ID: 1124911903

View in Genome Browser
Species Human (GRCh38)
Location 15:33929388-33929410
Sequence CTGTCTACAGCTATGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124911903_1124911907 11 Left 1124911903 15:33929388-33929410 CCACACTGCATAGCTGTAGACAG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1124911907 15:33929422-33929444 ATAGGACTAGGGCCAGCCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 107
1124911903_1124911906 0 Left 1124911903 15:33929388-33929410 CCACACTGCATAGCTGTAGACAG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1124911906 15:33929411-33929433 TCTTTCAACTGATAGGACTAGGG 0: 1
1: 0
2: 1
3: 12
4: 132
1124911903_1124911904 -7 Left 1124911903 15:33929388-33929410 CCACACTGCATAGCTGTAGACAG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1124911904 15:33929404-33929426 TAGACAGTCTTTCAACTGATAGG 0: 1
1: 0
2: 2
3: 48
4: 396
1124911903_1124911905 -1 Left 1124911903 15:33929388-33929410 CCACACTGCATAGCTGTAGACAG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1124911905 15:33929410-33929432 GTCTTTCAACTGATAGGACTAGG 0: 1
1: 0
2: 4
3: 20
4: 200
1124911903_1124911909 18 Left 1124911903 15:33929388-33929410 CCACACTGCATAGCTGTAGACAG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1124911909 15:33929429-33929451 TAGGGCCAGCCTCTGGGCCGAGG 0: 1
1: 0
2: 2
3: 13
4: 214
1124911903_1124911910 19 Left 1124911903 15:33929388-33929410 CCACACTGCATAGCTGTAGACAG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1124911910 15:33929430-33929452 AGGGCCAGCCTCTGGGCCGAGGG 0: 1
1: 0
2: 0
3: 22
4: 215
1124911903_1124911908 12 Left 1124911903 15:33929388-33929410 CCACACTGCATAGCTGTAGACAG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1124911908 15:33929423-33929445 TAGGACTAGGGCCAGCCTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124911903 Original CRISPR CTGTCTACAGCTATGCAGTG TGG (reversed) Intronic
900348065 1:2220617-2220639 CTGACTGCAGCCCTGCAGTGGGG - Intergenic
903029502 1:20452752-20452774 CTGTCCACATCTATGAAATGGGG - Intergenic
903259668 1:22124571-22124593 CTCTCTACAGCTCTGCTCTGTGG + Intronic
904481131 1:30794093-30794115 GTGTGTAGTGCTATGCAGTGTGG - Intergenic
907519274 1:55012483-55012505 ATGTCCACATTTATGCAGTGGGG + Intergenic
907914370 1:58855078-58855100 GTTTCTTCAGCAATGCAGTGGGG - Intergenic
908068826 1:60436067-60436089 CTGGTTAAAGCTATGCAGTTTGG + Intergenic
910542313 1:88373971-88373993 GTGTCTAAGGCTATGCAGAGTGG - Intergenic
911087820 1:93993826-93993848 CTGTCTCCAGTTATAAAGTGTGG + Intronic
915151698 1:153838088-153838110 CTTTCTAAAGCTTTGCAGTTGGG - Intronic
919863904 1:201764372-201764394 CTGTCTACAGCCAGGAAGAGAGG - Intronic
1066250412 10:33627336-33627358 CAGTCTTCAGCAATGCTGTGAGG + Intergenic
1067511895 10:46903140-46903162 CTGTCAGAAGCTATACAGTGGGG - Intergenic
1067650352 10:48148684-48148706 CTGTCAGAAGCTATACAGTGGGG + Intergenic
1067690451 10:48498262-48498284 CCTGGTACAGCTATGCAGTGTGG - Intronic
1068277365 10:54818583-54818605 CTGACTACTGCCATGCTGTGAGG + Intronic
1070682057 10:78455629-78455651 CTGTCTCCAGCTGGGCACTGGGG + Intergenic
1073053245 10:100683203-100683225 CTGGCTACAGCTGTTAAGTGTGG - Intergenic
1074116807 10:110462355-110462377 TTTTCTGCAGCTGTGCAGTGGGG - Intergenic
1074290831 10:112137051-112137073 CTGGCAGCTGCTATGCAGTGTGG - Intergenic
1076643535 10:131935450-131935472 CTGTGTACAGATCTGCAGAGAGG - Intronic
1078539948 11:12205272-12205294 CTTCCTGCAGCTTTGCAGTGGGG + Intronic
1081608605 11:44544370-44544392 CTGTCTGCAGCTAAGGAGTAAGG - Intergenic
1082702365 11:56448460-56448482 CTGTCTACATTTATTCATTGTGG + Intergenic
1084303411 11:68265898-68265920 CTGCCTACAGCTATGCAGCTGGG - Intronic
1084423891 11:69073870-69073892 ATGTCTACAGCCATGGAGAGAGG - Intronic
1086400830 11:86459928-86459950 CTGGCTCCAGCCATGCTGTGTGG + Intronic
1090628844 11:128628799-128628821 CTGTTTTCTGCCATGCAGTGTGG - Intergenic
1091855984 12:3740621-3740643 ATGTGTACAGCAATGCAGTAAGG - Intronic
1091917562 12:4280752-4280774 CTATCAACAGCTGGGCAGTGGGG - Intronic
1092974497 12:13731174-13731196 GTGCCTACAGCTATGCAGTCTGG - Intronic
1094191610 12:27703855-27703877 CTGTCTGCAGGAATGCTGTGTGG + Intergenic
1095929413 12:47610641-47610663 CTGGCAACAGCTTTGCACTGTGG - Intergenic
1097301541 12:58024424-58024446 CTGTCAAGAGATATGAAGTGGGG + Intergenic
1100623956 12:96309911-96309933 CTGTCAACAGCTTTCCAGAGTGG - Intronic
1101593662 12:106144285-106144307 CTGTTTCCAGCTAGGCAATGCGG - Intergenic
1104191929 12:126490324-126490346 CTGTTTCCAGCTGTGCAGTATGG - Intergenic
1104500533 12:129281635-129281657 CTGAATACAGATAAGCAGTGTGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1108511934 13:51164173-51164195 ATGTCTACTGATATGAAGTGTGG + Intergenic
1109685311 13:65812463-65812485 CTGTCTTCAGCTTGGAAGTGGGG - Intergenic
1110904270 13:80865543-80865565 CTGTTTGCAGCTTTGCAGAGTGG + Intergenic
1111024844 13:82507316-82507338 CCCTCTACAGCTCTACAGTGAGG + Intergenic
1111254925 13:85654033-85654055 CTGTCCACAGAAAAGCAGTGAGG - Intergenic
1118588091 14:67375649-67375671 GTATTTACAGTTATGCAGTGTGG + Intronic
1118623117 14:67632217-67632239 CTGTATACAGGTTTGCAGTTAGG - Intronic
1119738566 14:76999449-76999471 CTGTCTCCAGCGCTGCTGTGAGG - Intergenic
1124911903 15:33929388-33929410 CTGTCTACAGCTATGCAGTGTGG - Intronic
1126670035 15:51107781-51107803 CTGTCAACCTCCATGCAGTGAGG + Intergenic
1129426310 15:75465753-75465775 CAGTCTTCAGATATGCAATGAGG + Exonic
1132392723 15:101450667-101450689 CTGTGTCCAGCTGTCCAGTGAGG + Intronic
1132635941 16:946639-946661 CCGTCTACAGGTATGCTGTTCGG + Intronic
1133286790 16:4694356-4694378 CTGTCTCCAGCAATGGGGTGGGG + Intronic
1135685704 16:24496877-24496899 CTCTCTAGAGTTATGCAGTGCGG + Intergenic
1137378957 16:47980067-47980089 GTGTCTTCAGCTAAGCTGTGTGG - Intergenic
1137540664 16:49359523-49359545 GTCTCTTCAGCTATGCAATGAGG + Intergenic
1138416275 16:56873134-56873156 CTGCCTGCAGCAAGGCAGTGGGG - Intronic
1139145618 16:64321216-64321238 CTGTCAACAACTATTCAGTATGG + Intergenic
1142236874 16:88926619-88926641 CTCCCTGCAGCCATGCAGTGGGG - Intronic
1143724866 17:8837916-8837938 CTGCCTCCCGCTATGAAGTGGGG - Intronic
1146172652 17:30645571-30645593 CTTTCTTCAGCTCTGCATTGGGG + Intergenic
1146346107 17:32061580-32061602 CTTTCTTCAGCTCTGCATTGGGG + Intergenic
1147855758 17:43478550-43478572 ATGTCAACAGCTGGGCAGTGTGG - Intergenic
1150512616 17:65773084-65773106 TTGTCTACGGCTATGCAGCCAGG + Intronic
1150813541 17:68375494-68375516 CTGTCTAGAGCTACACAGTCTGG + Intronic
1151164565 17:72192700-72192722 CTGTCAACAGCTAGAAAGTGAGG - Intergenic
1151901691 17:77020169-77020191 CTGGCTCCCGCAATGCAGTGGGG + Intergenic
1152064602 17:78103744-78103766 CTGTCTACAGCCAAGGAGAGAGG - Intronic
1153971821 18:10234075-10234097 CTCTCTCCTGCCATGCAGTGTGG - Intergenic
1154000216 18:10476294-10476316 CTTTATACAGCTTTGCTGTGAGG + Intronic
1157053662 18:44199006-44199028 CTGTTTGCAGCTGTGCTGTGTGG - Intergenic
1157302820 18:46491814-46491836 TTGTCTTCATCCATGCAGTGGGG - Intronic
1160400627 18:78608422-78608444 CAGTCAAGAGCTAAGCAGTGTGG - Intergenic
1162204197 19:9043560-9043582 CCCTCTACAGCTCAGCAGTGTGG - Intergenic
1162300084 19:9839729-9839751 CTGTCTAAAGCTGTCCAGTTTGG + Intronic
1162989785 19:14294509-14294531 CTTTCTTCAGCTCTGCATTGGGG - Intergenic
1166565935 19:43765536-43765558 GTTTCTACATCTGTGCAGTGGGG + Intergenic
935130474 2:100257536-100257558 GTGTCTCCATCTAGGCAGTGGGG + Intergenic
935423719 2:102897650-102897672 CTGTCTCCAGCTATGCTGTTAGG + Intergenic
936102430 2:109594446-109594468 CTGTCTACTGCTCTGCACTGTGG + Intronic
938201024 2:129373226-129373248 CTGGCCACAGTTATGCACTGTGG - Intergenic
942378660 2:175363864-175363886 CAGTCTCCAGCTGTCCAGTGGGG + Intergenic
948962731 2:241353798-241353820 CTGGTAACAGCTATGCAGGGAGG + Intronic
1173011936 20:39190827-39190849 CTGTCCTCAGCTATGCCCTGGGG - Intergenic
1173310252 20:41890802-41890824 CTGCCTACAGGGATGCTGTGAGG - Intergenic
1173334224 20:42099913-42099935 CTGTCTACAGCTAGAGAGTTTGG - Intronic
1175973093 20:62696945-62696967 CTATGCACAGCTATGCAGTGAGG + Intergenic
1178262246 21:31110683-31110705 CTTTCTGCACCTCTGCAGTGGGG - Intergenic
1179364050 21:40739231-40739253 CTGTCTGCAGCAATGCTGGGGGG + Intronic
1179475144 21:41638346-41638368 TTGTTTTCAGCTGTGCAGTGTGG - Intergenic
1181149853 22:20875462-20875484 CAGTCCACAGGGATGCAGTGGGG + Intronic
1182240396 22:28911414-28911436 CTGCCGACTGCTGTGCAGTGAGG - Intronic
1184543703 22:45150365-45150387 CTGTCTTCACATATGCATTGAGG + Intergenic
1185311994 22:50161358-50161380 CTGTCTACAGCTGTGGCGAGGGG + Exonic
1185409805 22:50675752-50675774 GTGTGTACAGCATTGCAGTGTGG + Intergenic
950014870 3:9748498-9748520 CTGTCTCCGGTTAAGCAGTGGGG - Intergenic
954629680 3:52041073-52041095 CTGGCTGCTGCTATGCAGGGAGG - Intergenic
954750511 3:52810904-52810926 GTTTCCACATCTATGCAGTGGGG + Intergenic
955054231 3:55441924-55441946 CTGTCAACAGCTAGGCAATTGGG - Intergenic
955338215 3:58104496-58104518 CAGTCTACAGCTTTGCCTTGTGG + Intronic
960066456 3:113378851-113378873 TTATCTACAACTATGCTGTGGGG - Intronic
962955844 3:140265940-140265962 CCAGCTACAACTATGCAGTGAGG - Intronic
964976128 3:162622663-162622685 CTGGCAACAGCTATGCGGTGAGG - Intergenic
968161157 3:196428178-196428200 CTGTATACAGCTTCTCAGTGTGG + Intronic
970919901 4:21381794-21381816 CTGTCAACAGCTATTCATTGAGG + Intronic
974694511 4:65348267-65348289 CTGTCTAGATCTTTTCAGTGAGG - Intronic
977194495 4:94042751-94042773 CTGTCTCCATCTAGGCAATGGGG - Intergenic
981013760 4:139952347-139952369 CTGTCCAGAGATATGCAGTGGGG + Intronic
983466725 4:168102379-168102401 CTGACTACAGGCAGGCAGTGTGG - Intronic
984812191 4:183805300-183805322 ATGTCTACAGCTATGCAACAAGG - Intergenic
985533488 5:447841-447863 CCGTCTACAGGTCTACAGTGCGG - Intronic
993382931 5:87228620-87228642 CTGTTTCCACCTCTGCAGTGAGG - Intergenic
997228262 5:132225772-132225794 CTGTCGAAAGCTCTGCATTGGGG - Intronic
1000684430 5:164229237-164229259 CTATGTACAAATATGCAGTGAGG - Intergenic
1006815937 6:36849889-36849911 CTGTCCACAGCTCTTCAGAGAGG + Intergenic
1008574728 6:52849188-52849210 ATCTCTGCACCTATGCAGTGAGG - Intronic
1012866465 6:104624377-104624399 CTGTTTAGTGTTATGCAGTGTGG - Intergenic
1012975682 6:105778802-105778824 GTGTCTTCATCTATGAAGTGGGG + Intergenic
1015598834 6:134892803-134892825 CTGTCAACAGCTTTACATTGAGG + Intergenic
1019074410 6:169376525-169376547 ATTTCTACCGCCATGCAGTGAGG - Intergenic
1024219776 7:47278416-47278438 CTGACTCTAGCTCTGCAGTGAGG + Intronic
1027913391 7:84281767-84281789 ATGTCTACAGCTATAAAATGGGG + Intronic
1029188718 7:98756978-98757000 CTGTCTCCAGCTCTGCAGGCAGG - Intergenic
1032786238 7:135202521-135202543 CAGTTTACAGCTAAGCAATGGGG - Intronic
1034410248 7:150937387-150937409 CAGTCTACAGCTATCCTCTGTGG - Intergenic
1035773428 8:2168691-2168713 CTGCCTGCAGCCATGCACTGGGG - Intergenic
1039044103 8:33434614-33434636 CTGTCTCCAGTTCTACAGTGGGG - Intronic
1040558723 8:48504693-48504715 CTTTCCACAGCAGTGCAGTGTGG - Intergenic
1040896882 8:52377146-52377168 TTGTCTACAGCAATACATTGTGG - Intronic
1047705422 8:127494532-127494554 CTGTGTTCAGCTAGGCAGAGAGG + Intergenic
1047879872 8:129181181-129181203 CTGCCTCCATCTAAGCAGTGTGG - Intergenic
1047941745 8:129833079-129833101 CAGTCTCCAGCTATGGAGTAAGG - Intergenic
1048869001 8:138781851-138781873 CTGTTTCCATCTATACAGTGCGG + Intronic
1051439163 9:17065539-17065561 CTGTTACCAGCTATGCAATGAGG + Intergenic
1051684628 9:19645119-19645141 CTGTCCATACCTTTGCAGTGTGG - Intronic
1052395294 9:27931073-27931095 CTTTCAACAGGAATGCAGTGTGG - Intergenic
1057572231 9:96213439-96213461 ATGCCTACAACAATGCAGTGAGG + Intergenic
1058237832 9:102515079-102515101 CAGACTACAGCTTAGCAGTGTGG + Intergenic
1062560630 9:137140090-137140112 CTGTTTAAAGCTCTGCAGGGCGG - Intronic
1188660269 X:32750619-32750641 CTGTCTTCAGCTTGGAAGTGGGG - Intronic
1189488649 X:41452445-41452467 CTGTCCACAGTCAGGCAGTGTGG + Intronic
1196992190 X:121342329-121342351 CTCTCTACATCTATGCACAGTGG + Intergenic