ID: 1124898367

View in Genome Browser
Species Human (GRCh38)
Location 15:33798683-33798705
Sequence TAACAAACCCCATTTTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124898367_1124898369 -8 Left 1124898367 15:33798683-33798705 CCTGAACAAAATGGGGTTTGTTA 0: 1
1: 0
2: 2
3: 18
4: 164
Right 1124898369 15:33798698-33798720 GTTTGTTACTATGGAAGAAGAGG 0: 1
1: 0
2: 3
3: 26
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124898367 Original CRISPR TAACAAACCCCATTTTGTTC AGG (reversed) Intronic
902231213 1:15028903-15028925 TAACAAACCCCAATATTTTGGGG - Intronic
906780339 1:48567693-48567715 TCTCAAAGCCCATTTTCTTCAGG - Intronic
908043127 1:60137146-60137168 AAACATAACCCATTTTCTTCTGG + Intergenic
910849618 1:91637689-91637711 TGATAACCCCCATTGTGTTCGGG + Intergenic
911238719 1:95440714-95440736 AAACAAACGCCTTTTTGTTCTGG + Intergenic
911427029 1:97729946-97729968 TATCAAAACCCATTCTTTTCAGG + Intronic
911841974 1:102694382-102694404 GAACAAACCCCATTTTTTGCTGG + Intergenic
916646086 1:166786367-166786389 CAACAAACCCCATTTTTCTTGGG + Intergenic
917672171 1:177283152-177283174 TGACAACCCCCATTTTGTTCAGG + Intergenic
918554847 1:185786412-185786434 TAAGAAACCTGATTTTGTTTTGG + Intronic
919726227 1:200886331-200886353 TAAAAAGCCCCAAATTGTTCAGG + Intergenic
920904309 1:210146922-210146944 AAAGAAATCCTATTTTGTTCAGG + Intronic
921729849 1:218565772-218565794 TAACAAAGCCCATTCTGATCTGG + Intergenic
922359543 1:224808956-224808978 TAACCAATCTCATTTTTTTCTGG + Intergenic
922958901 1:229627954-229627976 TAAAAAACCTCATTTAGGTCGGG + Intronic
923352108 1:233118037-233118059 AAACAAAACCCATTTGGTTATGG - Intronic
1063228048 10:4034416-4034438 AAACAAAGCCCATTTTGGTTTGG + Intergenic
1064434322 10:15297827-15297849 TAGAAAACCTCATTTTGTACCGG - Intronic
1068330083 10:55553434-55553456 TAAAAAACACCACTTTGTTCAGG - Intronic
1068942884 10:62697766-62697788 TAAAAAACCCCATCTTATCCAGG + Intergenic
1073698994 10:105903854-105903876 TAACAACCCCAGTGTTGTTCTGG + Intergenic
1074273465 10:111978360-111978382 TAGCAAACCCCATTTGCTTGAGG - Intergenic
1075111292 10:119587070-119587092 TGACAATCATCATTTTGTTCTGG - Intronic
1079913096 11:26335002-26335024 TATCAAAACCAATTTTGATCGGG - Intronic
1080235936 11:30068244-30068266 TAACACAACCCCTTTTGCTCAGG + Intergenic
1081936950 11:46911424-46911446 TAACAAACCACATTTGTTTATGG + Intronic
1082673271 11:56061217-56061239 TTATAAAACCCATTTTATTCAGG + Intergenic
1084837680 11:71814857-71814879 TAACACCCCACATTTTATTCAGG - Intergenic
1085471413 11:76760737-76760759 AAACAGACCCCCGTTTGTTCAGG - Intergenic
1086477003 11:87187549-87187571 CAACAAACTACATTTTGTTAGGG - Intronic
1086932775 11:92710579-92710601 TAAAAAATCCCATTCTGTTCTGG - Intronic
1087200108 11:95336411-95336433 AAATGAACCCCATTTTTTTCAGG + Intergenic
1088065125 11:105708281-105708303 TAACAAATCTCATTTGTTTCTGG - Intronic
1088124775 11:106411337-106411359 TAACACACTCCATTTTCTCCAGG - Intergenic
1088798223 11:113282625-113282647 TAACACAACCCATCTTGGTCAGG + Intergenic
1089181824 11:116588514-116588536 CAACAAACCTGATTTTGTTTGGG - Intergenic
1089767246 11:120776954-120776976 AATCAACCCCCATTGTGTTCAGG + Intronic
1091517120 12:1195986-1196008 AAAGAAACCCCAATTTGGTCAGG - Intronic
1091977098 12:4834269-4834291 TCAGAACCCCAATTTTGTTCAGG - Intronic
1094014123 12:25843673-25843695 TTACTAACCTCATTTTTTTCAGG + Intergenic
1095118922 12:38390418-38390440 TAAAATACCCCATTTTATTTTGG - Intergenic
1098375110 12:69806945-69806967 TAGGAGACTCCATTTTGTTCTGG - Intronic
1098736932 12:74117016-74117038 GAACGAACCCCATCTTTTTCTGG + Intergenic
1099251186 12:80256955-80256977 TAGCAAAACCAATTTAGTTCTGG - Intronic
1100992857 12:100268326-100268348 TGTAAAACCCCATTATGTTCTGG + Intronic
1103063948 12:117881553-117881575 CAACATTCCCCATTTTGCTCAGG + Intronic
1103081996 12:118031589-118031611 TAGCCTACCCCATTTTGGTCTGG + Exonic
1103505284 12:121438923-121438945 CAACTAACCCAATTTTGGTCTGG - Intronic
1103832849 12:123794259-123794281 TAAACAAACCCACTTTGTTCGGG - Intronic
1105050674 12:133047718-133047740 AAACAAACATCATTTTCTTCTGG + Intronic
1110778887 13:79441559-79441581 TAAGAATCCCCATTTTGGGCTGG + Intergenic
1110988098 13:82000200-82000222 CAACACACCTCAATTTGTTCAGG - Intergenic
1111168607 13:84496013-84496035 TGTCAAAACACATTTTGTTCAGG + Intergenic
1112606794 13:100914263-100914285 AAAAAAACCCGATTTTGCTCTGG + Intergenic
1115614729 14:35083896-35083918 AAACAAACTTCATTTTGTTAAGG - Intronic
1116349387 14:43840560-43840582 GAATAAATCCCACTTTGTTCTGG + Intergenic
1117073088 14:52073909-52073931 TTAGAAACCCCATATTGTTCAGG + Intergenic
1119148685 14:72338670-72338692 TAACAAGCCCCAGTTTGTATAGG - Intronic
1120592046 14:86387869-86387891 CAACAAAACTTATTTTGTTCTGG - Intergenic
1124898367 15:33798683-33798705 TAACAAACCCCATTTTGTTCAGG - Intronic
1125455193 15:39851387-39851409 TAAGCAACCCCATCTTGCTCTGG - Intronic
1126893201 15:53228714-53228736 TAACTAACCCTATTTTGTTATGG + Intergenic
1127046816 15:55034693-55034715 TAGCAACACCCAATTTGTTCCGG + Intergenic
1127318053 15:57816072-57816094 AAAGTAACCCCATTTTGTTCTGG + Intergenic
1127739757 15:61891215-61891237 TAATAAATTCCACTTTGTTCTGG + Intronic
1128384907 15:67140673-67140695 CCACAAACCCCCGTTTGTTCAGG - Intronic
1129896233 15:79108268-79108290 GAAGAAACTCCATTTGGTTCTGG + Intergenic
1130425185 15:83790381-83790403 TAATAAACCCCATTTGGTTATGG - Intronic
1131289570 15:91094809-91094831 AAATAAACCCCATTTTGTCATGG - Intergenic
1131339514 15:91583992-91584014 AACAAAACCCCATTTTATTCTGG - Intergenic
1132631758 16:921130-921152 AAACAAAGACCATTTTCTTCTGG + Intronic
1134887531 16:17806950-17806972 AAAAAAATCCCATTTTATTCAGG - Intergenic
1137400180 16:48146794-48146816 TAAGAAAACCCATTTTCTTGGGG - Intronic
1138403408 16:56768028-56768050 TAACAAACCCCATTTTAAAAAGG - Intronic
1140762496 16:78123223-78123245 TAAAAAGGCCCATTGTGTTCAGG + Intronic
1144998354 17:19286262-19286284 AAAAAAATCCCATTTTATTCAGG - Intronic
1153255550 18:3166663-3166685 ATTCAAACTCCATTTTGTTCAGG - Intronic
1153328512 18:3847829-3847851 TCACAAACCTCATTTCATTCTGG - Intronic
1153821961 18:8839632-8839654 TTCCAAACCCCATTCTCTTCAGG + Intergenic
1154115054 18:11606701-11606723 GAACAAATCCCATTTGGTTGTGG - Intergenic
1155416885 18:25607798-25607820 TAACAATGCCCATCTAGTTCAGG - Intergenic
1156393265 18:36673297-36673319 TAAAAAACCCCATTGTGTTATGG + Intronic
1157628843 18:49076425-49076447 TAACAAGCACCATTTTGTTTAGG + Intronic
1159324298 18:66894547-66894569 TAGGAGACTCCATTTTGTTCTGG + Intergenic
1159863924 18:73682471-73682493 TACCTAAAACCATTTTGTTCTGG + Intergenic
1165656044 19:37533163-37533185 TTACTAATCCCATTTGGTTCTGG + Intronic
925054995 2:850446-850468 TGACAACGCCCATTCTGTTCAGG - Intergenic
930517261 2:52423769-52423791 GACAAAACCACATTTTGTTCCGG - Intergenic
931484970 2:62681599-62681621 TAGCCAACCCTGTTTTGTTCAGG + Intronic
931708940 2:64970785-64970807 TAAACAACCCCATCTTGTTCAGG - Intergenic
932693394 2:73932669-73932691 AAACATACCCAATTTTGGTCAGG - Intronic
936625891 2:114149047-114149069 TAACTAATCCCATACTGTTCTGG + Intergenic
937943673 2:127311319-127311341 CAACAAAGCCCATTTTTTACTGG + Intronic
938959166 2:136325463-136325485 TTAGAGACCCCACTTTGTTCAGG - Intergenic
939081929 2:137673088-137673110 CAGCAAACCACATTTTGTTTTGG - Intronic
939568007 2:143807620-143807642 TAACAAAGGCAATATTGTTCAGG + Intergenic
939599452 2:144170679-144170701 CATCAAACACCTTTTTGTTCTGG - Intronic
942367770 2:175246212-175246234 AAAAAAAACCCATTTTTTTCAGG + Intergenic
942574440 2:177348655-177348677 TAATGAACCCCATTGTGTGCTGG + Intronic
942608000 2:177712182-177712204 TAACAAAACACATTTTGCCCTGG - Intronic
942682745 2:178495039-178495061 TAAAAAGCCCAATTTTGTTCAGG - Intronic
943403656 2:187451399-187451421 TGTCAAACCACATTTTGGTCTGG - Intergenic
943749325 2:191494994-191495016 TAGCAAACCTCATTTTGTGGTGG - Intergenic
947207503 2:227675275-227675297 TAACAAACACCATTTGATTATGG - Intergenic
1173636199 20:44560490-44560512 TACCAAAGCCATTTTTGTTCTGG + Intronic
1174247512 20:49192845-49192867 TAACAAACAGGATTTTGTTTTGG + Intergenic
1174917786 20:54671458-54671480 TAACAACCCTGATTTTGTTTGGG + Intergenic
1175627657 20:60502220-60502242 TAACAAAACCCCTTTTATTTAGG + Intergenic
1180979019 22:19870015-19870037 CAACAAACCCAAGTGTGTTCAGG - Intergenic
951866463 3:27314101-27314123 GAACCCACCACATTTTGTTCTGG - Intronic
954817411 3:53293791-53293813 AAACAAACCCAGTTTTGTCCAGG + Intronic
956624958 3:71257997-71258019 TAACAATTACCATTTTGTTGAGG - Intronic
957328224 3:78724378-78724400 TAACAATCAACATTTTGGTCAGG + Intronic
957741862 3:84280811-84280833 TAAAAAAACCCATTATGTTAAGG - Intergenic
962483160 3:135815461-135815483 TAACAGAACCAGTTTTGTTCAGG - Intergenic
963278578 3:143358160-143358182 TACCAGACCCCATCTTGTACAGG - Intronic
966211731 3:177460367-177460389 TAATAAAACCCATTTTCATCAGG + Intergenic
967734708 3:192939907-192939929 TAAAAAATCCAATTTAGTTCAGG + Intergenic
969779103 4:9382362-9382384 TAACACCCCACATTTTATTCAGG - Intergenic
970277428 4:14416809-14416831 TAACAAACCACTTTTGGTTCTGG + Intergenic
976942833 4:90727431-90727453 TAACAACATCAATTTTGTTCAGG - Intronic
978066601 4:104411984-104412006 CAACAAACCAGTTTTTGTTCAGG + Intergenic
978333424 4:107640776-107640798 TAAAAAACCGCCTTTTGCTCAGG + Intronic
981531252 4:145755752-145755774 AAATAAACCCCATTTTGTGTGGG + Intronic
981755079 4:148134195-148134217 TCACAAAGCAGATTTTGTTCAGG + Intronic
985996074 5:3597555-3597577 GATCAGCCCCCATTTTGTTCAGG + Intronic
987990462 5:25202955-25202977 TGACTAACCACATTTTATTCAGG + Intergenic
992032754 5:72739515-72739537 TAATAAACCACTTTTTGTTGAGG - Intergenic
992603760 5:78433985-78434007 TAGCAAAGCCCATTTTCCTCAGG - Intronic
993475687 5:88361497-88361519 TAAAAAATCCCATTTTCTTCTGG + Intergenic
994862128 5:105210125-105210147 TAATAAACCCAATTTTGTACAGG + Intergenic
996743466 5:126824480-126824502 TAACAAGCCACATTTTGCTGCGG + Intronic
996784571 5:127224525-127224547 TAAGAACACCAATTTTGTTCAGG + Intergenic
996868704 5:128160437-128160459 TTCCAACCCCCATTTTTTTCTGG - Intronic
997194363 5:131968037-131968059 TAACAAATGCCATCTTGCTCCGG - Intronic
1001292751 5:170475781-170475803 TAACAGACCCAATTTTGTTCAGG + Intronic
1001459298 5:171895455-171895477 TAATAAGCCACATTTTATTCAGG - Intronic
1004549629 6:16634194-16634216 AAACTAACCCCATCTAGTTCTGG + Intronic
1005128038 6:22471166-22471188 TAACAAAATCCATGTTGATCAGG - Intergenic
1008088102 6:47265316-47265338 TAGCAAAGCCCAGCTTGTTCTGG - Intronic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1010291396 6:74142018-74142040 TAACAAACCCCCTTCGTTTCAGG - Intergenic
1010368700 6:75082456-75082478 TCACAAACCCCTTTTTATTAGGG + Intergenic
1012666961 6:101983271-101983293 TAACTAACTTCATTTTGCTCTGG - Intronic
1013676145 6:112465159-112465181 TAACAATCCCCAGTTGCTTCAGG + Intergenic
1014951832 6:127565057-127565079 GAACAAACTCCAGTTTGTTGAGG - Intronic
1018912965 6:168114625-168114647 TATCAAACTCACTTTTGTTCAGG - Intergenic
1019986044 7:4656642-4656664 GAACAAACACCCTTTTTTTCAGG - Intergenic
1020339195 7:7091005-7091027 AAACAAATCCCATTTTCATCTGG - Intergenic
1021272534 7:18608722-18608744 TGACAAACCACACTTTGTGCTGG + Intronic
1021773482 7:24028441-24028463 TAACAAAAGTCATTTTGTTTTGG + Intergenic
1022098685 7:27156636-27156658 CACCAAACCCCATTTTCTTTTGG + Exonic
1024535833 7:50431651-50431673 TCACAAATTCCTTTTTGTTCTGG - Intergenic
1027967505 7:85030958-85030980 GAACAAGCCATATTTTGTTCAGG - Intronic
1031842055 7:126754967-126754989 AAACAAACACCATTTTGTGTTGG - Intronic
1033409106 7:141100112-141100134 TAAGAGACACCATTTTGGTCGGG - Intronic
1033792530 7:144808219-144808241 TAACAGACTACATTTGGTTCTGG + Intronic
1034642689 7:152617145-152617167 TATCAAACCACTTTTTGTTTAGG + Intergenic
1036276536 8:7356323-7356345 TAACACCCCACATTTTATTCTGG - Exonic
1037056941 8:14454373-14454395 TAACAAACTGTATTTAGTTCAGG + Intronic
1041000830 8:53450954-53450976 GAACAAACTCCACTTTGTTGTGG + Intergenic
1041860796 8:62510560-62510582 TAACAAACCCTATTTTCATAAGG - Intronic
1042007706 8:64200614-64200636 TAAAAAAAACCATTTTTTTCAGG - Intergenic
1042954872 8:74238951-74238973 TAACAACCCACATTTGGGTCAGG - Intronic
1044419374 8:91975626-91975648 TATAAAACTCCATTTTTTTCAGG - Intronic
1047182556 8:122603408-122603430 AAACAAACCCCCTTTTGCCCAGG - Intergenic
1048074584 8:131055576-131055598 TCACAAACATTATTTTGTTCTGG + Intergenic
1056602188 9:88054979-88055001 CCACAAACCTCATTTTGTACGGG - Intergenic
1058741091 9:107943294-107943316 TAAAATACCACAGTTTGTTCAGG + Intergenic
1059542026 9:115140180-115140202 TAACAAAACCCAATTTCTTCTGG + Intergenic
1059564053 9:115365116-115365138 TATCAAAGCCCATTTTATGCTGG - Intronic
1060119399 9:120974010-120974032 TAACAAACACCAATTTGTGAAGG + Intronic
1061641775 9:131963845-131963867 TCACAAAGCCCATTTTCTCCGGG - Intronic
1062275576 9:135728804-135728826 TCACAAACCCCTTTTTAATCTGG + Intronic
1188362615 X:29274216-29274238 TGACATACTGCATTTTGTTCAGG - Intronic
1190424466 X:50319951-50319973 AGATAAACCCCATTTTGTCCTGG + Intronic
1192695515 X:73411335-73411357 ACACAAACCCCAGCTTGTTCTGG + Intergenic
1195481402 X:105349859-105349881 TAAAAAACAACATTTTTTTCTGG - Intronic
1195521729 X:105838387-105838409 TATCTAACACCATTTTGTTAAGG + Intronic
1195955286 X:110322528-110322550 TAACTAATCTCATTGTGTTCTGG + Intronic
1198047020 X:132913355-132913377 TAACACACCCCTGTTTGCTCAGG + Intronic
1200011197 X:153122323-153122345 TGACAAAGTCAATTTTGTTCTGG - Intergenic
1200028402 X:153277599-153277621 TGACAAAGTCAATTTTGTTCTGG + Intergenic
1200938259 Y:8757289-8757311 TTACACTCCCCATTTTGCTCTGG + Intergenic
1201890366 Y:18937232-18937254 TAACATACACAATTTTGTACTGG + Intergenic