ID: 1124900844

View in Genome Browser
Species Human (GRCh38)
Location 15:33821005-33821027
Sequence CCTTTTGGATACCATAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124900844_1124900848 11 Left 1124900844 15:33821005-33821027 CCACAATTATGGTATCCAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1124900848 15:33821039-33821061 TGTTCTATCAGTACAAAAAATGG 0: 1
1: 0
2: 1
3: 26
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124900844 Original CRISPR CCTTTTGGATACCATAATTG TGG (reversed) Intronic
901481971 1:9531379-9531401 GCTTTTGGATTTCAGAATTGTGG - Intergenic
907345683 1:53777670-53777692 CTTTTTGGATATCAGAATTGAGG - Intronic
911773858 1:101782966-101782988 ATTTTTGGTTACCATAACTGGGG - Intergenic
912199747 1:107443284-107443306 ACTTTTGGAAACCAGAAGTGAGG - Intronic
917457672 1:175199459-175199481 CATTTTGGTTACCAGAATTATGG - Intergenic
918898165 1:190375460-190375482 GCTTTTGAATACATTAATTGGGG - Intronic
920854414 1:209651533-209651555 CCTGTTGCATCCCAGAATTGTGG - Intronic
1065575911 10:27118045-27118067 CCATGTGGATACCAAAATTCAGG - Intronic
1066242848 10:33554605-33554627 TCTTTTGGGTACCTTGATTGTGG - Intergenic
1066991713 10:42520912-42520934 CCTTTTGAATACAATGAATGTGG - Intergenic
1068144549 10:53050858-53050880 CCTTTTGAATTCCATATTTCTGG - Intergenic
1068284593 10:54917746-54917768 CCTTTTGGATACCATAAAAATGG + Intronic
1069100313 10:64311939-64311961 CCTTATTAATACCATAATTGAGG - Intergenic
1069285064 10:66703603-66703625 CCTTTTTGTTAACATAATAGTGG + Intronic
1069340669 10:67404616-67404638 CATTTTGGATAACATAATTCAGG + Intronic
1071723298 10:88169373-88169395 GCTTTTGGAAACCAGACTTGTGG - Intergenic
1072114458 10:92356534-92356556 CCTTTTGAATAAGATAATGGTGG - Intergenic
1072156495 10:92728668-92728690 CTTTTTGGTTATCACAATTGTGG - Intergenic
1072482191 10:95819904-95819926 CCTTGTGGATAACAGAAATGTGG - Intronic
1074519213 10:114202152-114202174 CATTGAGAATACCATAATTGTGG + Intronic
1080540577 11:33260178-33260200 CTTTTTGGATACCATAAAATAGG + Intronic
1083220684 11:61250335-61250357 CCTTTTGGATGCGAAAACTGAGG - Intronic
1086538011 11:87872539-87872561 CTTTTCTGATACCATAATAGTGG - Intergenic
1087493566 11:98860034-98860056 TCTGTAGGATACTATAATTGCGG + Intergenic
1087828163 11:102789692-102789714 ACTTTTGGAATCCATAAATGGGG + Intergenic
1092456384 12:8647153-8647175 GCTTTTGGATATCCTGATTGGGG - Exonic
1095841010 12:46692984-46693006 CCTTTTGGCTGCCATAACTAAGG - Intergenic
1098822843 12:75254478-75254500 ACTTGTGGGTACTATAATTGGGG - Intergenic
1101890920 12:108714467-108714489 CCTTTTAGATACTATCCTTGGGG - Intronic
1110392037 13:74984991-74985013 CCTTTTGGAATTCATTATTGGGG - Intergenic
1114070544 14:19102045-19102067 CATTTTGGAAAACAAAATTGTGG - Intergenic
1114091716 14:19297960-19297982 CATTTTGGAAAACAAAATTGTGG + Intergenic
1115401960 14:32971768-32971790 CCGTTTGGAGACCATGATTATGG - Intronic
1118291015 14:64523101-64523123 CCTTTTCGATGTCCTAATTGTGG + Exonic
1119495061 14:75070910-75070932 GCTTTGGGATACCAGGATTGAGG - Exonic
1120390667 14:83903820-83903842 CATTTTGGAAAAAATAATTGAGG - Intergenic
1124900844 15:33821005-33821027 CCTTTTGGATACCATAATTGTGG - Intronic
1128185431 15:65640240-65640262 CCTTTGGGATTCCAGACTTGGGG - Intronic
1129526026 15:76215022-76215044 CCTGTTGGATGCTATAACTGGGG - Intronic
1130174886 15:81558254-81558276 CTTTTTGGAAAACATATTTGAGG - Intergenic
1132888622 16:2193761-2193783 CCTTGAGGAGACCATAAGTGGGG - Intronic
1135842008 16:25885462-25885484 ACTTTGGGATACCTTATTTGGGG + Intronic
1140893795 16:79307487-79307509 CCTGTTGGAAACCAGAATTGAGG + Intergenic
1142737890 17:1913143-1913165 CCCTTGGGTTACCATAATTTTGG - Intergenic
1144962677 17:19054777-19054799 CCATTTGTATACCTTATTTGAGG - Intergenic
1144972484 17:19119744-19119766 CCATTTGTATACCTTATTTGAGG + Intergenic
1146050335 17:29546082-29546104 ACTTTTGGATACTAGAATTTGGG - Exonic
1153065596 18:1040924-1040946 CATTTTGGAAAACATATTTGGGG + Intergenic
1156623302 18:38878955-38878977 CATTTTGGATTCCATATTTTTGG + Intergenic
1159213867 18:65364768-65364790 CCTTTCTGATAAAATAATTGAGG - Intergenic
1159478031 18:68949336-68949358 CCTTTTGGATAGGAGAGTTGGGG + Intronic
1164955522 19:32379928-32379950 CCTTGTGAACACCAGAATTGTGG + Intronic
928111146 2:28509776-28509798 CCCTTGGGATTCCATGATTGGGG + Intronic
928458068 2:31442359-31442381 CCTTTTTAATACCATAATATAGG + Intergenic
930742110 2:54842165-54842187 CCTGTAGGATACTATAATGGTGG - Intronic
932714045 2:74088777-74088799 CCTGTTGCATATCTTAATTGTGG - Intronic
933904149 2:86872653-86872675 CCTTTGGGATACCAAAATCTCGG + Intergenic
935448259 2:103179815-103179837 GCTTTTTGAGAACATAATTGGGG + Intergenic
935776355 2:106476326-106476348 CCTTTGGGATACCAAAATCTCGG - Intergenic
936747643 2:115598154-115598176 CCTTTTGGATAGCATATATTGGG + Intronic
942009536 2:171746383-171746405 CCTATTGGATTCCATTACTGTGG - Intronic
942805255 2:179923386-179923408 CCTTTTGGATTACATAGGTGTGG + Intergenic
943896625 2:193370671-193370693 CCTTCTGGCTGCCAGAATTGTGG + Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
945680920 2:212913154-212913176 TATTCTGGATACCATAATTAAGG + Intergenic
945731643 2:213544611-213544633 CCTGTTTGATACTATAATGGTGG - Intronic
947169280 2:227294913-227294935 CTTTTTGTATACCATAGTTTGGG + Intronic
947886221 2:233573925-233573947 CCTTTTGGAGCTCATAAATGTGG - Intergenic
948397383 2:237656048-237656070 ACTTCTGGAAACTATAATTGGGG + Intronic
948930638 2:241129603-241129625 CTTTTTGGATTTCATAATTTTGG + Intronic
1174721599 20:52818762-52818784 CCTTTTGGAGAAAAAAATTGAGG + Intergenic
1180489015 22:15824512-15824534 CATTTTGGAAAACAAAATTGTGG - Intergenic
1181452162 22:23030717-23030739 CCTTCAGAATACCATAATTCTGG - Intergenic
1182079264 22:27517748-27517770 CCTTTTAGATACCTTCCTTGAGG - Intergenic
951912170 3:27762223-27762245 CATTTCAGATACCATGATTGAGG + Intergenic
952194729 3:31062682-31062704 CCCTTTGGATACAAAAATTATGG - Intergenic
953122406 3:40057650-40057672 CCTTTTTGATAACATATTTTAGG - Intronic
954314986 3:49796132-49796154 CCTTTTGGAGATCCTAAGTGAGG - Intronic
955767932 3:62364458-62364480 CCTTGTTGATTCCATCATTGAGG - Intergenic
957432097 3:80123954-80123976 TCTTTATGATACCGTAATTGTGG + Intergenic
957709469 3:83836453-83836475 GCTTTTAAAAACCATAATTGAGG - Intergenic
962396373 3:135018282-135018304 CCTTTTGGCTACTATGATGGGGG + Intronic
963576845 3:147071058-147071080 CAGTTTGGATAACATATTTGAGG + Intergenic
963656172 3:148053797-148053819 TCTGTATGATACCATAATTGTGG + Intergenic
963845051 3:150147145-150147167 CATTTTGGATCCCATATATGAGG - Intergenic
964781154 3:160339518-160339540 CATTTTGGAGACAAAAATTGTGG - Intronic
965303409 3:167033064-167033086 CTTTTTAGATAGAATAATTGAGG + Intergenic
966951831 3:184827082-184827104 TCTTTTGGAAAACATAACTGCGG - Intronic
969971956 4:11057106-11057128 CCTTTTGGATGACATACATGTGG + Intergenic
973817338 4:54631213-54631235 ATTTTTGGATACCAAAATTTAGG - Intergenic
976237781 4:82917976-82917998 CCTTTGGGAAAACATAATTTTGG - Exonic
978018368 4:103777730-103777752 TCTATATGATACCATAATTGTGG - Intergenic
978080426 4:104583278-104583300 CCTATTGAATAGCCTAATTGGGG - Intergenic
983045583 4:162982857-162982879 CCTTTTGCATACCATTCCTGTGG - Intergenic
983996974 4:174194027-174194049 ACTTTTGAAAACAATAATTGAGG - Intergenic
986410008 5:7468192-7468214 CCTTTTGAAGAACATACTTGGGG + Intronic
987024202 5:13907588-13907610 CATTTTGGAAAACATATTTGAGG - Intronic
987139798 5:14933405-14933427 CCTTTTGGCTATTATAAATGGGG - Intergenic
988377973 5:30462718-30462740 CCCCTTGGATACCAAAATTTGGG - Intergenic
993035499 5:82751651-82751673 CCATTTGGTTTCCTTAATTGCGG + Intergenic
993356280 5:86912718-86912740 TCTTTATGATACTATAATTGTGG + Intergenic
993432563 5:87849751-87849773 CCTTTTGGATACAACATGTGTGG + Intergenic
995388126 5:111610862-111610884 CCTTTTGGATAACAAACTTTTGG + Intergenic
997752589 5:136361549-136361571 CCTTTTGGAGACAGAAATTGTGG + Intronic
1004388747 6:15191611-15191633 ACTTTTGGATCCCACAACTGTGG - Intergenic
1005603493 6:27451364-27451386 CCTTTTGGATGTAATGATTGTGG - Exonic
1005797081 6:29375970-29375992 CCTTTTGGATTGAAAAATTGGGG - Intronic
1007940884 6:45780375-45780397 TCTTTAGGATACCCTAATCGTGG + Intergenic
1009387916 6:63109536-63109558 ACATTATGATACCATAATTGTGG - Intergenic
1011984789 6:93429918-93429940 CCATTTGGATATCATCATTTGGG + Intergenic
1015423762 6:133040403-133040425 CCATTTGGATATGATAAGTGAGG - Intergenic
1015639478 6:135315661-135315683 TCTTTTGGATACCATAAGAATGG - Intronic
1016263081 6:142197702-142197724 CTTATTGGATAGCATAAATGTGG + Intronic
1016581752 6:145636089-145636111 CCTTTTGGAAATTATCATTGAGG + Intronic
1018501601 6:164416565-164416587 CCTTTTGGATCCCATTTTAGAGG + Intergenic
1023160926 7:37294615-37294637 TCTTTGTGATACCAAAATTGAGG + Intronic
1024697647 7:51872511-51872533 CCATTTGGAAACCATATTTTAGG - Intergenic
1025149301 7:56536470-56536492 CCTTTTGGATATAAAAATTGGGG - Intergenic
1030180058 7:106697400-106697422 TCTGTAGGATACCATAATGGTGG - Intergenic
1030362686 7:108611268-108611290 ATTTTTAGTTACCATAATTGTGG + Intergenic
1030472383 7:109981224-109981246 TCTTTTAGAAACCATCATTGTGG + Intergenic
1032326665 7:130935471-130935493 TCTATTGGAGACCATAATCGAGG + Intergenic
1033905826 7:146201001-146201023 CCTTTTGGATTCAGTAATTCAGG - Intronic
1034103962 7:148474840-148474862 CATTTTGGATGCCATAAATATGG - Intergenic
1034111371 7:148540910-148540932 CCTTTTGGAAAACACAATTTAGG - Intergenic
1035591308 8:816801-816823 CCATTTGGAAAACATATTTGAGG - Intergenic
1035795270 8:2350362-2350384 CCTGTATGATACCATAGTTGTGG + Intergenic
1037631354 8:20659524-20659546 TCTTTATGATACCATAATGGTGG + Intergenic
1038954640 8:32454155-32454177 CCATTTGGATTTCAGAATTGTGG + Intronic
1041266438 8:56070046-56070068 TCTCTTGAATACCAAAATTGAGG - Intronic
1043749376 8:83916357-83916379 TATTTTGGAGACCATAATGGTGG + Intergenic
1048756924 8:137749826-137749848 CCTTTTTGATCCAGTAATTGTGG + Intergenic
1058078621 9:100676789-100676811 CCTATTGGATACTACAATAGTGG - Intergenic
1059770728 9:117422154-117422176 CCTTCTGGAAACTATAATTTAGG - Intergenic
1061771856 9:132930798-132930820 CCTTTTTGATACCATGATATAGG + Intronic
1186523762 X:10228925-10228947 CATTTTGGTTGCCATAATGGGGG + Intronic
1186624267 X:11275618-11275640 CCTTTTGAAAGCCATCATTGAGG + Intronic
1193549149 X:82869079-82869101 GCTTTTGGTTTCCATTATTGTGG + Intergenic
1195540052 X:106053235-106053257 CTTTTTAGATTCCATATTTGAGG - Intergenic
1195887466 X:109654988-109655010 TCTTTTGGCTACCAGAATTCTGG + Intronic
1196226231 X:113170659-113170681 CCTTTTGGAAGCAATAATAGAGG - Intergenic
1198136876 X:133761811-133761833 CCTTCTGGACACCATAATTTGGG + Intronic
1199353705 X:146835206-146835228 TCCTTTGGATACCATACTTTGGG - Intergenic
1201384742 Y:13426712-13426734 CCTTTTGAATACAGTATTTGTGG - Intronic