ID: 1124923594

View in Genome Browser
Species Human (GRCh38)
Location 15:34048938-34048960
Sequence AGGGCTGCTGCAGTTTGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1398
Summary {0: 7, 1: 169, 2: 234, 3: 438, 4: 550}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124923594 Original CRISPR AGGGCTGCTGCAGTTTGCCG TGG (reversed) Intronic
900084625 1:885966-885988 AGGGCTGCTGTGGTTTTCTGGGG + Intergenic
901463593 1:9406343-9406365 AGGGCTGCTGGAGTTGGTGGTGG - Intergenic
902101907 1:13997090-13997112 AGGGCTGCTGCAATTTGCTAGGG - Intergenic
905811348 1:40915688-40915710 TGGGCTGCAGCAGGGTGCCGCGG + Intergenic
905848754 1:41257565-41257587 AGGGCTGCTGCAGTATGGTTGGG + Intergenic
905952716 1:41965143-41965165 AGGGCTGCTGCAGTTTTCTGGGG - Intronic
906586885 1:46985742-46985764 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
906722915 1:48022393-48022415 ATGGCAGCTGCAGTTTGAGGTGG + Intergenic
906903716 1:49865483-49865505 AGGGCTGCTGTGGTTTTCTGAGG - Intronic
906954403 1:50359953-50359975 AGGGCTGCTGCAATTTGCTGGGG - Intergenic
907241146 1:53081779-53081801 AGGGCAGCTGCAGCTTGTGGTGG - Intronic
908215180 1:61943971-61943993 AGGTCTGTTGGAGTTTGCTGGGG - Intronic
908450818 1:64252638-64252660 AGGGCTGCTATGGTTTGCTGGGG - Intronic
908865977 1:68548622-68548644 AGGGTTGCTGTGGTTTGCTGGGG - Intergenic
908930436 1:69311759-69311781 AGGGTTGCTACAGTTTGCTGGGG + Intergenic
909051546 1:70774019-70774041 AGGGCTGCTGCAGTATGCTTGGG + Intergenic
909677915 1:78258027-78258049 AGGGCTGCTGCAGTTTTCTGGGG - Intergenic
909697632 1:78484737-78484759 AGGGCTGCTGTTGTTTGCTGGGG - Intronic
910190451 1:84589550-84589572 AGGTCTGCTGTGGTTTGCTGAGG - Intergenic
910513884 1:88036819-88036841 AGGGCAGCTGCACTGTGCCAGGG - Intergenic
910518232 1:88087976-88087998 AGGGCTGCTGCAGTTTGCTAGGG + Intergenic
910619255 1:89235519-89235541 AGGGCTGATGCAATTTGCTGGGG + Intergenic
910642109 1:89474118-89474140 AGGTCTGCTGTGGTTTGCTGGGG - Intergenic
910821834 1:91358998-91359020 AGAGCTGCCGCAGTTTGCTGGGG - Intronic
910912628 1:92253643-92253665 AGGTCTGCTGCAGTTTGCTGGGG - Intronic
911148974 1:94579385-94579407 TAGGCTGCTGCAGTTTTCTGTGG + Intergenic
911284522 1:95974201-95974223 AGGTCTGCTGCAGTTTGCTGGGG + Intergenic
911464444 1:98233830-98233852 AGGGTTGCTGCGGTTTTCTGGGG - Intergenic
911508636 1:98784596-98784618 AGGGCTGCTGCAGTTTTCTGGGG - Intergenic
911632761 1:100200781-100200803 AGGTCTGCTGGAGTTTGCTGGGG - Intronic
911794610 1:102059525-102059547 AGGACTGCTGCAGTTTGCTAGGG - Intergenic
911836233 1:102622778-102622800 AGTGCTGCTTCAATTTGCCAGGG + Intergenic
911972387 1:104454348-104454370 AGGGCTGCTGTGGTATGCTGGGG + Intergenic
912276426 1:108262770-108262792 AGGTCTGCTGCGGCTTGCTGGGG - Intergenic
912280104 1:108304175-108304197 AGGGCTGCTGCAGTCTCTTGGGG + Intergenic
912288122 1:108390182-108390204 AGGGCTGCTGCAGTCTCTTGGGG - Intronic
912291802 1:108431588-108431610 AGGTCTGCTGCGGCTTGCTGGGG + Intronic
912607667 1:111008600-111008622 AGGGCTGCTGCGATTTGCTGGGG - Intergenic
912893277 1:113557946-113557968 AGGGCTGCTGGAGCGTGCTGGGG - Intronic
912975401 1:114324660-114324682 TGGGCGGCTGAAGTTTGCAGAGG - Intergenic
913036199 1:114968945-114968967 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
913541068 1:119821883-119821905 AGGGCATCTGCAGTTTGCTAAGG + Intergenic
914400702 1:147317187-147317209 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
914404712 1:147358836-147358858 AGGGCTGCTGCGGTTTGCTTGGG - Intergenic
914414632 1:147468663-147468685 AGGGCTGCTGTGGTATGCTGGGG + Intergenic
914470950 1:147978251-147978273 AGGGCTGCTGCCATTTGTTGGGG + Intronic
915637325 1:157195814-157195836 TGGGCTGCTGCAGCTGGCCTGGG - Intergenic
915639701 1:157215369-157215391 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
915792724 1:158692031-158692053 AGGGCTGCTGTATTTGGCCATGG + Intergenic
915990725 1:160512744-160512766 AAGACTGCTGCAGTTTGCTGGGG - Intronic
915995507 1:160558369-160558391 GGGGCTGTTGCAGTTTGCTGAGG - Intronic
916183076 1:162105158-162105180 AGCACTGCTGCAGTTTGCTGGGG + Intronic
916354501 1:163889736-163889758 AGGGCTGCTGCTGGGTGACGTGG + Intergenic
916568946 1:166008397-166008419 AGGGCTGCTGCAGCATGCTGGGG + Intergenic
916848918 1:168683475-168683497 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
917019475 1:170570049-170570071 AGTTCTGCTGGAGTTTGCTGGGG - Intergenic
917024777 1:170630621-170630643 AGGGCTGCTGAAGTTTCTGGGGG + Intergenic
917059240 1:171018275-171018297 AGGGTTGCTGCAGTTTTCTGGGG - Intronic
917060466 1:171032536-171032558 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
917062644 1:171056844-171056866 AGGGCTGCTGCCATTTGCTGGGG - Intronic
917079161 1:171238226-171238248 AGGGTTGCTGCAGTTTGCTGGGG - Intergenic
917269732 1:173259232-173259254 AGGGCTGCTGCAATTTGCTGGGG - Intergenic
917295591 1:173515924-173515946 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
917305309 1:173618021-173618043 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
917352166 1:174089757-174089779 AGGGCTGCTGCGGTTTTCTGGGG + Intergenic
917424682 1:174901937-174901959 AGGACTGCTGTGGTTTGCTGGGG + Intronic
917582273 1:176391323-176391345 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
918156311 1:181849962-181849984 AGGGCTGCTGCAATTCGCTGGGG - Intergenic
918177227 1:182057119-182057141 TGTGCTGCTGGAGTGTGCCGCGG + Exonic
918614703 1:186531432-186531454 AGGGCTGCTGCAGCTTGCTCAGG + Intergenic
918697223 1:187559955-187559977 AGGGCTGCTGTGGATTGCTGGGG + Intergenic
918786462 1:188769715-188769737 AGGTCTGCTGCAGTTTGCTGGGG - Intergenic
918943264 1:191027742-191027764 AGGGCTGCTGTTGTTTACTGGGG - Intergenic
919031710 1:192251409-192251431 AGGGCTGCTACAGTTTGCTAGGG + Intergenic
919220758 1:194625301-194625323 AGGGTTGCTGCAGTTTGCTGGGG - Intergenic
919578008 1:199336537-199336559 AGGGCTACTGCAGTATGCTGGGG + Intergenic
919586534 1:199447407-199447429 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
920786918 1:209050837-209050859 AGGGCTGTTTCAGTATGCTGGGG - Intergenic
921498604 1:215871944-215871966 AGGGCAGCTGCAGAATGCCTGGG + Intronic
921736317 1:218633049-218633071 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
921738190 1:218653036-218653058 AGGTCTGCTGGAGTTTGCTGAGG + Intergenic
921880926 1:220253390-220253412 AGGGTTGCTGCAGTTTACTGGGG - Intronic
921918788 1:220642838-220642860 AGGTCTGCTGCAGTTTTCTGGGG - Intronic
921976432 1:221207772-221207794 AGGTCTGCTGGAGTGTGCTGGGG - Intergenic
922406134 1:225315701-225315723 AGGTCTGCTGGAATTTGCTGGGG + Intronic
922565747 1:226600653-226600675 TGTGCTGCTGCAGTTTCCCAAGG + Exonic
922692014 1:227700503-227700525 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
922693673 1:227714277-227714299 AGGGCTACTGCAGTTTGCTGGGG - Intergenic
922825236 1:228513090-228513112 AGAGCTGCTGCAGCTTCCCTGGG + Intergenic
923195417 1:231662001-231662023 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
923431622 1:233926903-233926925 AGGTCTGTTGGAGTTTGCTGGGG + Intronic
923779819 1:237012131-237012153 TCGGATGCTGCACTTTGCCGGGG + Intergenic
923942506 1:238844005-238844027 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
924412435 1:243819881-243819903 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
924631553 1:245745508-245745530 AAGTCTGCTGGAGTTTGCTGAGG + Intergenic
924779365 1:247132159-247132181 AGGGCTGCCTCAGTTTGCTGGGG - Intronic
924823014 1:247512777-247512799 AGATCTGCTGGAGTTTGCTGGGG + Intronic
924828926 1:247572469-247572491 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
924878319 1:248129486-248129508 AGGTCTGCTATAGTTTGCTGGGG - Intergenic
924883773 1:248189817-248189839 AGGTCTGCTGCAGTTTGCTGGGG - Intergenic
924893941 1:248316219-248316241 AGGTCTGCTACGGTTTGCTGGGG + Intergenic
1064370373 10:14747555-14747577 AGGGTGGCTGCAGTTTGCTGGGG + Intronic
1065515143 10:26517181-26517203 TGGGCATCTGCAGTTTGCCATGG + Intronic
1066042828 10:31568069-31568091 AGGTCTGCTGGAGTTTGCTGAGG + Intergenic
1066257546 10:33695555-33695577 AGGTCTGTTGGAGTTTGCTGGGG + Intergenic
1066700872 10:38126719-38126741 AGGGCTGCTGCATGTTGCTCTGG - Intergenic
1066755136 10:38703844-38703866 AGGTCTGTTGGAGTTTGCTGGGG - Intergenic
1066990817 10:42511563-42511585 AGGGCTGCTGCATGTTGCTCTGG + Intergenic
1067095160 10:43294986-43295008 AGGGTTGCTGCAGTCCTCCGGGG - Intergenic
1067207569 10:44233077-44233099 AGGGCTGTTGAAGTTTGCTGGGG + Intergenic
1067329345 10:45300797-45300819 AGGTCTGCTGAAGTTTGCTGGGG + Intergenic
1068085993 10:52374495-52374517 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1068126779 10:52850880-52850902 AGGGCCACTGCAGTTTGCTGGGG + Intergenic
1068186514 10:53593253-53593275 AGATCTGTTGCAGTTTGCTGGGG + Intergenic
1068410326 10:56646203-56646225 AGATCTGTTGCAGTTTGCTGGGG + Intergenic
1068477619 10:57548481-57548503 AGGGCTGTTGAATTTTGTCGAGG + Intergenic
1068811062 10:61256759-61256781 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1069360283 10:67633617-67633639 TGGGCTGCTGTGGTTTGCTGGGG - Intronic
1069370035 10:67738091-67738113 TGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1069371038 10:67747498-67747520 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1071059165 10:81548989-81549011 AGGGCTGCTGTAGTTTGCTGGGG - Intergenic
1071071388 10:81697771-81697793 ATGGCTGCTGCAGTTTTCTGGGG - Intergenic
1071134468 10:82437811-82437833 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1071763711 10:88637793-88637815 AGGGCTGCTGCGGTTTGCTGGGG + Intergenic
1071815955 10:89232887-89232909 GGAGCTGCTGCAGTTTTCCTGGG + Intronic
1072365250 10:94703000-94703022 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
1072402631 10:95121526-95121548 AAGCCTGCAGCAGTTTGCTGGGG + Intergenic
1072834570 10:98696874-98696896 AGGGCTGCTGCGGTTCACTGGGG - Intronic
1072854741 10:98935553-98935575 AGGTCTGCTGCAGCTTGCTGGGG + Intronic
1073716706 10:106115475-106115497 AAGGCTGCTGCTGTTGGCTGGGG - Intergenic
1073818959 10:107238082-107238104 AGGGATGGTGCAGTTTGGGGAGG - Intergenic
1074003444 10:109394344-109394366 AGGGCTGCTACAGTTTGCTGGGG - Intergenic
1074022093 10:109594461-109594483 AGGGCTGCTGTGGTTCGCTGGGG - Intergenic
1074636235 10:115321155-115321177 AGGACTGCTGTGGTTTGCTGGGG + Intronic
1075172275 10:120127248-120127270 AGGGCTGCTGCAGTTTGCAGGGG + Intergenic
1075230528 10:120672116-120672138 AGGGCTGCTGCGGTTGGCTGTGG - Intergenic
1075282003 10:121147298-121147320 AGGGCTGCTGCTGTTTGCTGTGG + Intergenic
1075899156 10:126024968-126024990 AAGGCTGCTGCAATTTGCTGGGG - Intronic
1075899217 10:126025600-126025622 AAGGCTGCTGCAATTTGCTGGGG - Intronic
1075963459 10:126588569-126588591 AGGGCTGCTGTGGTTTGCTGAGG - Intronic
1076185233 10:128441250-128441272 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1076933095 10:133546813-133546835 AGGGTTGCTGCAGTTTGCTGGGG - Intronic
1077108289 11:851214-851236 AGGGCAGCTGCAGTTGGGGGTGG + Intronic
1077561945 11:3269677-3269699 AAGTCTGCTGGAGTTTGCTGGGG + Intergenic
1077567840 11:3315497-3315519 AAGTCTGCTGGAGTTTGCTGGGG + Intergenic
1077591775 11:3498169-3498191 AGGTCTGTTGGAGTTTGCCTGGG + Intergenic
1077755617 11:5024942-5024964 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1077855167 11:6116466-6116488 AGGGCTGCTGTGGTTTTCCAGGG - Intergenic
1077984780 11:7340909-7340931 AGGGCTGCTGCAGTGTGCTGGGG + Intronic
1078294794 11:10057155-10057177 AGGGCTGCTACAGTATGCTTGGG - Intronic
1078501762 11:11885975-11885997 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1078691343 11:13583194-13583216 AGGGCTGCTGTGGTTTTCTGGGG - Intergenic
1078816110 11:14823759-14823781 AGGGCTGCTGCAGTATGCTGGGG - Intronic
1078834607 11:15015037-15015059 AGGGCTGCTGTGGTTTCCTGGGG - Intronic
1078993073 11:16669444-16669466 AGGGCTGCTGCAGTATGCTGGGG - Intronic
1079276362 11:19040851-19040873 AGGGCTGCTGTGGTTTGCTTGGG - Intergenic
1079426158 11:20343556-20343578 AGGGGTGCTGCAGTTTGCTAGGG - Intergenic
1079481926 11:20890234-20890256 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1079580264 11:22055411-22055433 AGGGCTGCTACAGTTTGCTGGGG + Intergenic
1079587945 11:22149599-22149621 AGGGCTTCTGCAGTTTGCTGGGG + Intergenic
1079696219 11:23484894-23484916 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1079715004 11:23732774-23732796 AGGTCTGCTAGAGTTTGCTGGGG - Intergenic
1079800369 11:24860676-24860698 TAGGCTGCTGCAATTTGCTGGGG - Intronic
1079935155 11:26608200-26608222 AGGGCTGCTGCAGTTGACTGGGG + Intronic
1080130797 11:28792562-28792584 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1080214800 11:29827959-29827981 AGTGCTGCTGCACCTTGCTGGGG - Intergenic
1080292668 11:30688345-30688367 AGGACTGCTGCAGTTTACTGGGG - Intergenic
1080513677 11:33000705-33000727 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1080965530 11:37210375-37210397 AGGTCTGCTTGAGTTTGCTGGGG + Intergenic
1081008839 11:37781928-37781950 AGGGCTGTTGTAATTTGCCAGGG - Intergenic
1081094863 11:38920603-38920625 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1081177530 11:39947053-39947075 AGGGTTGCTGAGGTTTGCTGGGG - Intergenic
1081252242 11:40850402-40850424 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
1081269477 11:41065788-41065810 ACGTCTGCTGCAGTTTGCTGGGG - Intronic
1081317634 11:41650360-41650382 AGGTCTGCTGGAGTTTGCTGAGG + Intergenic
1081454842 11:43211842-43211864 AGGGCTGCTGCAGTTTGCTGAGG + Intergenic
1082076637 11:47980542-47980564 GGGGCTGCTGCAGGGAGCCGCGG - Exonic
1082205501 11:49428927-49428949 ATGGCTGCTGAAGTTTGGAGTGG - Intergenic
1082574122 11:54781890-54781912 CGGGGTGCTGCAGTATGCCAGGG - Intergenic
1082746427 11:56968260-56968282 AAGGCTGCTGCAGTTTGCTGGGG + Intergenic
1082994044 11:59234469-59234491 AGGTCTGCTGCAGTGTGCTGGGG - Intergenic
1084247616 11:67870904-67870926 AGGTCTGTTGGAGTTTGCCTGGG + Intergenic
1084825207 11:71724589-71724611 AGGTCTGTTGGAGTTTGCCTGGG - Intergenic
1085066401 11:73499238-73499260 AGGGCTGCTGCAGTTTGCCGGGG - Intronic
1085335071 11:75687393-75687415 AGGTCTGCAGCAGTTTGCTGGGG + Intergenic
1085880645 11:80463328-80463350 AGGGCTGCTGCTGTATGCTGTGG - Intergenic
1086021734 11:82239154-82239176 AGGGCTGGTGTGGTTTGCTGAGG + Intergenic
1086279851 11:85172346-85172368 AGAGCTGCTGCAGTTTCCTGGGG - Intronic
1086513925 11:87589828-87589850 AGGACTGCTGCAGTTTGCAGGGG - Intergenic
1086610449 11:88748828-88748850 AGGGCTGCTGTGGTTTGCTGGGG - Intronic
1086649597 11:89271592-89271614 ATGGCTGCTGAAGTTTGGAGTGG + Intronic
1086764693 11:90680716-90680738 ATGGCTGCTGAAGTTTGGAGTGG + Intergenic
1086771593 11:90774415-90774437 GGAGCTGCTGCAGTTTGCTGGGG + Intergenic
1086800576 11:91169831-91169853 AGGTCTGCTGCAGTTTGCTGAGG - Intergenic
1087316911 11:96614365-96614387 GGGGCTGCTGCGGTTTGCTGGGG + Intergenic
1087328550 11:96752853-96752875 AGGGCTGCTGCAGTTTGCTGAGG + Intergenic
1087328902 11:96755371-96755393 AGGGCTGCTACGGTTTGCTGGGG + Intergenic
1087406060 11:97732203-97732225 AGGGCTGCTACAGTTGGCTGGGG - Intergenic
1087427874 11:98013246-98013268 AGGTCTGCTGGAGTTTGCTGAGG - Intergenic
1087513592 11:99128840-99128862 AGGTCTGCTGCAGTGTGCTGGGG - Intronic
1087718611 11:101636826-101636848 ATGGATGCTACAGTTTGCTGAGG - Intronic
1087881365 11:103419522-103419544 AAGGCTGCTGTGGTTTGCTGGGG - Intronic
1088004940 11:104927941-104927963 AGGGCTGCTGTGATTTGCTGGGG - Intergenic
1088008421 11:104969802-104969824 AGGTCTGCTGCAGTGTGCTGAGG - Intergenic
1088017926 11:105082359-105082381 AGGTCTGCTGCAATTCGCTGGGG - Intronic
1088037514 11:105334859-105334881 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1088066556 11:105726757-105726779 AGGTCTGCTGGAGATTGCTGGGG - Intronic
1088167520 11:106956544-106956566 AGGACTGCTGCAGTTTGCTAGGG + Intronic
1088383289 11:109220958-109220980 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1088703308 11:112434425-112434447 AGGGCTGCTACAATTTGCTGGGG + Intergenic
1089564892 11:119365515-119365537 AAGGCTGCTGCAGTTTGTCCGGG - Intronic
1089882352 11:121787076-121787098 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1090106237 11:123855515-123855537 AGGGCTGCTGCGGTTTGCTGGGG - Intergenic
1090117015 11:123984396-123984418 AGGGATGCTGCGGTTTGCTGGGG + Intergenic
1090473888 11:127003205-127003227 GTGGCTGCTGAAGATTGCCGTGG - Intronic
1090720509 11:129467916-129467938 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1091805889 12:3355505-3355527 TGGGCTGCTGCTGTGTGCTGGGG - Intergenic
1092289502 12:7150795-7150817 AGGGCTGCTGGACCTTGCAGTGG + Intronic
1092316555 12:7422164-7422186 AGGTCTGCTGCAGTTTGCTTGGG - Intronic
1092417896 12:8306300-8306322 AGGTCTGTTGGAGTTTGCCTGGG + Intergenic
1092443072 12:8526956-8526978 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1092512486 12:9171237-9171259 AGGGCTGCTGAGGTTTGCTGGGG - Intronic
1092566653 12:9673328-9673350 AAGTCTGCTGCAGTTTGCTGGGG + Intronic
1092628499 12:10354220-10354242 AGCGCTGCTGGGGTTTGCTGAGG + Intergenic
1092639884 12:10494118-10494140 AGGGTTGCTGCATTTTGCTGGGG - Intergenic
1093383253 12:18521009-18521031 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1093528722 12:20135760-20135782 AGGGCTGCTGCAGTATGCTGAGG + Intergenic
1093690385 12:22102597-22102619 AGGGCTGCTGCAGTATGCTGGGG + Intronic
1093835504 12:23824385-23824407 AGGTCTGCTGGAATTTGCTGGGG + Intronic
1094054728 12:26257030-26257052 AGGGCTGCTGCAGTTTACTGGGG - Intronic
1094273685 12:28645397-28645419 AAGTCTGCTACAGTTTGCTGGGG + Intergenic
1094275428 12:28669300-28669322 AGGGCTGCTGCAGTTTTCTGGGG - Intergenic
1094425346 12:30310905-30310927 AGGGCTGCTGTGGTTTTCTGGGG - Intergenic
1094694886 12:32808779-32808801 AGGGCTGCTGTGGTTTGTTGGGG + Intronic
1094781974 12:33802121-33802143 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1094811624 12:34143591-34143613 AGGGCTGCTGTGGTTTTCTGGGG - Intergenic
1095303381 12:40613540-40613562 AGGGCTGTTGCACTTTGCTGGGG + Intergenic
1095320291 12:40818943-40818965 AGGGCTGCTGCAGTTTGCCGGGG + Intronic
1095356525 12:41281088-41281110 AGGTCTGCTGGAGTTTGCTGTGG - Intronic
1095595407 12:43952013-43952035 AGGTCTGCTGCAGTTTGCTGGGG - Intronic
1096051669 12:48615205-48615227 AGGGCTTCTGTGGTTTGCTGGGG + Intergenic
1096744364 12:53715792-53715814 AGGGCTGCTGCAGAGTGTGGAGG - Exonic
1097455221 12:59792162-59792184 AGAGCTGCTGCAATTTGCTGGGG + Intergenic
1097455808 12:59796764-59796786 AGGGCTGTTGCAGTTTGCTGGGG - Intergenic
1097498549 12:60373928-60373950 AGGGCTGCTGCGATTTGCTGGGG - Intergenic
1097517057 12:60618627-60618649 AGGTCTGCTGCAGTTTTCTGGGG - Intergenic
1097529433 12:60780424-60780446 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1097583043 12:61481577-61481599 AGGGCTGCTGCGGTTTGTTGGGG - Intergenic
1097598429 12:61663579-61663601 AAGGCTGCTGCATTTTTCTGGGG + Intergenic
1097643019 12:62205086-62205108 TGGGCTGCTGCAGTTTGCTGGGG + Intronic
1097749050 12:63331475-63331497 AGGGCTGATACAGTTTGCTGGGG - Intergenic
1097763253 12:63493395-63493417 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1097910513 12:64965101-64965123 AGGGCTGCTACAGTTTGCTGGGG + Intergenic
1098123656 12:67268643-67268665 CAGGCTGCTGCAGTTTGGCCAGG - Intergenic
1098145192 12:67490293-67490315 AGGACTGCTGCAGTATGCTGGGG - Intergenic
1098201732 12:68063740-68063762 AGGGCTGCCGCAGTTTGCTGGGG + Intergenic
1098667884 12:73186912-73186934 AAGGCTGCTGCAGTTTTCTGGGG + Intergenic
1098694741 12:73538117-73538139 AGGGCTGCTGTGGTTTGCTAGGG - Intergenic
1098764442 12:74468777-74468799 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1098830053 12:75350583-75350605 AGGGCTGCTGTGGTTTCCTGGGG - Intronic
1099010644 12:77287076-77287098 AGGTCTGCTAAAGTTTGCTGGGG - Intergenic
1099502585 12:83432263-83432285 AGGGCTGCTGTGGTTTGCTAGGG + Intergenic
1099667772 12:85653717-85653739 AGGGCTGCTGTGGTATGCTGGGG + Intergenic
1099684215 12:85865465-85865487 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1099793167 12:87362932-87362954 AGGTCTGCTGCAGTTTTCTGGGG + Intergenic
1100099940 12:91091451-91091473 AGGGCTGCTGCAGTTATTTGGGG + Intergenic
1100115198 12:91295106-91295128 AGGGCCACTGCAGTTTGCTGGGG - Intergenic
1100135099 12:91544699-91544721 AGGGCTGCTGTGGTATGCTGGGG - Intergenic
1100411238 12:94321912-94321934 AGGGCTGCTACAGTATGCTGGGG + Intronic
1100740144 12:97582257-97582279 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1101038038 12:100724425-100724447 AGGTCTGATGCAGGTTGCAGAGG + Intronic
1101066632 12:101028056-101028078 AGGGCTGCTGTGGTTTGCTGGGG - Intronic
1101186795 12:102289273-102289295 AGGGCTGCTGCAATTTGCTGGGG + Intergenic
1101206500 12:102493649-102493671 AGGTCTGCTGGAGTTTGCAGGGG + Intergenic
1102591053 12:113957087-113957109 GGGGCTGCTCCAGTTTGCCCGGG + Intronic
1103888314 12:124219713-124219735 AGGGTTGCTGCATTTAGCTGGGG - Intronic
1104054896 12:125221994-125222016 AGGGCTGCTGCAGTCTCCCAAGG + Intronic
1104256294 12:127142602-127142624 AGGGTGGCTGCAATTTGCTGGGG + Intergenic
1105668365 13:22586109-22586131 AGGGCTGCTGCTGTTTTCTGGGG + Intergenic
1106425605 13:29625649-29625671 AGGGCTGCTGTGGTTTACTGGGG - Intergenic
1106621306 13:31373626-31373648 TGGGCTGGTGAAGTTTGCAGTGG - Intergenic
1106621332 13:31373829-31373851 TGGGCTGGTGAAGTTTGCAGTGG - Intergenic
1106958664 13:34973046-34973068 AGGACTGTTGCGGTTTGCTGGGG + Intronic
1107119339 13:36779572-36779594 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
1107240836 13:38231762-38231784 AGGGCTGCTGTGGTTTTCCTGGG - Intergenic
1107243539 13:38265518-38265540 AGGTCTGCTGCAGTTTGGTAGGG - Intergenic
1107289718 13:38839227-38839249 AGTTCTGCTGCAGTTTGCTGTGG + Intronic
1107314709 13:39119229-39119251 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1107673988 13:42776216-42776238 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1108160501 13:47633193-47633215 AGGGCTGCTGCAGTTTCCTGGGG - Intergenic
1108173877 13:47772759-47772781 AGGGCTGCTGCAGTTTCTTGGGG + Intergenic
1108596777 13:51956265-51956287 AGGGCTGGTGCAGCTGGCCCTGG - Intronic
1108673939 13:52720570-52720592 AGGTCTGCTGGAGTTTGCTGAGG + Intronic
1108815546 13:54286571-54286593 AGGGCTGATGCAGTTTGCTGGGG + Intergenic
1109097185 13:58133733-58133755 AGGGCTGTAGCAGTTTGCTGGGG + Intergenic
1109146792 13:58790050-58790072 AGGGCTGCTGTGGTTTCCTGGGG + Intergenic
1109307821 13:60661008-60661030 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1109439444 13:62349964-62349986 AGGGCTGCTGCAGTTCTCTGGGG - Intergenic
1109457399 13:62611017-62611039 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1109731652 13:66420557-66420579 AGGTCTGCTGGAGTTAGCTGGGG - Intronic
1109902706 13:68795142-68795164 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1110020049 13:70458180-70458202 AGGTCTGCTGGAGTTTTCTGGGG - Intergenic
1110567039 13:76967543-76967565 AGGGCTGCCGCAGTTTGCTGGGG + Intergenic
1110788568 13:79561469-79561491 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1110790395 13:79581448-79581470 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1110821742 13:79925479-79925501 AGGACTGCTGCAGTTTGCTGGGG + Intergenic
1111045272 13:82805945-82805967 AGAGCTGCTGCATTTTGCTGGGG - Intergenic
1111092285 13:83462667-83462689 AGGGCTCCTGCAGTTTGCTAGGG - Intergenic
1111200436 13:84928367-84928389 AGGGCTGCTGCGGTTTGCTGGGG - Intergenic
1111235159 13:85400158-85400180 AGGGCTCCTGCAGTTTTCTGAGG + Intergenic
1111305748 13:86410241-86410263 AGGGCTGCTGCAGTTTTCTGGGG - Intergenic
1111332724 13:86781688-86781710 AGAGCTGCTGTGGTTTGCTGGGG + Intergenic
1111348477 13:86994826-86994848 AGGGCTGATGCATTTTTCTGGGG - Intergenic
1111635168 13:90893520-90893542 AGGTCTGCTGGAGTTTGCTAGGG - Intergenic
1111641722 13:90977939-90977961 AGGGCTGCTGCGGTTTCCTGAGG - Intergenic
1112076247 13:95916286-95916308 AGGGCTGCTGCAGTTTGCTGAGG - Intronic
1112913742 13:104521977-104521999 AGGTCTGCTGCAGTTTGCTGGGG + Intergenic
1113527807 13:110994443-110994465 AGGGATGTTGCAGTTTGCTGAGG - Intergenic
1114285062 14:21233638-21233660 AGGGCTCCTCCAGTCTGCTGTGG + Intronic
1114706068 14:24727391-24727413 AGGGCTGCTACAATTTCCTGGGG - Intergenic
1114817768 14:25980037-25980059 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1114949871 14:27736625-27736647 AGGTCTGCTGTAGTTTTCTGTGG + Intergenic
1114958277 14:27849835-27849857 AGGGCTGCCGCAGTTTGTTGGGG - Intergenic
1115048604 14:29028647-29028669 AGGTGTGCTGGAGTTTGCTGGGG + Intergenic
1115385306 14:32789612-32789634 AGGGCTGCTGCGGTTTGCTGGGG - Intronic
1115533681 14:34352682-34352704 AGGGCTGCTGCACATTGCAGGGG + Intronic
1115912058 14:38268220-38268242 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1115928733 14:38467253-38467275 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1115974304 14:38980457-38980479 AGATCTGCTGTAGTTTGCTGGGG + Intergenic
1116317518 14:43417213-43417235 AGGGTTGTTGCAGTTTGCTGGGG + Intergenic
1116320446 14:43455005-43455027 AAGGCTGCTGCATTTTCCTGGGG - Intergenic
1116428713 14:44820985-44821007 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1116685602 14:48035372-48035394 AAGGCTGCTGTGGTTTGCTGGGG + Intergenic
1116765256 14:49062631-49062653 AGGTCTGCTGGAGTTTGCTGTGG - Intergenic
1116932282 14:50702433-50702455 AGGGCAGCTGTACTGTGCCGGGG + Intergenic
1116977509 14:51132038-51132060 AGGGCTGCTGCTGTGTGCTAGGG - Intergenic
1117014401 14:51504183-51504205 AGGGCTGCTGTGGTTTGCTGGGG + Intronic
1117452614 14:55865696-55865718 AGGGCAGCTGCACTGTGCCGGGG + Intergenic
1117503022 14:56373564-56373586 AGGGCTGTTGTGGTTTGCTGTGG + Intergenic
1117641145 14:57800246-57800268 GGGACTGCTGCAGGTTGCTGGGG - Intronic
1117751147 14:58924642-58924664 AGGAATGCTGCAGTTTGCTGGGG - Intergenic
1117829349 14:59734121-59734143 AGGGCTGCTGCAGTTTTTTGGGG - Intronic
1117857468 14:60050831-60050853 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1118523611 14:66616476-66616498 AGGGCCACTGCAATTTGCTGGGG + Intronic
1118530781 14:66702528-66702550 ATGGCTGCTGTGGTTTGCTGGGG - Intronic
1118871520 14:69746941-69746963 AGGGCTGCTGCACATAGCAGGGG + Intronic
1119545750 14:75470048-75470070 AGCCCTGCTGGAGTTTGCTGTGG + Exonic
1120058567 14:79954436-79954458 AGTGCTGCTGCTGTTTGCTGGGG - Intergenic
1120283177 14:82464369-82464391 AGGGTTGCTGCAGTTTGCTGGGG - Intergenic
1120368903 14:83607401-83607423 AGGGCTGCTGCGGTTTGCTGGGG + Intergenic
1120637980 14:86974730-86974752 AAGGCTGCTGCAGTTTGCTGGGG - Intergenic
1121142508 14:91555532-91555554 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1121203087 14:92136757-92136779 AGCCATGCTGCAGTTTGCCACGG - Intronic
1121706899 14:96002834-96002856 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
1122402722 14:101476749-101476771 AGGGCTGCTGCAGATGGGCAGGG - Intergenic
1122567244 14:102668536-102668558 AGGGCTTCAGCAGATAGCCGAGG - Intronic
1122627957 14:103093910-103093932 GGGGCTGCTGCAGGGTGCTGAGG - Intergenic
1123576531 15:21675764-21675786 AGGTCTGCTGGAGTTTGCTGCGG + Intergenic
1123613155 15:22118232-22118254 AGGTCTGCTGGAGTTTGCTGCGG + Intergenic
1123884996 15:24718116-24718138 GGGTCTGCTGCAGTTTGCTGGGG + Intergenic
1124602788 15:31148936-31148958 AGGGCATCTGCAGGTTGCCCAGG - Intronic
1124923594 15:34048938-34048960 AGGGCTGCTGCAGTTTGCCGTGG - Intronic
1125054483 15:35341620-35341642 AGAGCTGCTGTGGTTTGCTGGGG + Intronic
1125216559 15:37282548-37282570 AGGGCTGCTGTGATTTGCTGGGG + Intergenic
1125373283 15:39000667-39000689 AGGGCTGCTGTGGTTTGCTTGGG - Intergenic
1126219520 15:46196909-46196931 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1126284491 15:46996066-46996088 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1126552898 15:49952971-49952993 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1126784305 15:52163966-52163988 AGGGCTGCTGCGGTTTGCTGGGG - Intronic
1126956337 15:53936759-53936781 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1127042454 15:54991461-54991483 AGGGCTGCTGCAGTTTTCTGGGG - Intergenic
1127099945 15:55553910-55553932 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1127799954 15:62469501-62469523 AGGAATGCTGGAGTTTGCAGAGG + Intronic
1127931655 15:63601015-63601037 AGCGCTGCAGCAGCTTGCCGAGG - Intronic
1128146355 15:65334422-65334444 AGGGCTGCTGAAGGGTGCTGGGG + Intronic
1128852418 15:70973247-70973269 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
1129145113 15:73640001-73640023 AGATATGCTGCAGTTTGCCATGG - Intergenic
1129178036 15:73854221-73854243 AGGGCTTCTCCAGCTTGCCTGGG - Intergenic
1129566916 15:76633181-76633203 AGGGCTGCTGCCATTTGCTGGGG + Intronic
1129631062 15:77261026-77261048 AGGTCTGTTGGAGTTTGCTGGGG - Intronic
1129946676 15:79544266-79544288 GGGGCTGCTGCTTTTTCCCGTGG - Intergenic
1129971495 15:79781235-79781257 AGGGCTCCTCCAGTTTGCTGGGG - Intergenic
1130030299 15:80308009-80308031 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1131942660 15:97584719-97584741 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1202985399 15_KI270727v1_random:410009-410031 AGGTCTGCTGGAGTTTGCTGCGG + Intergenic
1133223586 16:4329421-4329443 AGGGCAGCTGCACTAGGCCGTGG - Intronic
1133261519 16:4553966-4553988 AGGGCTCCTGCTGTGTGGCGCGG + Intergenic
1133783844 16:8960273-8960295 GGGCCTGATGCAGTTTGCTGGGG - Intronic
1134646771 16:15874896-15874918 AGGGCTGCTGAAGTGTCCTGAGG - Intronic
1136662194 16:31772510-31772532 AGGGCTGCTGTGGTTTGCTGGGG - Intronic
1137680955 16:50344162-50344184 AGGTCTGTTGGAGTTTGCTGGGG - Intronic
1138799831 16:60013660-60013682 AGGTCTGCTGCAGTTTGCTGGGG - Intergenic
1138843549 16:60538542-60538564 AGGTCTCCTGAAGTTTGCTGGGG + Intergenic
1139169600 16:64615101-64615123 AGAGCTGCTGCAGTTTGCTGGGG + Intergenic
1139618092 16:68113351-68113373 AGGGCTGCTGCAGTTTACTAGGG + Intronic
1140054069 16:71510420-71510442 AGGTCTGTTGGAGTTTGCTGGGG + Intronic
1140182603 16:72735824-72735846 AGGGCTGCTGCCATTTGCCTAGG + Intergenic
1140669988 16:77268987-77269009 AGAGCTCCTGCAGTTTGCTGGGG + Intronic
1141698286 16:85630990-85631012 AGAGCTGCTGCAGTATCCCCTGG + Intronic
1142355520 16:89599787-89599809 AGGGCTGCTGCCTTCTGCCATGG - Intergenic
1143287037 17:5797895-5797917 AGAGATGCTGCAGTTTCACGTGG - Intronic
1144120920 17:12151362-12151384 AGGACTGCTGCAGTTTGCTGGGG - Intergenic
1144371866 17:14598632-14598654 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1144616797 17:16783561-16783583 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1144778210 17:17795417-17795439 TGGGCTGCTGCAGTGCCCCGAGG + Exonic
1144895897 17:18532112-18532134 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1145104457 17:20103674-20103696 AGGGCTGCTGCAGTCTCCCTAGG + Intronic
1145136319 17:20412120-20412142 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1149174546 17:53853615-53853637 AGGGCCGCTACAGTTTGCTGGGG - Intergenic
1149229604 17:54518419-54518441 AGGGCTGCTCCAGTATGCTGGGG + Intergenic
1149377845 17:56064005-56064027 AGGGCTGCTGCAGTTTGTTGGGG + Intergenic
1150190378 17:63232513-63232535 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1150196409 17:63304342-63304364 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1150805309 17:68314134-68314156 GGGGATGATGCAGTTTGCCCGGG - Intronic
1150884712 17:69071466-69071488 AGGTCTACTGGAGTTTGCTGGGG - Intergenic
1151141732 17:71999703-71999725 AGGGTTGCACCAGTTTACCGGGG + Intergenic
1152445281 17:80339199-80339221 AGGTCTTCTGCAGTGTGCAGAGG + Exonic
1152568561 17:81111289-81111311 CGGGCTGCAGCTGCTTGCCGGGG - Intronic
1152702400 17:81825521-81825543 AGGGCTGCAGCCGTGTGCCCTGG - Exonic
1152907835 17:82978842-82978864 GGGGCTGCTGCTGATTGCTGGGG - Intronic
1153081483 18:1231460-1231482 AGGTCTGCTGCAGTTTTCTGGGG + Intergenic
1153125436 18:1784925-1784947 AGGGTTTCTGCAGTTTGCTGGGG - Intergenic
1153785342 18:8529177-8529199 AGGGCTGCTGCAGTATGCTTGGG - Intergenic
1153858328 18:9173468-9173490 AGGGCTGCTGTAGTTTGCTGGGG + Intronic
1154181395 18:12142653-12142675 AGGGCTGCTGCAGTATGCTGAGG + Intergenic
1154181686 18:12144332-12144354 AGGGCTGCTGCAGTATGCTGGGG + Intergenic
1154182218 18:12147252-12147274 AGGGCTGCTGCAGTATGCTGGGG - Intergenic
1154182509 18:12148931-12148953 AGGGCTGCTGCAGTATGCTGAGG - Intergenic
1155091286 18:22514476-22514498 AGGGCTGTTGTGGTTTGCTGGGG + Intergenic
1155117402 18:22783512-22783534 AAGGCTTCTGCAGTTTGCTGGGG + Intergenic
1155429932 18:25744322-25744344 AGGGTTGCTGCGGTTTGCTGGGG - Intergenic
1155464707 18:26121344-26121366 AGGGCTGCTGCAATTTACTGGGG - Intergenic
1155577045 18:27259422-27259444 AGGGCTGCTGCAGTATACAGGGG + Intergenic
1155763002 18:29589409-29589431 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1155847901 18:30731808-30731830 AGGGCTGCTGCTGTTTGCTGGGG - Intergenic
1156058775 18:33046790-33046812 AGGGCTGCTGTAGTTTGCTAGGG - Intronic
1156139116 18:34083923-34083945 AGGGCTACTGCGGTTTGTTGGGG + Intronic
1156241934 18:35263174-35263196 AAGGCTGCTGCAGTGAGCTGTGG + Intronic
1156511186 18:37638131-37638153 AGGGCTGCAGCAGGTGGCTGGGG - Intergenic
1156664676 18:39390656-39390678 AGAGCTGCTGCAGTTTGCTGGGG - Intergenic
1156694918 18:39754236-39754258 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1157123344 18:44933190-44933212 AGGTCTGTTGGAGTTTGCTGAGG + Intronic
1158105549 18:53882073-53882095 AGGGCTACTGCAGTTTGCTGGGG + Intergenic
1158297585 18:56015822-56015844 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1158398939 18:57103722-57103744 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1158571379 18:58599363-58599385 AGGGCTGAGGCAGGTTCCCGTGG - Intronic
1158729068 18:60003258-60003280 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1159076750 18:63688918-63688940 AGGTCTGCTGCAGTTTGCTGGGG - Intronic
1159387365 18:67742895-67742917 ATGTCTGCTACAGTTTGCTGGGG - Intergenic
1160388906 18:78515496-78515518 AGGGCTGTGGCAGGTTTCCGAGG - Intergenic
1161495319 19:4583293-4583315 AGGGAGCCTGCAGATTGCCGTGG - Intergenic
1161977930 19:7616390-7616412 AGGGGTGCTGCAGAGGGCCGAGG + Intronic
1162182603 19:8880311-8880333 AGGGCTGCTGCAGTTTGCTAGGG - Intronic
1163872265 19:19831569-19831591 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1163886037 19:19965846-19965868 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1163888431 19:19989631-19989653 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1163908086 19:20164997-20165019 AGCGCTGCTGCAGTTTGCTAGGG - Intergenic
1163935459 19:20438642-20438664 AGGGTTGCTGCAGTTTGCTAGGG + Intergenic
1163949565 19:20571424-20571446 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1163958272 19:20664106-20664128 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1163968510 19:20770474-20770496 AGGGCTTCTGCAGTTTGAGGGGG - Intronic
1164133113 19:22384215-22384237 AGGTCTGTTGGAGTTTGCCTGGG + Intergenic
1164165702 19:22672526-22672548 AGGTCTGTTGGAGTTTGCCTGGG - Intergenic
1164265214 19:23609823-23609845 AGGTCTGCTGCAGTTTGCTGGGG + Intronic
1164526659 19:29018002-29018024 GGGGCTGCTGAAGTTTGCCAAGG + Intergenic
1164599850 19:29553332-29553354 AGGGCTTCTGTGGTTTGCTGGGG - Intronic
1166408474 19:42540475-42540497 AGGGCTGCTGCGGGTTGGTGGGG + Intronic
1166588273 19:43970149-43970171 AGGGCTGCCACAGTTTGCTGGGG - Intronic
1166899162 19:46044857-46044879 AGGGCTGCTGTGGTGTGCTGGGG - Intronic
1166904825 19:46100979-46101001 AGGACTGCTGCAGTTTGCTGAGG + Intergenic
1167113696 19:47476561-47476583 TGGGCTGCAGGAGCTTGCCGTGG - Exonic
1167974005 19:53209565-53209587 ACGTCTGCTGGAGTTTGCTGGGG + Intergenic
1168174015 19:54609621-54609643 GCGGCTGCTGCTGTTTGCGGTGG - Intronic
925442220 2:3898733-3898755 AGGGCTGCTGTTGTTTGCTGGGG + Intergenic
925447398 2:3940147-3940169 AGGGCTGCTGCAGTTTGCTGAGG + Intergenic
925792864 2:7510606-7510628 GTGGCTCCTGCAGTGTGCCGTGG + Intergenic
926453944 2:13040840-13040862 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
926475260 2:13314229-13314251 AGGTCTGCTGCAGTTTGCTAGGG + Intergenic
926987347 2:18639316-18639338 AGGGCAGCTGTGGTTTGCTGGGG + Intergenic
927390574 2:22590162-22590184 AAGACTGCTGCAGTTTGCTGGGG - Intergenic
928803804 2:35126064-35126086 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
928900103 2:36308461-36308483 AGGGCTGCTGCGGTTTGCTGGGG - Intergenic
929033437 2:37670384-37670406 TGGGCTGCTGCTGTGTGCTGAGG - Intronic
929280404 2:40072171-40072193 AGGGCTGTTGCGATTTGCTGGGG + Intergenic
929286611 2:40142056-40142078 AGGGCTGCTGTAGTTTGCTAGGG - Intronic
929333430 2:40712191-40712213 AAGTCTGCTGGAGTTTGCTGGGG + Intergenic
929371005 2:41223503-41223525 AGGGCTATTGCAGTTTTCTGGGG - Intergenic
929401156 2:41582878-41582900 AGGGCTGCTGTGGTTTGCCGGGG - Intergenic
929405626 2:41637747-41637769 AGGGCTGCTGCAGTTTGATGGGG - Intergenic
929788632 2:45008852-45008874 ACAGCTGCTGCAGCTTGGCGTGG + Exonic
929838113 2:45426725-45426747 AGGTCTTCTGGAGTTTGCTGGGG - Intronic
930281031 2:49369933-49369955 GAGGCAGCTGCAGTTTGCCATGG + Intergenic
930304994 2:49666221-49666243 AGGGTTGCTGCAGTATGTTGGGG + Intergenic
930359427 2:50358957-50358979 AGTTCTGCTGGAGTTTGCTGGGG - Intronic
930424232 2:51193512-51193534 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
930523069 2:52492346-52492368 AGGACTGCTGCAGTTTGCTGGGG + Intergenic
930545870 2:52766378-52766400 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
930552371 2:52852131-52852153 AGGGCTGCTGCACTTTGCTGGGG + Intergenic
930581390 2:53216714-53216736 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
930586071 2:53268214-53268236 AGGGCTACTGTGGTTTGCTGGGG - Intergenic
930835893 2:55793351-55793373 AGGTCTGTTGGAGTTTGCTGAGG + Intergenic
930838008 2:55814907-55814929 AGGTCTGTTGGAGTTTGCTGAGG - Intergenic
930860254 2:56064819-56064841 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
930951437 2:57147468-57147490 CAGGCTGCTGCAGTTTGCTGGGG - Intergenic
931074058 2:58689365-58689387 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
931538760 2:63305428-63305450 AGGTCTGCTGGAGTTTGCCTGGG - Intronic
931543358 2:63353852-63353874 AGGGCTGCTGCAGTATTCTGGGG - Intronic
931560528 2:63555729-63555751 AGGGCTGCTGCAGCTTGCTGGGG - Intronic
932379693 2:71270586-71270608 AGGGCTGCTGTGGTTTACTGGGG - Intergenic
932523558 2:72439927-72439949 ATGGCTGCTGTGGTTTGCTGGGG + Intronic
932646678 2:73510480-73510502 AGGTCTGCTGGAGTTTACTGGGG + Intronic
932701868 2:73997642-73997664 GGTGCTGCTTCAGTTTCCCGAGG + Intronic
932826846 2:74948592-74948614 AGGGCTGCTGCAGTTTGCCGAGG - Intergenic
932913978 2:75834863-75834885 AGGTCTGCTGGAGTTTGCGGGGG - Intergenic
933052162 2:77612841-77612863 ATGGCTGCTGTGGTTTGCTGAGG - Intergenic
933129594 2:78655696-78655718 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
933436445 2:82256545-82256567 AGGGTGGCTGCAGTTTGCTGGGG + Intergenic
933482669 2:82876486-82876508 AGGGTTGCTGCAGTTTGCTGTGG - Intergenic
933602431 2:84347307-84347329 AGGGCTGCTGCAGTTTTCTGGGG + Intergenic
933603908 2:84361076-84361098 AGCGCTGCTGTAGTATGCTGGGG - Intergenic
933880773 2:86667627-86667649 AAGGCTGTTGAATTTTGCCGAGG - Intronic
934479017 2:94618209-94618231 AGGGCTGCCGCAGTTTGCTGGGG + Intergenic
934548774 2:95241375-95241397 AGGGCTGCTGCGGTTTGCTGGGG - Intronic
934622770 2:95825697-95825719 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
934623248 2:95829218-95829240 AGGGCTGCTGCAGTATGCCCAGG + Intergenic
934810518 2:97272874-97272896 AGGGCTGCTGCAGTATGCCCAGG - Intergenic
934811008 2:97276406-97276428 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
934826684 2:97431533-97431555 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
934827174 2:97435065-97435087 AGGGCTGCTGCAGTATGCCCAGG + Intergenic
934923577 2:98366155-98366177 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
935440874 2:103094301-103094323 AGGGCTGTTGCAGTATGCTGGGG + Intergenic
935489319 2:103697851-103697873 AGGTCTGCTGCAGTTTGCATGGG + Intergenic
935490775 2:103717229-103717251 AAGGCTGCTACAGTATGCTGAGG - Intergenic
936750334 2:115634471-115634493 AGGCGTGCTGCAGTTTGCTTGGG + Intronic
936848988 2:116873475-116873497 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
937200877 2:120203914-120203936 GGGGCTGCTGCAGTTGGTCCAGG + Intergenic
937214313 2:120301578-120301600 AGGGCTGCGGCATTCTGCAGGGG + Intergenic
937397154 2:121547080-121547102 AGGGCTGCTGCAATATGTTGGGG - Intronic
937569012 2:123333875-123333897 AGGGCTGCTGCAGTATGCTGGGG - Intergenic
937679412 2:124627448-124627470 AGGTCTGCTGTGGTTTGCTGGGG - Intronic
937893856 2:126962871-126962893 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
937931608 2:127209235-127209257 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
938136723 2:128765389-128765411 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
938282210 2:130072400-130072422 AGGGCTGCTGTGGTATGCTGGGG + Intergenic
938332836 2:130460972-130460994 AGGGCTGCTGTGGTATGCTGGGG + Exonic
938356971 2:130659699-130659721 AGGGCTGCTGTGGTATGCTGGGG - Intergenic
938433407 2:131266505-131266527 AGGGCTGCTGTGGTATGCTGGGG - Intronic
938477449 2:131629090-131629112 AGGGCTGCTGTGGTATGCTGGGG - Intergenic
939022856 2:136980025-136980047 AGGGCTGCTGTGCTTTGCTGGGG + Intronic
939109811 2:137992918-137992940 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
939180048 2:138794128-138794150 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
939391228 2:141571290-141571312 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
939809070 2:146808747-146808769 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
939860538 2:147415190-147415212 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
940030450 2:149256913-149256935 AGGTCTGCTGGAGTTTTCTGGGG + Intergenic
940124693 2:150310415-150310437 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
940273283 2:151914741-151914763 AGGGCTGCTGCAGTTTGCGGGGG + Intronic
940410837 2:153361107-153361129 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
940565049 2:155350787-155350809 AGGTCTGCTGCAGTTTGCTGGGG + Intergenic
940615081 2:156039225-156039247 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
941136313 2:161722448-161722470 AGGGCTGCTGTGGTTTGCTGGGG + Intronic
941565266 2:167098810-167098832 AGATCTGCTGGAGTTTGCTGTGG + Intronic
941694268 2:168534488-168534510 AGGGCTGCTGCAGTTCCCTGGGG + Intronic
942469556 2:176245446-176245468 AGGGCTGCAGTAGCTTGCTGGGG + Intergenic
942753649 2:179315380-179315402 AGGTCTGTTGGAGTTTGCTGGGG - Intergenic
942898858 2:181090092-181090114 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
942989388 2:182181357-182181379 AGGTCTGCTGCAGTTTGATGGGG + Intronic
943001393 2:182332610-182332632 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
943200475 2:184817284-184817306 AGGGCTGCTGTAGTTTGCTGGGG - Intronic
943286648 2:186009637-186009659 AGGGCTGCTGAAGTTTGCTGGGG - Intergenic
943514146 2:188863146-188863168 AGAGCTGCTGCAGTTTGCTGGGG - Intergenic
944035601 2:195290897-195290919 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
944167854 2:196742526-196742548 AGGGCTGCTGTGGTTTGCTGGGG + Intronic
944292139 2:198019106-198019128 AGGTCTGCTGGAGTTTGCTGGGG - Intronic
944385210 2:199155687-199155709 AGGGCTGCTGCCATTTGCTGGGG - Intergenic
945164414 2:206927274-206927296 AGGTCTGCTGCAGTTTGCGGGGG - Intergenic
945210783 2:207380455-207380477 AGGTCTGCTGCAGTTTTCTGGGG + Intergenic
945439644 2:209864110-209864132 AGAGCTGCTGCAGTTTGCTGGGG + Intronic
945524095 2:210866561-210866583 AGAGCTGCTATAGTTTGCTGAGG - Intergenic
946065218 2:216981969-216981991 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
946546509 2:220749740-220749762 AGGGCTCCTGCAGTTTTCCAGGG - Intergenic
947098234 2:226591311-226591333 AGGACTGCTGCAGTTTGTTGGGG + Intergenic
948327235 2:237134591-237134613 AGGGGTGCTGCAGATTACTGTGG - Intergenic
1168933426 20:1643830-1643852 AAGGCTGCTGCAGTTTGTTGGGG + Intronic
1169695669 20:8384789-8384811 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1169980694 20:11380398-11380420 AGGGCTGCTGTAGTTTACTGGGG - Intergenic
1170730081 20:18966305-18966327 AGGGCTGCTGTGGTTTGCTGAGG - Intergenic
1173091221 20:39974387-39974409 AGGGCTGCTGTTGTTCGCTGGGG + Intergenic
1173149473 20:40553636-40553658 AGGGCTGCTGCAGTTTACAGGGG - Intergenic
1173411867 20:42818253-42818275 AGGGCTTCTGCAGTTTGCTGGGG - Intronic
1174953242 20:55066708-55066730 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1174992044 20:55522288-55522310 AGGGCTGCCGCAGTTCGCTGTGG + Intergenic
1175217305 20:57398383-57398405 AGGCCAGCTGCAGGTCGCCGTGG + Intronic
1175217882 20:57401012-57401034 AGGGCTGCTCCTGTTTGGCCAGG - Intronic
1175591834 20:60199848-60199870 AGGGTTGCTGCAGTTTTCTCAGG + Intergenic
1176165103 20:63668654-63668676 AGAGCTGGTGAGGTTTGCCGTGG + Intronic
1176523041 21:7838967-7838989 AGGGCTGCTGTGGTTTGCTCAGG - Intergenic
1176977093 21:15334711-15334733 AGGGTTGCTGCAGTATGTTGGGG + Intergenic
1177099267 21:16879691-16879713 AGGGCTTCTGTGGTTTGCTGGGG - Intergenic
1177117758 21:17105829-17105851 AGGGCTGCTGAAGCTTGCTTGGG - Intergenic
1177184088 21:17775007-17775029 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1177332781 21:19683656-19683678 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1177388209 21:20433834-20433856 AGGGCTGCTGCAGTTTGCCGGGG - Intergenic
1177511272 21:22091292-22091314 AGGGCCGCTGGGGTTTGCTGGGG + Intergenic
1177878834 21:26668844-26668866 AGGGCTGTTGTAGTTTGCTAGGG + Intergenic
1177912638 21:27051539-27051561 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1177956485 21:27605655-27605677 AGGGCTGCTGCAGTTTGCAGGGG + Intergenic
1178033572 21:28555593-28555615 AAGTCTGCTGCGGTTTGCTGGGG - Intergenic
1178657061 21:34468979-34469001 AGGGCTGCTGTGGTTTGCTCAGG - Intergenic
1180250270 21:46581698-46581720 AGGGTTGCTGCAGTTTGCTGGGG + Intergenic
1182195025 22:28506797-28506819 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1182938842 22:34254707-34254729 AGGGCTGCCGCAGTTTGCTGGGG + Intergenic
1184671633 22:46014902-46014924 GGGGCTGCTGCAGGTGGCTGGGG - Intergenic
1184809618 22:46822505-46822527 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
949119827 3:372865-372887 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
949466005 3:4344412-4344434 AGGGATGCTGCAATTTGGTGGGG - Intronic
949592806 3:5511085-5511107 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
950279455 3:11694031-11694053 AGGGCTTCTGTAGTTTGCCCAGG - Intronic
951137345 3:19118801-19118823 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
951168285 3:19507737-19507759 AGGGCAGCTGCATTGTGCTGGGG + Intronic
951197031 3:19836016-19836038 AGGGCTGCTGTGGTATGCCTGGG - Intergenic
951432768 3:22627766-22627788 AGGGCTGCTGCTCTTTGCTGGGG + Intergenic
951469856 3:23044435-23044457 GGGGCTGCTGTGGTTTGCTGGGG - Intergenic
951676341 3:25246586-25246608 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
951687499 3:25361747-25361769 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
951741788 3:25932360-25932382 AGGTCTGCTGGAGTTTGCCAGGG - Intergenic
951996491 3:28736026-28736048 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
952216911 3:31287365-31287387 AGGCCTGCTGCAGTGTGTGGGGG + Intergenic
952424009 3:33156526-33156548 AGGGCTGCTGCTGTCTTCTGAGG - Intronic
952503684 3:33988722-33988744 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
953053025 3:39362738-39362760 AGGGCTGCTGTGGTTTTCTGGGG - Intergenic
953074156 3:39552071-39552093 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
953115543 3:39989292-39989314 AGGGCTGCTGTGGTTTGCTGGGG + Intronic
953654431 3:44838352-44838374 GGGGCTGCTGCAGTCTGCCCAGG + Exonic
953845846 3:46425631-46425653 AGGGCTGCTACAGTGTGCTCTGG - Intergenic
954498623 3:50988752-50988774 AGGGCTGCTGTGGTATGCCTGGG - Intronic
954529148 3:51303671-51303693 AGGGCTGCTCTGGTTTGCCGAGG + Intronic
955119022 3:56036919-56036941 AGGGCTGCTATGGTTTGCTGTGG - Intronic
955435894 3:58898942-58898964 AGGGCTGCTGTGGTTTTCTGAGG + Intronic
955447907 3:59033072-59033094 AGGTCTGCTGGAGTTTGCAGTGG - Intronic
955681294 3:61504946-61504968 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
956005918 3:64777664-64777686 AGGGCTGCTGGAGTTTGCTGGGG - Intergenic
956157815 3:66317367-66317389 AGGACTACTGCAGTGTGCTGGGG + Intronic
956477324 3:69636608-69636630 AGGTCTGTTGGAGTTTGCTGGGG + Intergenic
956610380 3:71116375-71116397 AGGTCGGCTGCAGTTTCCCTTGG - Intronic
957268791 3:78002803-78002825 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
957394835 3:79623051-79623073 AGGGCTGCTGCAGATTCCTGGGG - Intronic
957434032 3:80151562-80151584 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
957584239 3:82114139-82114161 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
957696716 3:83649419-83649441 AAGCCTGCTGCAGTTTGCTGGGG + Intergenic
957747583 3:84365530-84365552 AGGTCTGCTGGAGTTTGCTGTGG + Intergenic
958073148 3:88640647-88640669 AGGGCTGCTGGAGTTTGCAGGGG + Intergenic
958076801 3:88690817-88690839 AGGGCTGTTGTGGTTTGCTGGGG - Intergenic
958106131 3:89075868-89075890 AGGGCTGGTGAATTTTGTCGAGG - Intergenic
958148446 3:89657953-89657975 AGGGCTGCTGCAGTAACCTGGGG + Intergenic
958257370 3:91340663-91340685 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
958483730 3:94676919-94676941 AGGGCTGCTGAGGTTTGCTTGGG - Intergenic
958503656 3:94946161-94946183 AGGGCTGCTACAGTTTGTTAGGG + Intergenic
958650401 3:96930455-96930477 AGGGCTGCTGCAGGTTGCTGTGG + Intronic
958656391 3:97008890-97008912 AGGGCTACTGCAGTTTGTTGGGG + Intronic
958817249 3:98929220-98929242 AGGTCTGCTGAAGTTTGCTGGGG - Intergenic
959014801 3:101121537-101121559 GGGGCTGCTGTAGTTTGGTGGGG + Intergenic
959030992 3:101299661-101299683 AGGGCTGCTGCAGTTTGCTAGGG + Intronic
959258806 3:104048803-104048825 AGGGCTGCTGAAGTTTGCTGGGG - Intergenic
959418267 3:106103818-106103840 AGGGCTACCACAGTTTGCTGAGG + Intergenic
959428585 3:106223656-106223678 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
959452131 3:106517291-106517313 AGGGCTGCTGCAGCATGCTGGGG - Intergenic
959452809 3:106523744-106523766 AGGGCTGCTGCAGTTTTCTGGGG - Intergenic
959848182 3:111057535-111057557 AGTTCTGCTGGAGTTTGCTGGGG - Intergenic
959997561 3:112695591-112695613 AGAGCTGGTGCAGCTGGCCGTGG - Intergenic
960233552 3:115255519-115255541 AGGGCTGTTGAGGTTTGCTGGGG - Intergenic
960277129 3:115741687-115741709 AGGGCTGCTGTGATTTGCTGGGG + Intergenic
960342171 3:116487009-116487031 AGGGCTGCTGAAGTATGCTGGGG - Intronic
960413830 3:117359582-117359604 GGGGCTGCTGCAGTTTGCTGTGG - Intergenic
960477161 3:118144401-118144423 AGGGCTGCTGCAGTTTGCCGGGG + Intergenic
960565433 3:119126750-119126772 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
960565880 3:119130927-119130949 AGGTCTGTTGGAGTTTGCTGGGG - Intronic
960579934 3:119268058-119268080 AGGTGTGCTGCAGTTTGCTGGGG - Intergenic
961390966 3:126552113-126552135 AGTGCTGTTGCAGGTTGTCGTGG - Exonic
962156960 3:132957584-132957606 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
962692039 3:137908159-137908181 AGGGCTGCTGCAGTTTGTCGGGG - Intergenic
962859784 3:139389274-139389296 AGAGCTCCTGCAGTCTGCAGCGG - Intronic
962984365 3:140521375-140521397 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
963027544 3:140934243-140934265 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
963400365 3:144790563-144790585 AGGGCTGCTGTGGTTTGCTGTGG + Intergenic
963416167 3:144998683-144998705 ATGGCTGCTGCAGTTTGCTGGGG + Intergenic
963477719 3:145828390-145828412 AGGGCTGCTGCAGTTTTCTGGGG + Intergenic
963531205 3:146475394-146475416 AGGGCTGCTGCAGTTTTCTGGGG + Intronic
963532112 3:146483664-146483686 AGGGCTGCTGAAGTTTGCTAGGG - Intronic
963587021 3:147205073-147205095 AGGGCTGCTGCAGTAGGAAGGGG + Intergenic
963756095 3:149236099-149236121 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
964007663 3:151851531-151851553 AGGGCTACTGCAGTTTGCTGGGG + Intergenic
964295066 3:155224927-155224949 AGGACTGCTGCGGTTTGCTGGGG + Intergenic
964371269 3:156003353-156003375 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
964377925 3:156068429-156068451 AGGTCTGCTAAAGTTTGCTGGGG + Intronic
964581801 3:158247646-158247668 AGGGCTGCTGTGGTCTGCAGGGG + Intronic
964617173 3:158679033-158679055 ATGGCTGCTGCAGGTTGAGGTGG - Intronic
964831316 3:160886587-160886609 AGGGCTGCTGCGGTTTGCTGGGG - Intronic
964904934 3:161707949-161707971 AGGTCTGCTGGGGTTTGCTGGGG - Intergenic
965263427 3:166511330-166511352 AGGGCTGCTACAGTTTTCTGGGG - Intergenic
965497367 3:169414262-169414284 AGGTCTGCTGGAGTTTGCTGGGG - Intronic
965801191 3:172496162-172496184 AGGTCTGCTGCAGTTTGCTGGGG + Intergenic
966071525 3:175884996-175885018 AGGGCTGCTGCAATTTGCTAGGG + Intergenic
966152181 3:176877218-176877240 AGGGCTGCTGTGGTATGCTGGGG - Intergenic
966250410 3:177859709-177859731 AGGGCTGCTGCATTTTGCTGGGG + Intergenic
966454865 3:180102988-180103010 AGGGTTGCTGCAGTGTGCTGGGG - Intergenic
966539536 3:181074620-181074642 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
966652256 3:182314900-182314922 AGGTCTGCTGTAGTTTTCTGGGG + Intergenic
966862582 3:184238791-184238813 AGGGCTGCCGCAGTCTGGCCTGG + Exonic
967114286 3:186322684-186322706 AGGGCTGCCGCAGCATGCCGGGG - Intronic
967574896 3:191077749-191077771 AGGGCTGCTGCCATTTGCTGGGG - Intergenic
968390274 4:187149-187171 AGGGCTACTGTGGTTTGCTGGGG + Intergenic
968692213 4:1998015-1998037 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969202944 4:5620173-5620195 GGGGCTGCTGCAGTTTCCAAAGG - Intronic
969271900 4:6108620-6108642 AGGGCTGCTGCAGGTGGCTTGGG - Intronic
969952528 4:10853367-10853389 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
970107000 4:12595936-12595958 AGGTCTGCTGCAGTTTGCTGGGG - Intergenic
970155203 4:13134202-13134224 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
970165042 4:13227581-13227603 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
970185262 4:13445621-13445643 AGATCTGCTGCAGTTTGCTGGGG + Intronic
970288036 4:14539802-14539824 AGGGCTACTGCAGTTTGCTGGGG - Intergenic
970304778 4:14719602-14719624 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
970412158 4:15818746-15818768 AGGGCTGCTGCAGTGTGCAGGGG - Intronic
970666401 4:18342467-18342489 AGGGCTGCTGAAGTTTGCTGGGG + Intergenic
970952644 4:21775224-21775246 AGGGCTGCTGCAGTTTGCTCGGG + Intronic
971285933 4:25290367-25290389 AGGGCTGCTGCGATTTGCTGGGG + Intergenic
971429960 4:26555780-26555802 AGGTCTGCTGGAGTGTGCTGGGG + Intergenic
971516736 4:27496680-27496702 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
971574350 4:28254380-28254402 AGGGCTTCTGCAGTTTGCTGGGG - Intergenic
971746349 4:30586503-30586525 AGGTCTGCTGCAGTTTGCTGGGG + Intergenic
972022039 4:34327227-34327249 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
972861098 4:43169726-43169748 AAGTCTCCTGCAGTTTGCTGGGG - Intergenic
972990087 4:44814146-44814168 AGGGCTGCTGCAGTTTACTGGGG + Intergenic
973018608 4:45172232-45172254 AGGACTGCTGCAGTTTGCTGGGG + Intergenic
973562739 4:52152373-52152395 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
973574510 4:52273514-52273536 AGGGCTACTGCAGTATGCTGGGG - Intergenic
973584765 4:52378439-52378461 ACGGCTGCTGTTGTTTGCTGGGG - Intergenic
973694508 4:53476833-53476855 TGGGCTGCTGCAGTCTTCCTGGG + Exonic
974130419 4:57747984-57748006 AGAGCTGCTGCAGTTTGCTAAGG + Intergenic
974298320 4:60033775-60033797 AGGTCTGCTGCAGTTTGCTGAGG + Intergenic
974339966 4:60603095-60603117 AGGGCTGCTGCAGTTTGCTAAGG + Intergenic
974499809 4:62684715-62684737 ACGACTGCTGCAGTTTGCTGGGG - Intergenic
974539694 4:63218589-63218611 AGGGCTGCTTGAGTTTGGTGGGG + Intergenic
974760477 4:66267170-66267192 AGGTCTGCTGCAGTTTTCTGGGG - Intergenic
974768759 4:66383410-66383432 AGGGCTGCAGCAGTTTTCTGGGG - Intergenic
974814057 4:66982591-66982613 AGGTCTGCTGGAGTTTGCTAGGG - Intergenic
974885318 4:67810249-67810271 AAGGCTGCTGCAGTTTGCTGGGG - Intergenic
974913146 4:68148121-68148143 AGGGCTGCTGCAGTTTGGTGGGG + Intergenic
974965158 4:68751263-68751285 AGGGCTACTGCTGTTTGCTACGG - Intergenic
975022090 4:69502546-69502568 AGGGCTGCTGCAGTATGCTGGGG - Intronic
975106210 4:70571710-70571732 AGGGCTGCTGCAGCATACTGGGG + Intergenic
975153582 4:71045976-71045998 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
975518159 4:75269475-75269497 AGGTCTGCTGGATTTTGCTGGGG - Intergenic
975680027 4:76867255-76867277 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
975977611 4:80116488-80116510 AGGGCTGCTGTAGTTTGCTGGGG - Intronic
976080111 4:81346018-81346040 AGGGATTCTGCAGTTTCCTGGGG + Intergenic
976527769 4:86114438-86114460 AGGGCTGCTGTGGTTTACTGGGG + Intronic
976534244 4:86193038-86193060 AGCTCTGCTGGAGTTTGCTGGGG + Intronic
976538109 4:86242114-86242136 AGGGCTCCTGCAGTTTGCTGGGG + Intronic
976769441 4:88634887-88634909 AGAGCTGCTGCGGTTTGCTGGGG - Intronic
976807322 4:89063038-89063060 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
976852789 4:89567852-89567874 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
976954692 4:90880726-90880748 AGGGCTGCTGAGGTATGCTGGGG + Intronic
977039901 4:92002561-92002583 GGGACTGCTGCATTTTGCTGGGG - Intergenic
977086061 4:92600642-92600664 AGGGCTGCTGTGGTTTGCTCGGG + Intronic
977185556 4:93932070-93932092 AGGTCTGCTGGAGTTTGCTAGGG + Intergenic
977508912 4:97937643-97937665 AGGGCTGCTGTGGTTTGCTGAGG + Intronic
977657170 4:99535977-99535999 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
977671495 4:99699945-99699967 AGGTCTGCTGGAGTTTGCTGAGG - Intergenic
977729293 4:100331864-100331886 AGGGCTGCTGCAATATGCTTGGG - Intergenic
977819818 4:101458554-101458576 AGGGCTGCTGCAGTACGCTTGGG - Intronic
977887986 4:102273821-102273843 AGGTCTTCTGGAGTTTGCTGGGG - Intronic
977971411 4:103218088-103218110 ATGGCTGCTGCAGTATGCTGGGG - Intergenic
978118586 4:105050745-105050767 AGGACTGCTGTAGTTTGCTGGGG - Intergenic
978206258 4:106083816-106083838 AGGGCTGCTGCAGTTTCCTGGGG - Intronic
978208207 4:106104883-106104905 AGGGCTGCTGCAGTATGCTTGGG - Intronic
978238378 4:106487578-106487600 AGGGCTGCTGCAATATGCTGAGG + Intergenic
978327997 4:107580069-107580091 AGGGTTGCTGCAGTTTGCTGGGG - Intergenic
978656933 4:111075422-111075444 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
978940320 4:114428914-114428936 AGGGCTGCTGAAGTTTGCTGGGG + Intergenic
979045011 4:115851947-115851969 AGGGCTGCTGTGGTATGCTGGGG - Intergenic
979179598 4:117708262-117708284 AAGGCTGCTGTGGTTTGCTGAGG - Intergenic
979197743 4:117941061-117941083 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
979576205 4:122294500-122294522 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
979583782 4:122391125-122391147 AAGGCTGCTGCAGTCTGTTGGGG + Intronic
979628326 4:122871731-122871753 AGGGCTTCTGCAGTTTGCTGGGG - Intronic
979742497 4:124168383-124168405 ATGGCTGCTGTGGTTTGCTGGGG - Intergenic
979775539 4:124583943-124583965 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
979967207 4:127089093-127089115 AGGGCTGCTGCGATTTGCTGAGG - Intergenic
980022021 4:127722207-127722229 AGAGCTGCTGCAGTTTGCCTGGG + Exonic
980184743 4:129446944-129446966 AGGGCTGCTGTGATTTGCTGGGG - Intergenic
980331343 4:131415120-131415142 AGGGCAGCTGCAGTATGCTGGGG - Intergenic
980392825 4:132169159-132169181 AGGGCTGCTGCAGTTTGTTGGGG + Intergenic
980489488 4:133506402-133506424 AAGGCTGCTGCAGTTTGCTGGGG - Intergenic
980508823 4:133759255-133759277 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
980645241 4:135635517-135635539 AGAGCTGCTGTGGTTTGCTGGGG + Intergenic
980744572 4:136998762-136998784 AGGGCTGCTGCAGTTTTCTGGGG + Intergenic
980787313 4:137572350-137572372 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
980864941 4:138543080-138543102 AGGGCTGCTGTGGTTTGCTTGGG - Intergenic
980888025 4:138784883-138784905 AGGTCTGCTGGAGTTCGCTGGGG + Intergenic
981273933 4:142875480-142875502 AGGGCTGCTGTGGTTTGCTTGGG - Intergenic
981290580 4:143070879-143070901 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
981352926 4:143752914-143752936 AGGGCTGCTGCTGTTGGCTGGGG - Intergenic
981388914 4:144164391-144164413 AGGGCTACTGCAGTATGCTGGGG + Intergenic
981577957 4:146224730-146224752 AGAACTGCTGCAGTTGGCCACGG - Intronic
981790844 4:148535367-148535389 AGGGCTGCTGATGTTTGCTGGGG + Intergenic
982183020 4:152766039-152766061 AGGGAGGCTGCAGTGAGCCGAGG + Intronic
982372393 4:154647764-154647786 AGGGCTACTGCAGTTTGCTGGGG - Intronic
982528321 4:156506469-156506491 AGGGCTGCTGTGGTTTGTTGGGG - Intergenic
982663073 4:158229257-158229279 AGGGCTGCTGTGGTTTGCTGGGG + Intronic
983044409 4:162969130-162969152 AGGTCTGCTGGAGTTGGCAGGGG + Intergenic
983047380 4:163003985-163004007 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
983167610 4:164497004-164497026 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
983169499 4:164520303-164520325 AGGTCTGCTGCAGTTTGCTAGGG + Intergenic
983179548 4:164631321-164631343 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
983727030 4:170941130-170941152 AGAGCTGCTGCAGTGTGCTTGGG - Intergenic
983774811 4:171594290-171594312 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
983896130 4:173084090-173084112 AGGTCTGCTGGAGTTTGCTAGGG + Intergenic
983899047 4:173113514-173113536 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
983957689 4:173716440-173716462 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
984215845 4:176911532-176911554 GGGGCTGCTGCAGTTTGCTGGGG - Intergenic
984335112 4:178379839-178379861 AGGGCTGCTGCAGTTTGCTGTGG - Intergenic
984525950 4:180860001-180860023 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
984626009 4:182008997-182009019 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
984723437 4:182998221-182998243 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
985845765 5:2345921-2345943 AGGGCTGCTGCAGTGTGCTAGGG + Intergenic
986140754 5:5027090-5027112 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
986484442 5:8220885-8220907 AGGTCTGCTGGAGTTTGCCTGGG - Intergenic
986492524 5:8307193-8307215 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
986753647 5:10812907-10812929 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
986781285 5:11068239-11068261 AGGGATGCTGAAGTTTGCCAAGG - Intronic
987019356 5:13853244-13853266 AGGTCTTCTGGAGTTTGCTGGGG - Intronic
987228856 5:15871185-15871207 AGGTCTGCTGGAGTTTGCTGGGG - Intronic
987453964 5:18120082-18120104 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
987530712 5:19115458-19115480 AGGGATGCTGCAGTTTGCTGGGG - Intergenic
987634894 5:20526630-20526652 AGGTCTGCTGCAGTTTGCTGGGG - Intronic
987834606 5:23145700-23145722 AGGGCTGCTGCAGTTTTCTGGGG + Intergenic
987837309 5:23178590-23178612 AGGGTTGCTGTGGTTTGCTGGGG + Intergenic
987927793 5:24364632-24364654 AGGGCAGCTGCACTATGCCAGGG - Intergenic
987988487 5:25180727-25180749 AGGGCTGCTGCAGTTTGCTGAGG + Intergenic
988076488 5:26362020-26362042 AGGGTTGCTGCAGTATGCTGGGG + Intergenic
988402212 5:30776314-30776336 AGGTTTGCTGGAGTTTGCTGGGG - Intergenic
988935976 5:36083304-36083326 AGGGCTGTTGCAGTATGCTGGGG - Intergenic
989092150 5:37744152-37744174 AGAGCTGCTGCAGTTTGCTGGGG - Intronic
989305539 5:39951086-39951108 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
989348118 5:40453174-40453196 AGGGCTGCTGCAGTTCGCTGGGG + Intergenic
989657376 5:43759640-43759662 AAGGCTGCAGCAATTTGCTGGGG + Intergenic
989676582 5:43981003-43981025 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
990016123 5:51064271-51064293 ATGGCTGCTGCGGTTTGCTGGGG - Intergenic
990138991 5:52681947-52681969 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
990230842 5:53711924-53711946 AGGGCTGCTGTTGTTTGCTGGGG + Intergenic
990620004 5:57549688-57549710 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
990897496 5:60715182-60715204 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
990931228 5:61094717-61094739 AGGGCTACTGCAGTTTTCTGGGG + Intronic
991097387 5:62753279-62753301 AGGTCTGTTGGAGTTTGCTGGGG - Intergenic
991143347 5:63272991-63273013 AAGGCTGCTGCAGTTTTCTCAGG + Intergenic
991157796 5:63459101-63459123 AGGGCTGCTGCAGTATGCTGGGG - Intergenic
991227716 5:64292378-64292400 AGGGCTGCTGTGGCTTGCTGGGG + Intronic
991424028 5:66472320-66472342 AGGGCTGCTGCATGTTGCAGGGG + Intergenic
992571792 5:78066051-78066073 AGAGCTGCTGCAGTTTGCTGGGG - Intronic
992977608 5:82137481-82137503 AGGTCTGCGGGAGTTTGCTGAGG + Intronic
993018403 5:82563074-82563096 AGAGCTGCTGGACTGTGCCGAGG - Intergenic
993018493 5:82563613-82563635 AGGGCTGCTGCAGTATGTTGGGG - Intergenic
993020315 5:82584224-82584246 AGGGCTGCTGCGGTTTGCTGGGG + Intergenic
993253454 5:85556882-85556904 AGGGCAGCTGCAGTTTGCTGGGG - Intergenic
993265576 5:85722197-85722219 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
993375843 5:87149029-87149051 AGGGCTGCCGTGGTTTGCTGGGG + Intergenic
993410375 5:87566783-87566805 AGGTCAGCTGGAGTTTGCTGGGG + Intergenic
993420933 5:87700455-87700477 AGGGCTGCTGTAGTTTACTGGGG + Intergenic
993589684 5:89778614-89778636 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
993808006 5:92436684-92436706 AGGGCTGCTGAAGTTTGCTAGGG - Intergenic
993837557 5:92834596-92834618 AGGGCTGCTGCTGTTTGCTGGGG + Intergenic
993927677 5:93890969-93890991 AGGGTTGCTACAGTTTGACATGG - Intronic
994005068 5:94828225-94828247 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
994235183 5:97355216-97355238 AGGGCTGCTGTGGTCTGCTGGGG + Intergenic
994298894 5:98122264-98122286 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
994344619 5:98669475-98669497 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
994350783 5:98743193-98743215 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
994437962 5:99763060-99763082 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
994470108 5:100192653-100192675 AGGGCTGCTGCAGCTTGCTGGGG - Intergenic
994473445 5:100238613-100238635 AGGACTGCTGTAGTATGCTGGGG + Intergenic
994565703 5:101442937-101442959 AGGTCTGTTGGAGTTTGCTGGGG - Intergenic
994843065 5:104951301-104951323 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
994917947 5:106004139-106004161 AGGTCTGCTGGAGTTTGCGGGGG + Intergenic
995003107 5:107158633-107158655 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
995052320 5:107720110-107720132 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
995080768 5:108048178-108048200 AGGGCTGCTTCAGTTTGTTGGGG - Intronic
995258213 5:110072163-110072185 AGGGTTGCTGCAGTTTGCTGGGG + Intergenic
995264061 5:110138338-110138360 TGGGCTGCTGCAGTTTTCTGGGG + Intergenic
995271143 5:110220595-110220617 AGGGCTGCTTCACTGTGCTGGGG + Intergenic
995578944 5:113574214-113574236 AGGGCTGCTGCGGTTTGCTGGGG + Intronic
995594105 5:113730487-113730509 AGGACTGCTGCAGTTTGCTGGGG + Intergenic
995685255 5:114765863-114765885 AGTGCTGCTGCAGTTTTCTGGGG + Intergenic
995960056 5:117829199-117829221 AGGACTGCTACAGTTTGCTGGGG + Intergenic
996182045 5:120431658-120431680 AGAGCTGCTGAGGTTTGCTGGGG + Intergenic
996287634 5:121813297-121813319 AGGGCTGCTGTTGTTTGCTGGGG + Intergenic
996425756 5:123312459-123312481 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
996463125 5:123770311-123770333 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
996482134 5:123987871-123987893 AAGGCTGCTGCAGTTTGCTGGGG + Intergenic
996527175 5:124491798-124491820 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
996639183 5:125731148-125731170 AGGGCTGCTGCAGTTTGCTGCGG - Intergenic
996778526 5:127159347-127159369 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
996893935 5:128456673-128456695 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
996901925 5:128552326-128552348 GGGGCTGCTACAGTTTGCTGAGG - Intronic
997866874 5:137471720-137471742 AGGCATGGTGCACTTTGCCGTGG - Intronic
998717816 5:144905958-144905980 AGGTCTGCTGGAGTTTTCTGAGG - Intergenic
998788931 5:145744585-145744607 AGGGTTGCTGTGGTTTGCTGGGG - Intronic
998972678 5:147610449-147610471 AAGTCTGCTGGAGTTTGCTGGGG + Intronic
999052133 5:148534365-148534387 ATGGCTACTGCAGTATGCTGGGG - Intronic
999596994 5:153215432-153215454 AGAGCTGCTGCTCTTTGCTGGGG - Intergenic
999678758 5:154034904-154034926 GGGGCTGCTTCAGTTAGCAGTGG + Exonic
999938674 5:156516405-156516427 ACAGCTGCTGCAGTTTGCTGGGG - Intronic
999959058 5:156735058-156735080 AGGCCTGCTGCAGTTTGCTGGGG + Intronic
1000031673 5:157407067-157407089 AGGGCTGCTGCAGTATGCTTGGG - Intronic
1000194667 5:158946451-158946473 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
1000523618 5:162328131-162328153 AGGGCTGCTACAGTTTGCTTGGG - Intergenic
1000749250 5:165074273-165074295 AGGCCTGCTGCAGTTTGCCAGGG + Intergenic
1001362567 5:171102865-171102887 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
1001739027 5:174034842-174034864 AGGGCTGCTGCAGTTTTCCGGGG + Intergenic
1001788925 5:174437667-174437689 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1001839604 5:174864237-174864259 AGTGCTTCTACAGTTTGCTGAGG + Intergenic
1001844133 5:174905287-174905309 AGGGCTGCTGCAGCTTGCTGAGG - Intergenic
1002419309 5:179137477-179137499 CGGGCTCCTGCAGTTCACCGTGG - Intronic
1002465650 5:179407151-179407173 AGTGCTGCTGCAGTCTGCACGGG - Intergenic
1003248853 6:4406521-4406543 AGGGCTGCTGCTGTTTGCTGGGG - Intergenic
1003686993 6:8314601-8314623 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1003867222 6:10374403-10374425 AGGACTGCTGCAGTTTTTCGAGG + Intergenic
1003874779 6:10425923-10425945 GGGGCTGCTGCAGCTCCCCGAGG - Intergenic
1003902468 6:10667962-10667984 AGGGCTTCTGCGGTTTGCTGGGG + Intergenic
1004760213 6:18657260-18657282 AGGGCTGCTGCAGTTTGCCAGGG - Intergenic
1005170715 6:22981178-22981200 AGGGCTTCTGCGGTTTGCTGGGG - Intergenic
1005373572 6:25159074-25159096 AGGTCTGTTGGAGTTTGCTGTGG - Intergenic
1005670387 6:28099598-28099620 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1006040279 6:31246764-31246786 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
1006048690 6:31322177-31322199 AGGGCTGCTACAGTTTGCTGGGG - Intronic
1006712261 6:36084081-36084103 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1007195462 6:40056270-40056292 AGGGCTGCTGTATTTTCCTGGGG - Intergenic
1007351030 6:41273663-41273685 AGGGGTGCTTCAGTATGCTGAGG + Intronic
1008082743 6:47210622-47210644 AGAGCTGCTGTGGTTTGCTGGGG - Intergenic
1008173201 6:48234499-48234521 AGGGCTGCTGCAGTGTGCTGGGG - Intergenic
1008211412 6:48729426-48729448 AGGACTGCTGCAGTATGCTGGGG - Intergenic
1008244151 6:49150246-49150268 GGGGCTGCTGCAGTTTTCTGGGG + Intergenic
1008294335 6:49757278-49757300 AGGGCTGCTGTAGTATGCAGGGG + Intergenic
1008468155 6:51854191-51854213 TGGGCTGCTGCAGTTTGCTGGGG + Intronic
1008741656 6:54615649-54615671 AGGCCTGCTGCAGTTTGCTGGGG - Intergenic
1008773549 6:55008653-55008675 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1008779824 6:55089946-55089968 AGGTCTGTTGGAGTTTGCTGGGG - Intergenic
1008997935 6:57680360-57680382 AGGTCTGCTGGAGTCTGCTGGGG - Intergenic
1009186422 6:60579698-60579720 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1009193986 6:60663215-60663237 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1009305800 6:62088467-62088489 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
1009336160 6:62492897-62492919 AGGTCTGCTAGAGTTTGCTGGGG - Intergenic
1009458858 6:63888513-63888535 AGGTCTGCTGGAGTTTGCTGGGG - Intronic
1009596663 6:65745378-65745400 AGGGCTGCTGCAGTATGCTGGGG - Intergenic
1009707038 6:67265835-67265857 AGGGCTGCTGTGGCTTGCTGGGG + Intergenic
1009916684 6:70005418-70005440 AGGGCTGCTACGGTTTGCTCGGG + Intronic
1010019040 6:71138898-71138920 AGGGCTGCTGCAGTATACTGGGG - Intergenic
1010295754 6:74194224-74194246 AGGGCTGCTGAAGTTTGCTGGGG + Intergenic
1010331396 6:74627190-74627212 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1010483121 6:76378732-76378754 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1010615440 6:78006352-78006374 AGGTCGGCTGGAGTTTGCTGGGG - Intergenic
1010782863 6:79965632-79965654 AGGGCTATTGCAGTATGCTGGGG - Intergenic
1010945715 6:81970783-81970805 AGGGCTGCTTCAGTTTTCTGGGG - Intergenic
1011137690 6:84117730-84117752 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1011321194 6:86095135-86095157 AGGGGTGCTGCAGTTTGCTGGGG - Intergenic
1011377545 6:86706378-86706400 AGGGCTGCTGCAGTTTTCTGGGG + Intergenic
1011392314 6:86867657-86867679 AGGGCTGCTGCAGTGTGCTTGGG - Intergenic
1011507839 6:88067763-88067785 AGGGCTGCTGTGGTTTGCTTGGG + Intergenic
1011578304 6:88828265-88828287 AGCTCTGCTGGAGTTTGCTGGGG - Intronic
1011714057 6:90085738-90085760 AGGGATGCTGCAGTTTGTGAGGG - Intronic
1011944272 6:92881128-92881150 GGGGCTGCTTCAGTTTGCTAGGG - Intergenic
1012043508 6:94239558-94239580 AGGTATGCTGGAGTTTGCTGGGG - Intergenic
1012063171 6:94512435-94512457 AGGGCTGCTGCAGTTTTCTGGGG - Intergenic
1012082976 6:94784704-94784726 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1012127836 6:95453545-95453567 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1012343370 6:98156413-98156435 AGGTCTGCTGCAGTTTTCTGGGG + Intergenic
1012434734 6:99203652-99203674 AGGGCTGCTGCGGTTTGTTGAGG + Intergenic
1012595132 6:101030581-101030603 AGGTCTGTTGGAGTTTGCCTGGG + Intergenic
1012597019 6:101053416-101053438 AGGTCTGCTGGGGTTTGCTGGGG + Intergenic
1012869511 6:104656938-104656960 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1012878124 6:104753630-104753652 AGGGCTGCTGTGGTTTGCCAGGG - Intronic
1013379825 6:109557254-109557276 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1013453099 6:110304040-110304062 AGGTCTACTGGAGTTTGCTGGGG - Intronic
1013461622 6:110379455-110379477 AGGGCTGCTGCAGGTTGCTGGGG - Intergenic
1013932073 6:115545866-115545888 AGGGCTGCTGAAGTTTGCTGGGG - Intergenic
1013941440 6:115667856-115667878 AGGGCTGCTACAGGTTGAGGTGG - Intergenic
1014084871 6:117330704-117330726 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1014278947 6:119418834-119418856 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1014369179 6:120583880-120583902 AGGGCTGCTGTAGTTTGCTGGGG + Intergenic
1014393487 6:120894547-120894569 AGGGCTGCTGCAGTTTGCTAGGG + Intergenic
1014422406 6:121261508-121261530 AGGGCTGCTGTGGTTTGCTGGGG - Intronic
1014464415 6:121738290-121738312 AAGGCTCTTGCAGTTTGCTGGGG + Intergenic
1014484664 6:121984486-121984508 ACGGCTGCAGCAGATTGCTGTGG + Intergenic
1014753788 6:125281079-125281101 AGGTCTGCTGGCGTTTGCTGAGG - Intronic
1014864122 6:126506438-126506460 AGGGCTACTGCAGTTTGCTGGGG - Intergenic
1015046205 6:128779490-128779512 AGGTCTGTTGGAGTTTGCTGGGG + Intergenic
1015136909 6:129882734-129882756 AGGGCTGCTGCGGTTTGCTGGGG + Intergenic
1015197250 6:130537177-130537199 AGGGCTGCTGTAGTATGCTTAGG - Intergenic
1015211414 6:130702491-130702513 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1015368489 6:132424781-132424803 TGGGCTGCTGTGGTTTGCAGGGG + Intergenic
1015440686 6:133242370-133242392 ATGTCTCCTGCAGTTTGCCAGGG + Intronic
1015587465 6:134790119-134790141 TGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1015902009 6:138076869-138076891 AGGGGTGCTGTGGTTTGCTGTGG - Intergenic
1016423697 6:143912503-143912525 AGGGCTGCTAAGGTTTGCTGGGG + Intronic
1016691432 6:146942873-146942895 AGGTCTGCTGGAGTTTGCTGCGG + Intergenic
1016790660 6:148064294-148064316 AGAGATGCTGCAGTTTGCTGGGG + Intergenic
1016847865 6:148587167-148587189 AGGGCTGCTGCAGTTTATTGGGG + Intergenic
1017536028 6:155348969-155348991 AGGGCTGCTGTGGTATGCTGGGG + Intergenic
1017994505 6:159520618-159520640 AGGGCTGCTGCAGTATGCTGGGG + Intergenic
1018507739 6:164490225-164490247 AGGTCTGCTGGAGTTTGCAGAGG + Intergenic
1018578351 6:165283706-165283728 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1018924025 6:168194309-168194331 AGGGCTGCTGCAGAGAACCGCGG - Intergenic
1019113434 6:169737577-169737599 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1019161401 6:170068999-170069021 AGGGCTGCAGCAGGGTGGCGTGG + Intergenic
1019385665 7:754716-754738 AGTGCTGCTGCTGCATGCCGAGG + Exonic
1020599030 7:10248708-10248730 AGGTCTGCTGCAGTTTGCTGGGG - Intergenic
1020619201 7:10497372-10497394 AGGGTTGCTGTGGTTTGCTGGGG - Intergenic
1020633688 7:10671663-10671685 TGGGCTGCTGCAGTTTGTTGGGG + Intergenic
1020702306 7:11498865-11498887 AGGGCTGCTGCTGTATGCTTGGG - Intronic
1020753320 7:12170127-12170149 AGGTCTGCTGGAGTTTGCTCAGG + Intergenic
1020874171 7:13673285-13673307 AGGTCTGCTGGAGTGTGCTGGGG + Intergenic
1021390708 7:20089346-20089368 AGGTCTGCTGCAATTTGCTGGGG - Intergenic
1021520925 7:21538382-21538404 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1021776611 7:24060302-24060324 AGGGCTGCTGCAGTTTGCTGAGG - Intergenic
1022058745 7:26769719-26769741 AGGTCTGCCGGAGTTTGCTGGGG + Intronic
1022076156 7:26973392-26973414 AGGAATGCTGCAGTTTTCTGGGG + Intronic
1022677853 7:32516550-32516572 AGGGCTGCTGCACGTTGCTGGGG - Intronic
1023196106 7:37641538-37641560 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1023886407 7:44360323-44360345 AGGGCTGCTGCAATATGCTGGGG + Intergenic
1024034287 7:45494711-45494733 AGGGCTGCTGCAGTTTTCTGGGG + Intergenic
1024099608 7:46016291-46016313 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1024664808 7:51536027-51536049 AGGTCAGCTGGAGTTTGCTGGGG + Intergenic
1024703263 7:51927767-51927789 AGGTGTGCTGGAGTTTGCTGGGG + Intergenic
1025041798 7:55651877-55651899 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1027576137 7:79933631-79933653 AGGGCTGCAGAAGTTTTCTGGGG + Intergenic
1027956800 7:84888337-84888359 AGGGCTACTTCAGTGTGCTGGGG + Intergenic
1028027751 7:85867313-85867335 AGGGCTGCTGCGGTTTGCTGGGG - Intergenic
1028049009 7:86159007-86159029 AGGGCTGTTGCAGTTTGCTAGGG - Intergenic
1028080408 7:86568052-86568074 AGATCTGCTGGAGTTTGCTGGGG - Intergenic
1028518086 7:91699434-91699456 AGGGCTACTGTGGTTTGCTGGGG - Intronic
1028523102 7:91753312-91753334 AGGGCTGCTGCCGTTTGCTGGGG - Intronic
1028626939 7:92888611-92888633 ATGGCTGCTGATGTTTGCTGGGG + Intergenic
1028644253 7:93077246-93077268 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1028781576 7:94743587-94743609 AAGGCTGCAGCAGGTTGCCTTGG - Intergenic
1029017962 7:97333983-97334005 AGGGCTGTTGAATTTTGTCGAGG - Intergenic
1029039591 7:97558401-97558423 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG + Intronic
1030234324 7:107242387-107242409 AGGGCTGCTGCAGTATGCTTGGG - Intronic
1030256621 7:107516736-107516758 AGGTCTGCTGCAGTTTGCTGGGG - Intronic
1030258040 7:107533049-107533071 AGGTCTGCTGGAGTTTGCTGCGG - Intronic
1030375138 7:108745496-108745518 GGGGCTGCTGCAGTACGCTGGGG + Intergenic
1030403674 7:109084104-109084126 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1030413526 7:109212624-109212646 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1030438313 7:109552797-109552819 AAGGCTGCTGCAGTTTGCTGGGG - Intergenic
1030500717 7:110356047-110356069 AAGTCTGCTGGAGTTTGCTGGGG + Intergenic
1030830131 7:114210399-114210421 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1031254404 7:119428991-119429013 AAAGCTGCTGCTGTTTGCTGGGG - Intergenic
1031804687 7:126293232-126293254 AGGGCTGCTGCAGTTTTCTGGGG - Intergenic
1032203461 7:129840645-129840667 AGGGGTGCTGCAGTTCACTGAGG - Intronic
1032526372 7:132581032-132581054 AAGGCTGCTGGAGTGTGCTGTGG - Intronic
1032775567 7:135109495-135109517 ATGGCTGCTGCAGTATGCTGGGG + Intronic
1032776917 7:135122769-135122791 AGGGCTGCTGCTGTTTGCTGGGG - Intronic
1032920015 7:136534658-136534680 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1032968580 7:137131699-137131721 AGGGGTGCTACAGTATGCTGGGG - Intergenic
1033989504 7:147265882-147265904 AGGGGTGCTGTGGTTTGCTGGGG - Intronic
1034086485 7:148327176-148327198 GGGGCTGCTGCAGTGGCCCGTGG + Intronic
1035491784 7:159285404-159285426 AGGGCTGCTGTGGTTTGCTAGGG - Intergenic
1035599391 8:888640-888662 TGGGGTGCTGCAGTTTGCTGGGG + Intergenic
1035794166 8:2337786-2337808 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1035798639 8:2383922-2383944 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1036184760 8:6613581-6613603 AGGGATTCTGCAGTTCCCCGGGG + Intronic
1036370339 8:8156810-8156832 AGGTCTGTTGGAGTTTGCCTGGG - Intergenic
1036880553 8:12508821-12508843 AGGTCTGTTGGAGTTTGCCTGGG + Intergenic
1037249482 8:16876567-16876589 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1037285373 8:17293717-17293739 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
1037610612 8:20473110-20473132 AGGGCTGCTGCAGAGAGCCACGG + Intergenic
1038073794 8:24046952-24046974 AGGACTGCTGTGGTTTGCTGGGG - Intergenic
1038243239 8:25830413-25830435 AAGGCTGCTGCAGTTTGCTGGGG + Intergenic
1038706818 8:29901925-29901947 AGGGATGCTGCAGTTTGCTGGGG - Intergenic
1038917132 8:32037194-32037216 AGGGCTGCAGCCATTTGCTGGGG + Intronic
1039025291 8:33252281-33252303 AGGGCTGCTGCAATTTGCAGGGG + Intergenic
1039265255 8:35816579-35816601 AGTGCTGCTGCAGTTTGCTGGGG - Intergenic
1039293749 8:36127215-36127237 AGAGCTGCTGCAGTTTGCTGGGG + Intergenic
1039402331 8:37280111-37280133 AGGGCTGCTGCTGTTTGCTGGGG - Intergenic
1039551454 8:38446175-38446197 AGGGCTGAGTCAGTTTGCCTTGG - Intronic
1039637019 8:39178786-39178808 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1039658297 8:39433906-39433928 AAGGCTGCTGCAGTTTTCTGGGG - Intergenic
1039685823 8:39801278-39801300 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1039754741 8:40511703-40511725 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1039801889 8:40964878-40964900 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1039820606 8:41130666-41130688 AGGGCTGTTGCAGTTTGCTGAGG - Intergenic
1040091918 8:43407870-43407892 AGGGGTGCTGCAGTTTGTTGGGG + Intergenic
1040400724 8:47046547-47046569 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1040614090 8:49017810-49017832 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1040763189 8:50874889-50874911 AGGGCTGCTGTGGTTTGCTAGGG - Intergenic
1040841929 8:51793203-51793225 AGGGCTGCTGTGGTTTCCTGGGG - Intronic
1040959869 8:53019976-53019998 AGGGCTGCTTCGGTTTGTGGGGG - Intergenic
1041021294 8:53641980-53642002 AGGGCTGCCACGGTTTGCTGGGG + Intergenic
1041561779 8:59226421-59226443 AGGGCTGCTGCAGTATACTTGGG - Intergenic
1041615403 8:59900141-59900163 AGGGCTGTTGAAGTTTCCTGGGG - Intergenic
1041666409 8:60448940-60448962 TGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1041747499 8:61224434-61224456 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1041972516 8:63760322-63760344 AGGGCTGCTGGGGTTTGCTGGGG + Intergenic
1042108607 8:65355631-65355653 AGGGCTGCTGCAGTGTGCTGGGG + Intergenic
1042630055 8:70806142-70806164 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1042644257 8:70968698-70968720 AGGGCTTCTGCAGTTTGCTGGGG + Intergenic
1042773744 8:72406030-72406052 AGGTCTGCTGCAGGTTGCTGGGG - Intergenic
1043092660 8:75924765-75924787 AGGGCTGCTGTGGTTTGCTCGGG - Intergenic
1043191134 8:77224813-77224835 AGGGCTGCTGCAGCATGCTGGGG + Intergenic
1043223748 8:77698970-77698992 AGGGCTGCTGCAATTTGCTGGGG + Intergenic
1043227357 8:77748771-77748793 AGGGCTGCTGCAGTATGCTGGGG - Intergenic
1043301795 8:78743836-78743858 AGGGCTGCTGTGGTTTGCTGGGG + Intronic
1043363101 8:79499088-79499110 AGGACTGCTGCAATTTGCTAGGG + Intergenic
1043396593 8:79843214-79843236 AGGGCTGGTGCAGTTTGCTGGGG - Intergenic
1043532537 8:81166535-81166557 AAGTCTGCTGGAGTTTGCTGGGG - Intergenic
1043647146 8:82535629-82535651 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1043948538 8:86281871-86281893 AGGGCTGCTGTATGTTGCAGGGG + Intronic
1044038550 8:87336960-87336982 AGGGCTGCTGCGGTTTGCTGGGG + Intronic
1044113391 8:88303700-88303722 AGCGCTGCTGCAGTTTGCTGGGG - Intronic
1044117144 8:88349794-88349816 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1044135791 8:88584306-88584328 AGGGCTGCTGCAGTTTTCTGGGG + Intergenic
1044221949 8:89679244-89679266 AGGGCTACTGTGGTTTGCTGGGG - Intergenic
1044356047 8:91224447-91224469 AGGGCTGCTGCAGTTGGCTGGGG + Intronic
1044505084 8:93007231-93007253 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1044961107 8:97531043-97531065 AGGTCTGCTCGAGTTTGCTGGGG - Intergenic
1045390682 8:101711140-101711162 AGGTCTGCTGGAGTTTGCTGGGG - Intronic
1045489505 8:102657513-102657535 AGGGCTGGAGCAGTTGGCCCTGG + Intergenic
1045699487 8:104849925-104849947 TGGGCTGCTGCAGTATGCTGGGG + Intronic
1045705343 8:104916274-104916296 GGGGCTGCTGCAATTTGCTGGGG + Intronic
1046080269 8:109362619-109362641 TGGGCTGCTCCTGTGTGCCGCGG + Exonic
1046295964 8:112218991-112219013 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1046416240 8:113917226-113917248 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1046657605 8:116912630-116912652 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1046708937 8:117487539-117487561 AGGACTGCTGTGGTTTGCTGGGG - Intergenic
1046986957 8:120398378-120398400 AGGACTGTTGCAGTTTGCTGGGG - Intronic
1047152014 8:122274249-122274271 AGGGCTGCTGAAGTTTGCTGGGG - Intergenic
1048587605 8:135790106-135790128 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1048587874 8:135791630-135791652 AGGGCCGCTGTGGTTTGCTGGGG - Intergenic
1049819287 8:144624784-144624806 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819315 8:144624886-144624908 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819329 8:144624937-144624959 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819357 8:144625039-144625061 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819371 8:144625090-144625112 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819385 8:144625141-144625163 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819399 8:144625192-144625214 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819413 8:144625243-144625265 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819427 8:144625294-144625316 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819441 8:144625345-144625367 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819455 8:144625396-144625418 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819493 8:144625549-144625571 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819507 8:144625600-144625622 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819533 8:144625702-144625724 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819559 8:144625804-144625826 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819611 8:144626008-144626030 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819625 8:144626059-144626081 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819703 8:144626365-144626387 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819717 8:144626416-144626438 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1049819731 8:144626467-144626489 GGGGCTGCCGCAGTGTGCAGTGG - Intergenic
1050130049 9:2402936-2402958 AGGTCTGCTGGAGTTTTCTGGGG + Intergenic
1050239807 9:3623601-3623623 AGGTCTGCTGGAGTTTTCTGGGG + Intergenic
1051036066 9:12747007-12747029 AGGGCTGCTGCAGTTTGCTGAGG + Intergenic
1051459011 9:17293028-17293050 AGGGCTGCTGTGGTTTGCTGGGG + Intronic
1051489567 9:17646639-17646661 AGGCCTGATGGAGTTTGCTGGGG + Intronic
1051603556 9:18897604-18897626 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1051695719 9:19766566-19766588 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
1051814416 9:21088086-21088108 AGGTCTGCTGGAGTTTGCTATGG - Intergenic
1051823298 9:21192610-21192632 AGGGCTGCTGCAATATGCTGGGG - Intergenic
1051825118 9:21211146-21211168 AGGGCTGCTGCAATATGCTGGGG - Intronic
1051827105 9:21233209-21233231 AGGGCTGCTGCAATATGCTGGGG - Intronic
1051877427 9:21806807-21806829 AGGGCTCCTGCAGTGTACCATGG + Intronic
1051899748 9:22025578-22025600 AGGGCTGCTGTAGTATGCTGGGG + Intronic
1051914015 9:22185890-22185912 AGGGCTGCTGTAGTTTGCTTAGG - Intergenic
1051998560 9:23248611-23248633 AGGTCTGTTGGAGTTTGCTGGGG - Intergenic
1052115646 9:24646104-24646126 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1052143930 9:25024834-25024856 AGGTCTGCTGCAGTTCACTGGGG + Intergenic
1052176658 9:25471660-25471682 AGGGCTGTTGCAGTTTGCTGGGG + Intergenic
1052199846 9:25764446-25764468 GGGGCTGCTGTGGTTTGCTGTGG - Intergenic
1052225185 9:26077403-26077425 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1052311645 9:27074901-27074923 AGGGCTTCTGCAGTATGCTTGGG + Intergenic
1052369345 9:27646052-27646074 AGGGCTGCTGCATTTTGCCAGGG - Intergenic
1052387044 9:27835117-27835139 AGGGCTGCTGTGGATTGCTGGGG + Intergenic
1052420892 9:28241850-28241872 AGGGCTGCTGCAGTTTGCTGGGG - Intronic
1052515225 9:29472017-29472039 ATGGCTGCTGCCGTTTGCTGGGG + Intergenic
1052546749 9:29889477-29889499 AAGGCTGCTACAGTTTGCTAGGG - Intergenic
1053678811 9:40465356-40465378 AGGGCTGCCGCAGTTTGCTGGGG - Intergenic
1053928796 9:43093709-43093731 AGGGCTGCCGCAGTTTGCTGGGG - Intergenic
1054284913 9:63159586-63159608 AGGGCTGCCGCAGTTTGCTGGGG + Intergenic
1054291889 9:63300894-63300916 AGGGCTGCCGCAGTTTGCTGGGG - Intergenic
1054389907 9:64605437-64605459 AGGGCTGCCGCAGTTTGCTGGGG - Intergenic
1054505807 9:65910939-65910961 AGGGCTGCCGCAGTTTGCTGGGG + Intergenic
1054719779 9:68593413-68593435 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1054760236 9:68998374-68998396 AGTTCTGCTCCAGTTTGCCTGGG + Intronic
1054813797 9:69455621-69455643 AGTGCTCCTGCTGTTTGCTGGGG + Intronic
1054985882 9:71261769-71261791 AGGTCTGCTGGAGTTTGTTGTGG + Intronic
1055239331 9:74164502-74164524 AGTTCTGCTGGAGTTTGCTGGGG - Intergenic
1055386734 9:75771206-75771228 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1055509702 9:76984309-76984331 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1055748575 9:79478569-79478591 AGGGACTCTGCAGTTTGCTGGGG + Intergenic
1055785413 9:79864857-79864879 GGGGGTGCTGCAGTTTGCCTTGG - Intergenic
1055829082 9:80359091-80359113 AGTGGTGCTGCAGTTTACCTTGG + Intergenic
1055842206 9:80519051-80519073 AGGGATCCTGCTGTTTGCTGGGG + Intergenic
1056123835 9:83514837-83514859 AGGTCTGCTGGAGTTTGTTGGGG - Intronic
1057241564 9:93416420-93416442 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1057337551 9:94166998-94167020 AGGGAGGCTGCACTTGGCCGCGG - Intergenic
1058182621 9:101816389-101816411 AGGTCTTCTGGAGTTTGCTGGGG - Intergenic
1058199961 9:102027497-102027519 AGGGCTGCTGCTGTTTGCTGGGG + Intergenic
1058265889 9:102898305-102898327 AGGTCTGCTGCAGTTTGCTGGGG - Intergenic
1058461701 9:105189612-105189634 AGGGCTGCTGCAGTATGCTGAGG + Intergenic
1058514205 9:105752560-105752582 AGGGTTGCTGCGGTTTGCTGAGG - Intronic
1058530263 9:105899678-105899700 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1058997044 9:110309282-110309304 AGGGCTGCTGCATATTGTGGGGG - Intronic
1059004109 9:110383328-110383350 AGGGCTGCTGTGGTTTGCTGGGG + Intronic
1059260724 9:112973720-112973742 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1059262609 9:112993333-112993355 AGGGCTACTGCAATTTGCTGGGG + Intergenic
1059895234 9:118856478-118856500 AGAGTTGCTGCGGTTTGCTGGGG - Intergenic
1059954690 9:119503050-119503072 AGGTCTGCTGCAGTTTGCTAGGG - Intronic
1060307272 9:122425465-122425487 AGGGCTGCTCCATTTTGCAATGG + Intergenic
1060321015 9:122561597-122561619 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1062709272 9:137964948-137964970 AGGGCTGCTGCAGTTTTCTGTGG + Intronic
1062743058 9:138192293-138192315 AGGGCTGCTGTGGTTTTCTGGGG + Intergenic
1062743307 9:138194294-138194316 AGGGCTGCTGTGGTTTTCTGGGG + Intergenic
1062743556 9:138196295-138196317 AGGGCTGCTGTGGTTTTCTGGGG + Intergenic
1185846177 X:3440481-3440503 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1185952583 X:4452513-4452535 AGGACTGCTGCAGTTTGTTGGGG - Intergenic
1186404848 X:9292865-9292887 AGGGCTGGTCCACTTTGCCAAGG - Intergenic
1186593344 X:10953848-10953870 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1186913296 X:14193069-14193091 AGGGCTGCTGTGGTTTGCTAGGG + Intergenic
1187424645 X:19166061-19166083 AGCACTGGTGCAGTTTGCTGGGG + Intergenic
1187605300 X:20875478-20875500 AGGTCTACTGCAGTTTGCTGGGG - Intergenic
1188099823 X:26070784-26070806 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1188193320 X:27197861-27197883 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1188669884 X:32869138-32869160 AGGGCTGCTGCAGTTTGTTGGGG - Intronic
1188723443 X:33551447-33551469 AGGGCTGCTGTGGTTTGGTGGGG + Intergenic
1188744745 X:33829045-33829067 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1188791575 X:34413161-34413183 AGGGTTGCTGCAGTATGCTGGGG - Intergenic
1188884438 X:35531942-35531964 AGGGCTGCTGAGGTTTGCTGGGG - Intergenic
1188921826 X:35986872-35986894 AGGTCTGCTGGAGTTTGCTGGGG + Intronic
1189296479 X:39921815-39921837 AGAGCAGCTGCAGTTTGTTGAGG + Intergenic
1189581607 X:42413341-42413363 AGGGCTGCCACAGTTTTCTGGGG + Intergenic
1189673952 X:43442492-43442514 AAGGCTGCTGCAGTATGCTGGGG + Intergenic
1189855070 X:45215334-45215356 AGGGCTGCTGTAGTTTGCTGGGG - Intergenic
1189861332 X:45275742-45275764 AGGGCTGCTGCGGTTTGCTGGGG + Intergenic
1189940050 X:46112405-46112427 AGGGTTGTTGCAATTTGCAGGGG + Intergenic
1190133157 X:47769211-47769233 AGGGCTGCTGCAGTTTTCCGGGG - Intergenic
1190494987 X:51020339-51020361 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1190529718 X:51362168-51362190 AGGGCTGCTGCCGTTTGCTGGGG - Intergenic
1190600538 X:52088414-52088436 AGGGCTGCTGCAGTATACTGGGG + Intergenic
1190803262 X:53812693-53812715 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1190971896 X:55357367-55357389 AGGGCTGCTGTGGTTTGCTTGGG - Intergenic
1190992603 X:55567089-55567111 AGGGCTGCTGCGATTTGCTGGGG - Intergenic
1191022705 X:55879183-55879205 AGGGCTGCTGCATATTGCTGGGG - Intergenic
1191034477 X:56009329-56009351 AGGCCTGCTGAAGTTTGCTAGGG - Intergenic
1191066856 X:56357865-56357887 AGGTCTGTTGGAGTTTGCTGGGG + Intergenic
1191078793 X:56487050-56487072 AGGGCTGCTGCAGTTTGCTGAGG + Intergenic
1191185458 X:57607008-57607030 AGGTCTGCTGCAGTTTGCTGGGG + Intergenic
1191223551 X:58016424-58016446 AAGGCTGCTGCAATATGCTGGGG - Intergenic
1191225090 X:58034617-58034639 AGGGCTGCTGTAGTTTTCTGGGG + Intergenic
1191594204 X:62923853-62923875 AAGGCTGCTGCAGATTGCTGGGG - Intergenic
1191651070 X:63537911-63537933 ACGTCTGCTGCAGTTTGCTGGGG - Intergenic
1191747549 X:64506487-64506509 AGGGCTGTTGAATTTTGTCGAGG - Intergenic
1191766486 X:64704502-64704524 AGGTCTGCTGCAATTTGCTGGGG + Intergenic
1191877313 X:65809781-65809803 AGAGCTGCTGCACTGTGCTGGGG - Intergenic
1192023775 X:67426627-67426649 AGGTCTGCTGGAATTTGCTGGGG + Intergenic
1192026445 X:67457322-67457344 AGGGCTGCTGGCATTTGCTGGGG - Intergenic
1192067707 X:67903882-67903904 AGGGCTGCTGCAGTATGCTGAGG + Intergenic
1192228560 X:69246784-69246806 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1192382924 X:70636367-70636389 AGGCCTGCTGCAGTAGGCCAAGG + Intronic
1192718534 X:73668601-73668623 AGGGCTGCTGCAGTTTGCTGGGG + Intronic
1192723312 X:73723370-73723392 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1192821976 X:74655914-74655936 AGGGCTGCCGTGGTTTGCTGGGG + Intergenic
1192920784 X:75703549-75703571 AGGGATGCTGTAGTTTGCTGTGG - Intergenic
1192944290 X:75949241-75949263 AGGGCTGCTGCAGCTTGCTGGGG + Intergenic
1192950236 X:76009126-76009148 AGGGCTGCTTCAGTTTGCTGGGG + Intergenic
1192953078 X:76038868-76038890 AGGTCTGCTGCAGTTTGCTAGGG + Intergenic
1192971390 X:76234529-76234551 AGGTCTGTTGAAGTTTGCTGGGG - Intergenic
1193005933 X:76618111-76618133 AGGGCTGCTGCAGCATGCTGGGG - Intergenic
1193039388 X:76988217-76988239 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1193048284 X:77076402-77076424 AGGGCTGCTGCAGTTGGCTGGGG + Intergenic
1193055417 X:77144275-77144297 AAATCTGCTGCAGTTTGCTGAGG - Intergenic
1193073468 X:77331934-77331956 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1193190252 X:78562980-78563002 AGGTCTGCTGCAGTTTGCTGTGG + Intergenic
1193258846 X:79380944-79380966 AGGGCTGCTGCAGTTTGCTAGGG - Intergenic
1193270866 X:79529680-79529702 AGGGCTTCTGCAGTTTGCTGGGG + Intergenic
1193281439 X:79655704-79655726 AGGGCTGTTGGAGTTTGCTGGGG + Intergenic
1193301418 X:79892670-79892692 AGGGGTGCTGTGGTTTGCTGGGG - Intergenic
1193478504 X:81996748-81996770 AGGGCTTCTGTAGTTTTCTGGGG - Intergenic
1193533537 X:82686085-82686107 AGGGCTGCTACAGTTTGCTGGGG + Intergenic
1193647556 X:84088378-84088400 AGAGCTGCTGTGGTTTGCTGGGG + Intronic
1193687260 X:84592336-84592358 TGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1193719408 X:84970921-84970943 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1193739709 X:85203067-85203089 AGGGCTGCTGCGGTATGCTTGGG + Intergenic
1193758698 X:85440043-85440065 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1193762768 X:85488495-85488517 AGGGCTGGTACAGTTTTCTGGGG + Intergenic
1193768445 X:85560687-85560709 AGGCCTGCTGCAGTTTGCTGGGG + Intergenic
1193780698 X:85698461-85698483 AGGGCTGCTGCAGTTAGCTGAGG + Intergenic
1193844734 X:86455031-86455053 AGGGCTGCTGTGGTTTGCTGGGG + Intronic
1193858910 X:86640082-86640104 AGGGCTGCTGCAGTATGCTTGGG - Intronic
1193909076 X:87280305-87280327 ATATCTGCTGCAGTTTGCTGAGG + Intergenic
1193933133 X:87581605-87581627 AGGGCTGCTGCAGTCCGCAGTGG - Intronic
1194021955 X:88702135-88702157 AGGGCTTCTGCAGTTTTCTGGGG + Intergenic
1194055621 X:89127972-89127994 TAGGCTGCTGCAGTATGCTGAGG + Intergenic
1194058103 X:89163261-89163283 AGAGCTGCTACAGTTTTCTGTGG + Intergenic
1194067767 X:89283829-89283851 TGGACTGCTGCAGTATGCTGGGG + Intergenic
1194110110 X:89823745-89823767 AGGGCTGCTGCTGGTTGATGTGG - Intergenic
1194133044 X:90105994-90106016 AGGGCTGCTGTGGTTTGCCAGGG + Intergenic
1194183198 X:90738139-90738161 AGGGCTGCTGTGGTTTGTTGGGG - Intergenic
1194193619 X:90865854-90865876 TGGGCTGCTGCAGTTTTCTGGGG - Intergenic
1194213104 X:91092803-91092825 AGGGCTGCTGCAGTATGCTTAGG + Intergenic
1194247899 X:91537847-91537869 AGGGCTGTTGCAGAATGCTGGGG - Intergenic
1194263902 X:91733056-91733078 AGGGCTTCTGCAGTTTGCTGGGG + Intergenic
1194281281 X:91957519-91957541 ATGGCTGCTGCAATTTGCTGGGG + Intronic
1194405800 X:93494344-93494366 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1194444870 X:93975429-93975451 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1194445981 X:93987273-93987295 AGGGCTGCTGCAGTTTGCCGGGG - Intergenic
1194489772 X:94531267-94531289 AGGGCTGTTGCAGTTTGTTGGGG - Intergenic
1194506321 X:94738443-94738465 AGGGCTGTTGTGGTTTGCTGGGG + Intergenic
1194523234 X:94943469-94943491 AGTGCTGTTGTAGTTTGCTGGGG - Intergenic
1194596810 X:95868495-95868517 AGGGCTGCTGAAGTTTGCTGTGG - Intergenic
1194623125 X:96197167-96197189 AGGACTGCTGTAGTTTGCTGGGG - Intergenic
1194631999 X:96296486-96296508 AGGGCTGCTGCAGTATGCTGGGG - Intergenic
1194643291 X:96428838-96428860 AGGTCTGCTGGAGTTTGCTGGGG + Intergenic
1194830527 X:98618426-98618448 AGGGATGCTGCAGTTTGTTGGGG + Intergenic
1194852063 X:98881675-98881697 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1194867545 X:99086794-99086816 AGGGCTGCTGTGGTATGCTGGGG - Intergenic
1194917633 X:99724052-99724074 GGGGAAGCTGCAGTTTGCAGAGG - Intergenic
1194948033 X:100091769-100091791 AGGGTTGCTACAGTATGCTGGGG - Intergenic
1194953303 X:100152552-100152574 AGAGCTGCTGCAGTTTGCTGGGG + Intergenic
1195104703 X:101593107-101593129 AGGGCTGCTGCAGTATGCTGGGG + Intergenic
1195147265 X:102029906-102029928 AGGGCTGCTGAGGTTTACTGGGG - Intergenic
1195148670 X:102043760-102043782 AGGGCTGCTACGGTATGCTGGGG - Intergenic
1195153522 X:102097946-102097968 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1195213016 X:102669110-102669132 AGGTCTGCTGCAGTTTGCTGGGG + Intergenic
1195235269 X:102890575-102890597 AGGGCTGCAGCTGTGTGCAGAGG + Intergenic
1195344851 X:103939921-103939943 AGGTCTGCTGCAGTTTGCTGGGG + Intronic
1195434594 X:104828394-104828416 AAGTCTGCTGGAGTTTGCTGGGG + Intronic
1195686269 X:107589355-107589377 ACGGCTGCTGCTATTTGCTGGGG + Intronic
1195803148 X:108734996-108735018 GGGGCTTCTGCAGGGTGCCGGGG + Exonic
1195812761 X:108852073-108852095 AGGGCTGCTGTGGTTTTCTGGGG - Intergenic
1195882247 X:109604261-109604283 AGGTCTGCTGGAGTTTGCTGGGG - Intergenic
1195979255 X:110560677-110560699 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1195983213 X:110601619-110601641 AGGGCTCCTGTTGTTTTCCGGGG - Intergenic
1196284413 X:113863332-113863354 AGGGCTCCTGCGCTTTGCTGGGG + Intergenic
1196517175 X:116628034-116628056 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1196559002 X:117123547-117123569 AGGTCTGCTGCAGTTTGCTGGGG - Intergenic
1196582298 X:117392425-117392447 AGGGTTGCTGCAGTATGCTGGGG - Intergenic
1196582328 X:117392587-117392609 AGGGTTGCTGCAGTATGCTGGGG - Intergenic
1196599991 X:117590338-117590360 AGGGCTGTTGCTGTTTGCTGGGG - Intergenic
1196601144 X:117603140-117603162 AGGGCTGCTGCAGTACACTGGGG - Intergenic
1196607253 X:117671254-117671276 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1196932598 X:120696286-120696308 AGGGCTGCTGCAGTATGCTTGGG - Intergenic
1197030011 X:121802445-121802467 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1197046379 X:122003603-122003625 AGGGCTCCTGCAGTTTTCTGGGG + Intergenic
1197049460 X:122041975-122041997 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1197051288 X:122061916-122061938 AGGTCTGCTGCAGTTTGCTTGGG - Intergenic
1197107451 X:122732610-122732632 AGGGCTGCTGCAATTTACTTGGG - Intergenic
1197124085 X:122924419-122924441 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1197302832 X:124802369-124802391 AGGGCTGCCGCAGTTTGCTGGGG + Intronic
1197350025 X:125372017-125372039 AGGTCTTCTGGAGTTTGCTGGGG + Intergenic
1197356816 X:125445346-125445368 AGGGCTGCTGTGGTTTGCTGGGG - Intergenic
1197403832 X:126026993-126027015 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1197413738 X:126150170-126150192 AGGGCTGCTACAGTTTGCTGGGG + Intergenic
1197428175 X:126323820-126323842 AGGGCTGCTGCATTTTGCTGGGG - Intergenic
1197489632 X:127101243-127101265 AGAGCCGCTGCTGTTTGCTGGGG - Intergenic
1197570841 X:128148490-128148512 AAGGATGCTGCAGTTTGCTGGGG - Intergenic
1197602043 X:128542891-128542913 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1197606995 X:128596938-128596960 AGGGCTGCTGCAGTTTGCTGGGG + Intergenic
1198687184 X:139238741-139238763 AGGGCTGCTGCAGTTTGCTAGGG - Intergenic
1198705519 X:139444004-139444026 AGGGCTGCTGTGGTTTGCTTGGG - Intergenic
1198786270 X:140291958-140291980 AGTGCTGCTTCAGTTTTCTGGGG + Intergenic
1199478811 X:148274651-148274673 AGTGCTGCTGCCATTTGCTGGGG - Intergenic
1199524807 X:148781014-148781036 AGATCTGCTGGAGTTTGCTGGGG + Intronic
1199564350 X:149198933-149198955 AGATCGGCTGCAGTTTGCTGGGG + Intergenic
1199567314 X:149229685-149229707 AGGGCTGCTGTGGTTTGCTGGGG + Intergenic
1199589183 X:149450794-149450816 AGGGCTGCTGTAGTTTGCTGGGG + Intergenic
1199637027 X:149824068-149824090 AGGTCTGTTGGAGTTTGCCTAGG + Intergenic
1199950885 X:152705124-152705146 AGTTCTGATGCAGTTTGCCAGGG - Intergenic
1199958797 X:152763337-152763359 AGTTCTGATGCAGTTTGCCAGGG + Intergenic
1199996539 X:153029960-153029982 AGGCCTGCTGCAGATGGCCCTGG + Intergenic
1200034650 X:153319567-153319589 AGGCCTGCTGCAGAAGGCCGTGG - Intergenic
1200120547 X:153788190-153788212 AGGGCAGCTGAAGGCTGCCGGGG + Intronic
1200163422 X:154020274-154020296 AAGGCTGCTGCCGTGTGCAGGGG - Intergenic
1200321648 X:155196334-155196356 AGGGCTGCTGCAGTTTGCTTGGG + Intergenic
1200344726 X:155436477-155436499 AGGGCTGCTGCTATTTGCTGGGG - Intergenic
1200372292 X:155739699-155739721 AGGACTGCTGCAGTTTGCTGGGG - Intergenic
1200462769 Y:3478486-3478508 AGGGCTGCTGCTGGTTGATGTGG - Intergenic
1200478832 Y:3676069-3676091 AGGGCTGCTGTGGTTTGCCAGGG + Intergenic
1200497640 Y:3903700-3903722 AAGGCTGCTGCAGTATGCTTGGG - Intergenic
1200529813 Y:4320094-4320116 AGGGCTGCTGTGGTTTGTTGGGG - Intergenic
1200540231 Y:4448236-4448258 TGGGCTGCTGCAGTTTTCTGGGG - Intergenic
1200566915 Y:4779376-4779398 AGGGCTGTTGCAGAATGCTGGGG - Intergenic
1200598871 Y:5182175-5182197 ATGGCTGCTGCAGTTTGCTGGGG + Intronic
1200721914 Y:6617990-6618012 TGGACTGCTGCAGTATGCTGGGG + Intergenic
1200741927 Y:6863699-6863721 AGGGCTGCTGTGATTTGCTGGGG + Intergenic
1200818328 Y:7555921-7555943 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic
1201756779 Y:17494647-17494669 AGGGCTGCTGTGGTTTTCAGGGG - Intergenic
1201844774 Y:18411337-18411359 AGGGCTGCTGTGGTTTTCAGGGG + Intergenic
1201936046 Y:19411923-19411945 AGGGCTGCTGCAGTTTGCTGGGG - Intergenic