ID: 1124928730

View in Genome Browser
Species Human (GRCh38)
Location 15:34098184-34098206
Sequence GACTGGCTGTGTTAAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124928719_1124928730 8 Left 1124928719 15:34098153-34098175 CCCCCAGACCTCTCACTGACAGG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1124928730 15:34098184-34098206 GACTGGCTGTGTTAAGGGACTGG 0: 1
1: 0
2: 0
3: 13
4: 149
1124928724_1124928730 0 Left 1124928724 15:34098161-34098183 CCTCTCACTGACAGGCCACCTCT 0: 1
1: 0
2: 1
3: 16
4: 243
Right 1124928730 15:34098184-34098206 GACTGGCTGTGTTAAGGGACTGG 0: 1
1: 0
2: 0
3: 13
4: 149
1124928723_1124928730 5 Left 1124928723 15:34098156-34098178 CCAGACCTCTCACTGACAGGCCA 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1124928730 15:34098184-34098206 GACTGGCTGTGTTAAGGGACTGG 0: 1
1: 0
2: 0
3: 13
4: 149
1124928718_1124928730 9 Left 1124928718 15:34098152-34098174 CCCCCCAGACCTCTCACTGACAG 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1124928730 15:34098184-34098206 GACTGGCTGTGTTAAGGGACTGG 0: 1
1: 0
2: 0
3: 13
4: 149
1124928722_1124928730 6 Left 1124928722 15:34098155-34098177 CCCAGACCTCTCACTGACAGGCC 0: 1
1: 0
2: 0
3: 16
4: 184
Right 1124928730 15:34098184-34098206 GACTGGCTGTGTTAAGGGACTGG 0: 1
1: 0
2: 0
3: 13
4: 149
1124928721_1124928730 7 Left 1124928721 15:34098154-34098176 CCCCAGACCTCTCACTGACAGGC 0: 1
1: 0
2: 0
3: 14
4: 216
Right 1124928730 15:34098184-34098206 GACTGGCTGTGTTAAGGGACTGG 0: 1
1: 0
2: 0
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124928730 Original CRISPR GACTGGCTGTGTTAAGGGAC TGG Intronic