ID: 1124931189

View in Genome Browser
Species Human (GRCh38)
Location 15:34121299-34121321
Sequence CTGGGGAAACTTTCGGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124931189_1124931197 19 Left 1124931189 15:34121299-34121321 CCAATATCCGAAAGTTTCCCCAG No data
Right 1124931197 15:34121341-34121363 CTTTTTTTTTTTTTTAGACAGGG 0: 59
1: 1839
2: 28342
3: 132092
4: 128276
1124931189_1124931196 18 Left 1124931189 15:34121299-34121321 CCAATATCCGAAAGTTTCCCCAG No data
Right 1124931196 15:34121340-34121362 CCTTTTTTTTTTTTTTAGACAGG 0: 16
1: 306
2: 3530
3: 23084
4: 39730

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124931189 Original CRISPR CTGGGGAAACTTTCGGATAT TGG (reversed) Intergenic
No off target data available for this crispr