840322 Y:7775125-7775147 CACTGAGCCTGGATGTGCATTGG - Intergenic