ID: 1124902051

View in Genome Browser
Species Human (GRCh38)
Location 15:33833037-33833059
Sequence GAGTCTCCATAGGACCACGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124902051 Original CRISPR GAGTCTCCATAGGACCACGT AGG Intronic
901949146 1:12727515-12727537 GAGCCTCCAGAAGACCAAGTGGG - Exonic
917513655 1:175689093-175689115 CTGTCTCTGTAGGACCACGTCGG + Intronic
921803350 1:219427111-219427133 GAAAGTCCATAGGACCACATGGG - Intergenic
1075608689 10:123834649-123834671 CAGTCTCCATAGGCCCTTGTGGG + Intronic
1086960843 11:92978975-92978997 GAGTCTCCATAGGACCCGCTGGG - Intronic
1096473110 12:51891029-51891051 GAGTCCCCAGAGGTCCCCGTGGG + Exonic
1096814590 12:54193915-54193937 GAGTGGCCATGGGACCAAGTGGG + Intergenic
1102203741 12:111075855-111075877 TAGTCTCCATCAGACCAAGTGGG + Intronic
1113746590 13:112749659-112749681 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746647 13:112749939-112749961 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746667 13:112750033-112750055 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746686 13:112750126-112750148 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746705 13:112750219-112750241 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746724 13:112750312-112750334 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746742 13:112750405-112750427 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746760 13:112750499-112750521 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746778 13:112750592-112750614 GAGTCTCCATCCTCCCACGTGGG + Intronic
1119692076 14:76681319-76681341 GACTTTCCATAGGAACAGGTGGG - Intergenic
1122642826 14:103170600-103170622 GGGTCTTCATAGCCCCACGTTGG - Intergenic
1124902051 15:33833037-33833059 GAGTCTCCATAGGACCACGTAGG + Intronic
1125315868 15:38430495-38430517 GTGTCTCAAAAGGACCACTTGGG + Intergenic
1148701195 17:49588001-49588023 CAGGCTCCCTAGGACCAAGTAGG - Intergenic
1160451447 18:78969168-78969190 GAGTCTGTATAGAACCACCTGGG - Intergenic
1167525176 19:49979113-49979135 GTGTCTCCATATGACCCCATTGG - Exonic
926988925 2:18655789-18655811 AACTCTCCTTAGGACCACATAGG - Intergenic
929133459 2:38601963-38601985 GGGTCTCCATAGGACCGAGGCGG + Intronic
937719086 2:125071069-125071091 GAGGCTCCACAGGAGCACCTGGG - Intergenic
942078742 2:172381018-172381040 GAATCTCCATAGAACCAGGAAGG + Intergenic
948163517 2:235844021-235844043 GAGTCCCCAAAGGACCACCCAGG + Intronic
1171314470 20:24177009-24177031 AAGTCTCCATAGCACCACTATGG + Intergenic
962344400 3:134608906-134608928 GGGTGTCCATAGGACCACTCCGG - Intronic
977556670 4:98494148-98494170 GAGTCTCCCTTGTACCACGATGG - Intronic
985058281 4:186054906-186054928 GAGTATCCATAGGCCCAGGCTGG - Intergenic
1015812832 6:137178214-137178236 GAGTCTCCATAGGTCCCAGGAGG + Intergenic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1019631326 7:2051380-2051402 AAGGCTCCACAGCACCACGTGGG - Intronic
1027327599 7:77060401-77060423 GAGTCTCCAGCGGAGCACCTCGG - Intergenic
1036202788 8:6783331-6783353 CTGTCTCCAGAGGACAACGTAGG + Intergenic
1044557696 8:93582053-93582075 GACTATCCATTGGCCCACGTGGG - Intergenic
1193449602 X:81649589-81649611 GAGACGCCAGAGGACCACCTGGG + Intergenic
1200868662 Y:8073846-8073868 GTGTGTCCATATGAGCACGTAGG - Intergenic