ID: 1124932039

View in Genome Browser
Species Human (GRCh38)
Location 15:34129971-34129993
Sequence TATTAGGCTCAGCAGTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124932039_1124932045 7 Left 1124932039 15:34129971-34129993 CCCCTCCACTGCTGAGCCTAATA No data
Right 1124932045 15:34130001-34130023 ATGAAGTTGGAAACTGCTTAAGG No data
1124932039_1124932046 8 Left 1124932039 15:34129971-34129993 CCCCTCCACTGCTGAGCCTAATA No data
Right 1124932046 15:34130002-34130024 TGAAGTTGGAAACTGCTTAAGGG No data
1124932039_1124932044 -6 Left 1124932039 15:34129971-34129993 CCCCTCCACTGCTGAGCCTAATA No data
Right 1124932044 15:34129988-34130010 CTAATACATTACAATGAAGTTGG No data
1124932039_1124932047 14 Left 1124932039 15:34129971-34129993 CCCCTCCACTGCTGAGCCTAATA No data
Right 1124932047 15:34130008-34130030 TGGAAACTGCTTAAGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124932039 Original CRISPR TATTAGGCTCAGCAGTGGAG GGG (reversed) Intergenic
No off target data available for this crispr