ID: 1124908135

View in Genome Browser
Species Human (GRCh38)
Location 15:33891462-33891484
Sequence CACCTGTGAATAAGAACATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25778
Summary {0: 2, 1: 52, 2: 894, 3: 9579, 4: 15251}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124908128_1124908135 18 Left 1124908128 15:33891421-33891443 CCCTCCCTGTCTGTGTCCAAGTG 0: 1
1: 2
2: 5
3: 40
4: 363
Right 1124908135 15:33891462-33891484 CACCTGTGAATAAGAACATGTGG 0: 2
1: 52
2: 894
3: 9579
4: 15251
1124908130_1124908135 14 Left 1124908130 15:33891425-33891447 CCCTGTCTGTGTCCAAGTGTTCT 0: 1
1: 85
2: 3976
3: 22237
4: 17011
Right 1124908135 15:33891462-33891484 CACCTGTGAATAAGAACATGTGG 0: 2
1: 52
2: 894
3: 9579
4: 15251
1124908131_1124908135 13 Left 1124908131 15:33891426-33891448 CCTGTCTGTGTCCAAGTGTTCTC 0: 2
1: 183
2: 5753
3: 20977
4: 15351
Right 1124908135 15:33891462-33891484 CACCTGTGAATAAGAACATGTGG 0: 2
1: 52
2: 894
3: 9579
4: 15251
1124908127_1124908135 19 Left 1124908127 15:33891420-33891442 CCCCTCCCTGTCTGTGTCCAAGT 0: 1
1: 2
2: 5
3: 66
4: 413
Right 1124908135 15:33891462-33891484 CACCTGTGAATAAGAACATGTGG 0: 2
1: 52
2: 894
3: 9579
4: 15251
1124908132_1124908135 2 Left 1124908132 15:33891437-33891459 CCAAGTGTTCTCATTGTTCAGTT 0: 840
1: 6119
2: 14881
3: 15008
4: 7712
Right 1124908135 15:33891462-33891484 CACCTGTGAATAAGAACATGTGG 0: 2
1: 52
2: 894
3: 9579
4: 15251
1124908129_1124908135 17 Left 1124908129 15:33891422-33891444 CCTCCCTGTCTGTGTCCAAGTGT 0: 1
1: 1
2: 14
3: 39
4: 280
Right 1124908135 15:33891462-33891484 CACCTGTGAATAAGAACATGTGG 0: 2
1: 52
2: 894
3: 9579
4: 15251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124908135 Original CRISPR CACCTGTGAATAAGAACATG TGG Intronic
Too many off-targets to display for this crispr