ID: 1124940535

View in Genome Browser
Species Human (GRCh38)
Location 15:34213516-34213538
Sequence CTTCCTTTGCAGGCTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124940525_1124940535 5 Left 1124940525 15:34213488-34213510 CCCTTTTTTCTGCTCCTCCCTTC No data
Right 1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG No data
1124940527_1124940535 -9 Left 1124940527 15:34213502-34213524 CCTCCCTTCCCTACCTTCCTTTG No data
Right 1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG No data
1124940526_1124940535 4 Left 1124940526 15:34213489-34213511 CCTTTTTTCTGCTCCTCCCTTCC No data
Right 1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124940535 Original CRISPR CTTCCTTTGCAGGCTGTGGA AGG Intergenic
No off target data available for this crispr