ID: 1124947202

View in Genome Browser
Species Human (GRCh38)
Location 15:34280016-34280038
Sequence AGACAGAGTGAAATGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 7, 3: 38, 4: 353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124947197_1124947202 1 Left 1124947197 15:34279992-34280014 CCTGCCATGCACCTGGGAGAATG 0: 1
1: 0
2: 0
3: 13
4: 186
Right 1124947202 15:34280016-34280038 AGACAGAGTGAAATGATTGTGGG 0: 1
1: 0
2: 7
3: 38
4: 353
1124947199_1124947202 -3 Left 1124947199 15:34279996-34280018 CCATGCACCTGGGAGAATGGAGA 0: 1
1: 0
2: 1
3: 17
4: 297
Right 1124947202 15:34280016-34280038 AGACAGAGTGAAATGATTGTGGG 0: 1
1: 0
2: 7
3: 38
4: 353
1124947200_1124947202 -10 Left 1124947200 15:34280003-34280025 CCTGGGAGAATGGAGACAGAGTG 0: 1
1: 0
2: 11
3: 40
4: 335
Right 1124947202 15:34280016-34280038 AGACAGAGTGAAATGATTGTGGG 0: 1
1: 0
2: 7
3: 38
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124947202 Original CRISPR AGACAGAGTGAAATGATTGT GGG Intronic
900824001 1:4911791-4911813 AGACAGAGTGAGATGGTAGCTGG - Intergenic
901093226 1:6657511-6657533 AGACAGTATGGAATTATTGTTGG + Intronic
903614075 1:24639342-24639364 AGACAGAGTGAGGGGATTGAGGG + Intronic
905981333 1:42231437-42231459 ACAAAGAGTAAAATGATGGTTGG + Intronic
906362015 1:45169191-45169213 ATACATAGGGAAATGAATGTGGG - Intronic
906634471 1:47399479-47399501 AGGAAGAGGGAAATGATTGTTGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907553118 1:55320948-55320970 GGACAGAGTGAATTTATTGGGGG + Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909883799 1:80914372-80914394 AGAAAGAGTTTAATGATTGCAGG - Intergenic
910021662 1:82597776-82597798 AGACATGTGGAAATGATTGTAGG - Intergenic
911532566 1:99062944-99062966 AGACAGAGAGAAAGAAATGTTGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
912258019 1:108080893-108080915 AGACAGAGTGAAGTGAGTTGAGG - Intergenic
913157641 1:116115685-116115707 AGTCAGAGTGATATTATTATAGG + Intronic
914938754 1:152003673-152003695 AGACACAGTGAAATCATAGAGGG + Intergenic
914959558 1:152194434-152194456 AGAAAGAGTGAAATGACTTAAGG - Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916133099 1:161629016-161629038 AGACAGAAAGATATGATTCTAGG + Intronic
916443386 1:164849304-164849326 AGACTAAGTGAAATGCTGGTTGG - Exonic
918545729 1:185681469-185681491 AGACAAAAGGAAAAGATTGTTGG + Intergenic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919886520 1:201938936-201938958 AGACAGAGTGAAAGGAGATTAGG - Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921959651 1:221021524-221021546 AGACAGAGGGGAATGATGGTGGG + Intergenic
922420540 1:225458259-225458281 AGACAGATAGTAATGAGTGTGGG + Intergenic
922530766 1:226343152-226343174 GGAAGGAGAGAAATGATTGTTGG + Intergenic
923001829 1:230012571-230012593 AGAAAGAGTTGAATAATTGTAGG + Intergenic
923162428 1:231327294-231327316 AGACAGAGTGAAAAGAACATGGG + Intergenic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1063276053 10:4569004-4569026 AGACAGAGTTTAAGGATTGCAGG + Intergenic
1063802833 10:9600700-9600722 AGACAGAGAGAAATTATTCATGG + Intergenic
1063917439 10:10897788-10897810 AGACAGAATGAAATGAAAGAAGG + Intergenic
1064870319 10:19929828-19929850 GGACAGTGTGAAATGAATGTGGG - Intronic
1064984650 10:21198005-21198027 AGACAGAGTTTCATGATTGCAGG - Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065118317 10:22503754-22503776 AGACAGAGTGAAAGGTTTTGTGG + Intergenic
1065225089 10:23535450-23535472 AGAGAGAGTTAAATGCTGGTGGG - Intergenic
1065394707 10:25222221-25222243 AGAAACAGTGAAAAGATAGTTGG - Intronic
1068832228 10:61508475-61508497 AGACAGAGTTTCATCATTGTTGG - Intergenic
1069283689 10:66687545-66687567 AGACATAGTAAAATAATTGTAGG + Intronic
1070459347 10:76649136-76649158 AAACAGTGTGTAATAATTGTGGG + Intergenic
1071944521 10:90627652-90627674 AGACAGATTGAAAACAATGTGGG + Intergenic
1074164605 10:110864010-110864032 AGACAGAGTCCAGTGATGGTGGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076117823 10:127912905-127912927 AGACAGAGTAAAATCATGGCAGG - Intronic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079760146 11:24319148-24319170 AGAGAGAGTGCAAGGATTGTGGG - Intergenic
1080603851 11:33847514-33847536 AGAGAGAGAGAAAAGATAGTTGG - Intergenic
1080912961 11:36623779-36623801 AGAAACAGCGAAATGATTGGAGG - Intronic
1082168726 11:48975739-48975761 AGACAGAATGACATGATAGATGG - Intergenic
1083392959 11:62368474-62368496 AGATACTGTGAAATGATTGAAGG + Intronic
1084207257 11:67602887-67602909 AGAAAGAGTTTAATGATTGCAGG + Exonic
1084519805 11:69656278-69656300 AGACAGAGAGAATGGGTTGTGGG - Intronic
1084921199 11:72471445-72471467 AGAGATAGAGAAATGATTGAGGG - Intergenic
1086901849 11:92376379-92376401 AGACAGAGGGAAATAACAGTGGG + Intronic
1087874549 11:103339967-103339989 AGCAAGAGTGAAGTGAGTGTGGG - Intronic
1088074785 11:105833941-105833963 AGGCATAGTAAAATGATTGTAGG - Intronic
1088175660 11:107050428-107050450 AGAAAGAGTGTAATCATTGCAGG - Intergenic
1088397454 11:109384152-109384174 AGACATAATGAAATGAATTTTGG - Intergenic
1089503584 11:118947904-118947926 AGACAGACTGCAGTGATTTTAGG - Intronic
1090961500 11:131561479-131561501 AGACAGAGTGAAAGGATAGTGGG + Intronic
1091877718 12:3950356-3950378 AGACTGGCTGAAATGTTTGTGGG - Intergenic
1092184676 12:6470282-6470304 GGAGAGGGTGCAATGATTGTGGG + Intronic
1095638974 12:44465411-44465433 AGCCAGAGTGAAATGATAAAGGG + Intergenic
1096640126 12:52987763-52987785 AGAAAGAAAGAAATGTTTGTAGG + Intergenic
1097124015 12:56758912-56758934 AGAAAGAGTTTAATGATTGCAGG + Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099650971 12:85427928-85427950 AGACAGAAGGAAAAGAATGTAGG - Intergenic
1099751893 12:86784886-86784908 AGAGAAAGGGAAATGATTGTAGG + Intronic
1101875210 12:108592895-108592917 AGAGAGGGAGAAATGATAGTAGG + Intronic
1102266514 12:111490810-111490832 AGAGAGAGAGAAATGACTGTGGG + Intronic
1103269785 12:119663745-119663767 AGACAGACTCAAATGTGTGTGGG - Intergenic
1103304877 12:119956079-119956101 AGAAAGAGTGTAATGGTTGCAGG - Intergenic
1104889099 12:132131480-132131502 CGACAAAGTGCAGTGATTGTCGG - Intronic
1107609502 13:42099009-42099031 AGAGAGAGAGAAATCAGTGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109496949 13:63184712-63184734 AAACAAAGTGAAATAATGGTGGG + Intergenic
1109889832 13:68596666-68596688 AGACAAAGTTAAAGCATTGTGGG - Intergenic
1109940103 13:69350587-69350609 TGTCTGAGTGAAATGATTGCTGG + Intergenic
1110404577 13:75135550-75135572 AGAAAGAGTTTAATGATTGCGGG + Intergenic
1110569495 13:76989524-76989546 AGATAGAGTGATAGGATTCTGGG - Intergenic
1110896545 13:80759981-80760003 AGAAAGAGTTAAATGGTTGGAGG - Intergenic
1111231665 13:85352438-85352460 AGAAAGAGTGAAAGGAATGAAGG - Intergenic
1111355515 13:87095970-87095992 AGAAAGAGTTTAATGATTGCAGG - Intergenic
1112452699 13:99526472-99526494 AGAGACAGTGAAAAGACTGTAGG + Intronic
1112761616 13:102698750-102698772 AGAAAGAGTTTAATGATTGCAGG - Intergenic
1114316250 14:21512413-21512435 AGAAAGAAAGAAAGGATTGTAGG - Intergenic
1114542197 14:23469441-23469463 AGACTGAGTAAAATGATTGACGG - Intergenic
1114994289 14:28328467-28328489 AGAGAGAGTGAAGTGATCCTGGG - Intergenic
1115113091 14:29847883-29847905 AGAGAGAGTGAAAGGTTGGTGGG - Intronic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1117795546 14:59389370-59389392 AGAAAGAGTGCAGTGGTTGTGGG - Intergenic
1119636564 14:76278112-76278134 AGAGGGAAGGAAATGATTGTAGG + Intergenic
1121153439 14:91660090-91660112 AGAGAGAGAGAGATGAATGTAGG - Intronic
1121836512 14:97097272-97097294 AGAAAGAGTGCAATGAGTATCGG - Intergenic
1124005207 15:25790198-25790220 AGGCAGTGAGAAATGATAGTTGG + Intronic
1124035165 15:26048009-26048031 AGACAAAGTAAAATGATTTTTGG + Intergenic
1124503337 15:30250033-30250055 AGAGAGAGAGAAATGAATGATGG + Intergenic
1124740218 15:32288606-32288628 AGAGAGAGAGAAATGAATGATGG - Intergenic
1124947202 15:34280016-34280038 AGACAGAGTGAAATGATTGTGGG + Intronic
1124988201 15:34644159-34644181 AGAAAGAGTTTAATGATTGCAGG + Intergenic
1125249666 15:37685595-37685617 AGACATAGAGATATGTTTGTTGG - Intergenic
1125582923 15:40799825-40799847 AGAGAGAGAGAAATAAATGTTGG - Intronic
1126022810 15:44419018-44419040 ACAAAAAGTGGAATGATTGTGGG - Intergenic
1126049233 15:44671833-44671855 AGATAGAGAGAAATGAGTTTGGG + Intronic
1127490090 15:59454122-59454144 AAACAGAGTGAAAGGATAGAGGG - Intronic
1127637120 15:60881631-60881653 AGACAGAGAGAAAAGAGAGTGGG + Intronic
1128267473 15:66279373-66279395 AGACAGATTGCAATGAGTGGAGG - Intergenic
1130395879 15:83500821-83500843 AGAAAGAGTCCAAGGATTGTGGG - Intronic
1133243884 16:4433619-4433641 AGATAGAGGGAAAAGAATGTGGG + Intronic
1133571494 16:7044946-7044968 AAACAGGGTGTAATGATTCTTGG - Intronic
1133675388 16:8066033-8066055 AGAAAGAGTTTAATGATGGTGGG - Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1136241527 16:28947570-28947592 AGAGAGAGTTTAATGATTGCAGG + Intergenic
1136380563 16:29892745-29892767 AGACAGAGAGAACTGTGTGTCGG - Intronic
1137759889 16:50932024-50932046 AGGCAGAGTTAGATGATTGGAGG + Intergenic
1137860294 16:51840137-51840159 TGCCAGAGTAAAATGATTGATGG - Intergenic
1139228955 16:65263421-65263443 ATACAGAGTTAAATTTTTGTTGG + Intergenic
1140329014 16:74034748-74034770 ACACAGAGGGAAATGATAATCGG - Intergenic
1140718719 16:77750919-77750941 AGGCAAAGGGAAATGATTGAGGG - Intergenic
1141780069 16:86153400-86153422 AGACAGAGGGAAGCCATTGTAGG + Intergenic
1143006672 17:3840681-3840703 AGACAATGTGAAGTGGTTGTAGG - Intronic
1143843067 17:9750133-9750155 AGTCAGAGGGAAATGAATGCTGG + Intergenic
1143860120 17:9883808-9883830 AGACTGAGAGAAATCATTATTGG + Intronic
1145193831 17:20869438-20869460 AGACGGAGGGAAATGTTTTTGGG + Intronic
1145298201 17:21611723-21611745 AGACGGAGGGAAATGTTTTTGGG - Intergenic
1145352054 17:22091664-22091686 AGACGGAGGGAAATGTTTTTGGG + Intergenic
1147232032 17:39026683-39026705 AGACCCAGTGAAGAGATTGTAGG + Intergenic
1148175373 17:45559748-45559770 AGAGAAAGAGAAATGCTTGTTGG + Intergenic
1149065608 17:52475854-52475876 AGACAGAGTTGAATGATTTCTGG - Intergenic
1151007728 17:70457451-70457473 AGACAGAGAGAATTCATTGTGGG + Intergenic
1151043746 17:70895146-70895168 AGACAAAGTGTAAATATTGTGGG + Intergenic
1151392990 17:73800451-73800473 AGAGAGGGTGAAATCATTCTGGG + Intergenic
1153909405 18:9693704-9693726 AGACAGACTGTAAAGTTTGTTGG + Intergenic
1155499437 18:26472145-26472167 AGACAGAGTGAGCTCATTTTTGG + Intronic
1155872415 18:31043951-31043973 AGCCAGAGTGAGATGAATGAAGG - Intergenic
1156689772 18:39693565-39693587 AGACACAATGAAATGAATTTGGG - Intergenic
1157942712 18:51946515-51946537 AGACAGTGGGATATGATAGTGGG + Intergenic
1158794271 18:60823753-60823775 ATACACAGTGATATGATTGCTGG - Intergenic
1158918350 18:62160135-62160157 AAACAGAGTAAAATGATAGGAGG + Intronic
1159607427 18:70489665-70489687 AGACAAAGAGAAATCATTCTGGG - Intergenic
1159647960 18:70942470-70942492 GGACAGAGCGGAGTGATTGTGGG + Intergenic
1161530128 19:4783769-4783791 ATACAGAGTGAAATAATAGGTGG + Intergenic
1163202106 19:15776952-15776974 AGACAGAGAGAATTTATTATGGG - Intergenic
1165334425 19:35159203-35159225 GGAAAGAATAAAATGATTGTAGG + Intronic
1166619094 19:44279697-44279719 ATACAGAGTGAAATGAGAGGAGG - Intronic
1168198231 19:54791506-54791528 AAACAGAGAGAACTGATGGTAGG - Intronic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
926856789 2:17265289-17265311 AGACAGAGAGAGATGATCTTAGG + Intergenic
927066984 2:19481491-19481513 GGACAGAAGGAAATGAATGTTGG + Intergenic
928715648 2:34056696-34056718 AGGAAGAGTGCCATGATTGTGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930924511 2:56800549-56800571 AGAAAGAGTGATAGGATTGGTGG + Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931178000 2:59872699-59872721 GGAAAGAGTGATATGGTTGTAGG + Intergenic
932080020 2:68705571-68705593 AAGCAGAGTGAAAAGATGGTGGG - Intronic
932268796 2:70390918-70390940 AGACAGAGTTCACTGACTGTGGG + Intergenic
932841314 2:75085368-75085390 AGAGAAAGAGAAATGATTGCAGG - Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933207277 2:79521642-79521664 AGGAAGAGGTAAATGATTGTTGG + Intronic
934039367 2:88115307-88115329 AGTCAGAGTGATGTGATTGCTGG - Intergenic
934489897 2:94755310-94755332 AGACAGAGAGACATGGTTGGTGG + Intergenic
935970645 2:108527817-108527839 AGACACAGTGAACTTAGTGTTGG - Intergenic
936910170 2:117582541-117582563 AGCCACAGTGAAATGATAATGGG - Intergenic
938251033 2:129815941-129815963 AGAAAGAGTGTAATGATTGCAGG + Intergenic
938872310 2:135492367-135492389 GGACAGAATGAAATAGTTGTTGG + Intronic
939547906 2:143576226-143576248 AGGCACAGTGAAATGCTGGTGGG - Intronic
940002828 2:148983920-148983942 TGACTGAGTGAATTGTTTGTTGG + Intronic
940913198 2:159226977-159226999 AGACAGAATTAAAAGATTATAGG + Intronic
941014112 2:160335111-160335133 AGAGAGAGAGAAATGATTCCTGG + Intronic
941735644 2:168972797-168972819 AGACAGAGTGAAAAGAGCATGGG + Intronic
941818822 2:169825134-169825156 AGACAGAGTGAAAGGGATGCGGG + Intergenic
941894500 2:170615513-170615535 AGACAGAGGGAAGTGAGTGAGGG + Intronic
942716079 2:178893777-178893799 AGAGAGAGAGAAATGTTTGGTGG - Intronic
943000268 2:182318875-182318897 AGACATATTGAAATCAATGTGGG - Intronic
943108526 2:183577169-183577191 AGAATGAGTGAAATGGTTGCAGG + Intergenic
943238205 2:185348964-185348986 AGATAGAGGGAAGGGATTGTTGG + Intergenic
943920604 2:193702370-193702392 GGACAGAGATAAATGAATGTAGG - Intergenic
944005278 2:194897097-194897119 AGAGAGAGTGCAACTATTGTGGG - Intergenic
944080639 2:195784285-195784307 GGAGACAGTGAAATGATTATTGG - Intronic
944331969 2:198479921-198479943 TGACAAAGTAAAATGATTGTTGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
947228843 2:227865591-227865613 AGAAAGGAAGAAATGATTGTAGG - Intergenic
947308873 2:228778368-228778390 AGACAGAATATAATGATTGCAGG - Intergenic
947873888 2:233455578-233455600 AGAGAGGGAGAAATGAGTGTGGG + Intronic
948326488 2:237126061-237126083 AGACCTTGTGAAATGTTTGTAGG - Intergenic
948734549 2:239993202-239993224 ACACAGTGTGAAATGTGTGTTGG - Intronic
1170051628 20:12152108-12152130 AGACACAATGAAGTGGTTGTGGG + Intergenic
1170818356 20:19734389-19734411 AGAGAGAGAGAAATGATTTTTGG + Intergenic
1170900329 20:20456406-20456428 AGACAGAGAGAAATGTCCGTTGG + Intronic
1171567207 20:26206303-26206325 AGAAAGAGTTTAATGATTGCAGG - Intergenic
1173108921 20:40166559-40166581 AAAAAGCCTGAAATGATTGTTGG - Intergenic
1174213816 20:48900707-48900729 GGACAGAATGTAATGATTCTGGG + Intergenic
1175135280 20:56818807-56818829 AGAATGAGTGAAATGAGTGGGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177849725 21:26332458-26332480 AGAGAGAGTGTAGTGATTCTGGG + Intergenic
1177904282 21:26956572-26956594 AGAGATAGTGAAATGATTGTGGG - Intronic
1178114889 21:29407093-29407115 AGAAAGAGTCTAATGATTGCAGG + Intronic
1179406463 21:41130376-41130398 ACACAGAATGAAATGATACTGGG + Intergenic
1181857214 22:25790749-25790771 AGACCTAGTGAAATGATACTGGG - Intronic
1182490956 22:30671493-30671515 AGAGAGAATGAAATGAATATGGG - Intergenic
1183128906 22:35813848-35813870 ACACAGAGTGAAACAAGTGTTGG + Intronic
950901600 3:16503109-16503131 AGACAGACTGAGATGGTGGTAGG - Intronic
951125961 3:18983384-18983406 AGGGAGAGAGACATGATTGTGGG - Intergenic
951836248 3:26986577-26986599 TGAGAGAGTCAAATGATTGCAGG - Intergenic
952187211 3:30982947-30982969 AGACAGAGGGAAGTCATTGAGGG + Intergenic
955118285 3:56028167-56028189 AGACAGTGTGATATTATTGAAGG - Intronic
955352766 3:58206244-58206266 AGATAGAGTGAAATTATGTTAGG - Intronic
956722709 3:72132789-72132811 GGCCAGAGTGACATAATTGTTGG - Intergenic
957111148 3:75960005-75960027 AGAAAGAGTTTAATGATTGCAGG + Intronic
957195643 3:77063529-77063551 AGAAAGAGTTACATGATTATGGG - Intronic
958261602 3:91387641-91387663 AGCCAGAGTGTAAAAATTGTAGG - Intergenic
960384534 3:117005919-117005941 AGCTAGAGTCACATGATTGTAGG - Intronic
960631894 3:119740808-119740830 TGACAGAGTGATGGGATTGTGGG - Intronic
961199453 3:125032718-125032740 AGACAGAGAGAAGTGATTGTAGG + Intronic
963432078 3:145220311-145220333 ACTGAGAGTGAAATGAGTGTTGG + Intergenic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
964911680 3:161790274-161790296 AGAAAGAGGGAATTGATAGTGGG - Intergenic
965004975 3:163009438-163009460 AGAAAGAGAGAAAAGATTCTGGG - Intergenic
966153120 3:176887520-176887542 AGACAGACAGAAATGAATGCTGG + Intergenic
966315289 3:178637878-178637900 AGAAATACTGAAATCATTGTGGG - Intronic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
970196219 4:13552781-13552803 AAACAGAGTGATATGATAGAGGG + Intergenic
970568314 4:17353998-17354020 AGGCAGAGTCAAATAATTCTGGG - Intergenic
971804208 4:31334366-31334388 AGAGAGAGAGAGATGATTTTGGG + Intergenic
972058821 4:34840263-34840285 AGAAAGAGAGAAATGAAGGTGGG - Intergenic
972844728 4:42974092-42974114 AGAAAGAGTTTAATGATTGCAGG + Intronic
973937006 4:55856277-55856299 AAACAGGGTGAAATAATTGTAGG + Intronic
975461553 4:74659409-74659431 AGAAAGAAAGAAAGGATTGTAGG + Intergenic
975723113 4:77267274-77267296 AGACATAGTGAACTCAATGTAGG - Intronic
975808823 4:78142642-78142664 AGGTAAAGTTAAATGATTGTTGG + Intronic
977627975 4:99209276-99209298 AGACAGAGAGAAATGGTTGTAGG - Intronic
978365099 4:107973133-107973155 AGAAAGAGTTTAATTATTGTGGG - Intergenic
979027364 4:115594690-115594712 TTATAGAGTGAAATGATTTTAGG - Intergenic
979678157 4:123432089-123432111 AGAAAAAGTGAAAATATTGTAGG + Intergenic
979931214 4:126633232-126633254 TGACAGAGTGAAATGATTTGGGG + Intergenic
979964212 4:127058102-127058124 AGACAAAGTGAATTTCTTGTAGG - Intergenic
980095390 4:128484715-128484737 ACACAGAGTGCAAAGATTGGTGG + Intergenic
980181668 4:129408645-129408667 ATACATAGTGAAATGATTGCTGG - Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
982741602 4:159062519-159062541 AGAAAGAGTGAATGGAATGTGGG - Intergenic
983007033 4:162495768-162495790 ATACATAGTGAAATGATTACTGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983844944 4:172506416-172506438 AGAAAGAGTTTAATGATCGTAGG - Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987882349 5:23765075-23765097 GGACAGAGAGAAAAGATTATTGG - Intergenic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
989229459 5:39069984-39070006 AGACATAAGGAAATGATTGCAGG - Intronic
989563180 5:42874369-42874391 AGACAGAGTGAAATCCTGATAGG - Intronic
989573025 5:42962786-42962808 AGAGAGAGAGAAATGTTTTTTGG + Intergenic
991101314 5:62796754-62796776 AGACAAAGTGTAATTATTGGAGG + Intergenic
991462419 5:66872910-66872932 AGACAGAATGAAATGAATACAGG - Intronic
991483012 5:67103597-67103619 AGAGAGAATGAAATGAAAGTTGG + Intronic
992390301 5:76325085-76325107 AGAAAGAGAGAAAAAATTGTAGG - Intronic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995829153 5:116334471-116334493 AGACATAGTGAAATGACAGTGGG - Intronic
997329162 5:133046700-133046722 AGAAAGAATGAAATGAATGGGGG - Intergenic
997739086 5:136238021-136238043 AGGCAGAGTGCAATGAGTGAAGG - Intronic
997887240 5:137641157-137641179 AGTGAGAGTGACATCATTGTGGG - Intronic
998682601 5:144486997-144487019 AGACAGACTGAAGTGATGGAGGG + Intergenic
999595647 5:153201372-153201394 AGACAGAGGGAAAAGATTTGAGG + Intergenic
1000988721 5:167889540-167889562 AGACAGAGTGAAAGGGGGGTGGG - Intronic
1002304644 5:178275954-178275976 AGAAAGAGTTTAATGATTGCAGG - Intronic
1004110747 6:12716308-12716330 AGACAGAGAGAAATGCATTTAGG + Intergenic
1004192892 6:13479822-13479844 GCACTGAGTGAAATGATTTTTGG - Intronic
1004239381 6:13905081-13905103 AGACAGCAAGAAGTGATTGTTGG - Intergenic
1004305042 6:14492890-14492912 AGAAAGAGTTTAATGATTGCAGG - Intergenic
1004425334 6:15503241-15503263 AGGCAGAGTGCAATGAGTGGAGG - Intronic
1004822909 6:19387517-19387539 AGACAGAGTGAACTGTTAATGGG - Intergenic
1005387234 6:25297448-25297470 AGAGAGAGTAAAATGATAGAGGG - Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1007204532 6:40138037-40138059 ATTCAGAATGAAATGATTTTAGG - Intergenic
1007840698 6:44713645-44713667 ATACATAGTGGTATGATTGTGGG + Intergenic
1008343692 6:50399449-50399471 AGACAGAGTGAGATTATTTTAGG - Intergenic
1008444120 6:51568847-51568869 AGAAAAAGGGAAATGAATGTTGG - Intergenic
1008993558 6:57632504-57632526 AGCCAGAGTGTAAAAATTGTAGG + Intronic
1009182164 6:60531590-60531612 AGCCAGAGTGTAAAAATTGTAGG + Intergenic
1009596293 6:65740826-65740848 AGGAAGAGTGAAATGATTGATGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1011147104 6:84229711-84229733 ATACAGAGAGAAATCATTGTAGG - Intergenic
1012737430 6:102967886-102967908 AAAGAGAGTGAATGGATTGTAGG - Intergenic
1013747720 6:113365738-113365760 AGACAATGGAAAATGATTGTAGG - Intergenic
1014135373 6:117883167-117883189 AGAAGGAGTGAAATGATTTATGG - Intergenic
1014149179 6:118034145-118034167 AGACAGAGTGTAAATATTTTAGG + Intronic
1014777999 6:125532990-125533012 AGACAGAGAGAAGTGATCCTAGG - Intergenic
1015265821 6:131291224-131291246 AGTGAGAGGGAAATGATGGTTGG + Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016182441 6:141163629-141163651 AGAAAGAGTTTAATGATTGCAGG - Intergenic
1019066301 6:169302206-169302228 AGAGAGAGTCAAATGAATGTGGG + Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1020655849 7:10927237-10927259 ACACAAAGTGAACTGAGTGTTGG - Intergenic
1021042905 7:15885384-15885406 AGATACAGTGAAATGAGAGTTGG - Intergenic
1022152944 7:27627461-27627483 AGAAAGAGTTTAATAATTGTAGG - Intronic
1022771315 7:33475792-33475814 AGAGCGAGAGGAATGATTGTTGG + Intronic
1023267118 7:38418354-38418376 AGACAGAGAGAAAGGATTCTAGG + Intronic
1023454022 7:40318965-40318987 ACACATAGTGAAATAATTGAGGG - Intronic
1024435355 7:49346839-49346861 AGACAGTGACAAATGATTATTGG + Intergenic
1024735301 7:52297744-52297766 AGACATAGAGAAAAGATTATGGG - Intergenic
1024782756 7:52870897-52870919 ATACAGAGTGATATGACTTTGGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026285989 7:68963262-68963284 AGAAAGAGTTTAATGATTGCAGG + Intergenic
1026524814 7:71144648-71144670 AGAAAGAGTTTAATGATTGCAGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027561303 7:79734222-79734244 ATAAAGAGTAAAATGGTTGTTGG + Intergenic
1028765617 7:94555363-94555385 AGACAGAATAAAATGGTTTTAGG + Intronic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029153275 7:98496852-98496874 AGAAAGAGTTTAATGATTGCAGG + Intergenic
1029175887 7:98664193-98664215 AGAGAGAGTTTAATGATTGCAGG - Intergenic
1029899962 7:104028809-104028831 AGACATAGTGTTATGAATGTTGG + Intergenic
1030288896 7:107853024-107853046 AAACACAGTGCAATGATTTTGGG - Intergenic
1030474195 7:110007753-110007775 AGACAGCTTGAAATTATTATTGG + Intergenic
1031300116 7:120054460-120054482 AGACAGAGTGAAGTTATCTTGGG + Intergenic
1031463757 7:122083063-122083085 AGAGAGAGGGAAATAATTCTAGG + Intronic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1032605793 7:133350461-133350483 ATACACAGTCAAATGATTTTTGG - Intronic
1032677789 7:134147565-134147587 AGAGAAAATGAAATGGTTGTGGG + Intronic
1033186182 7:139229307-139229329 TTACACAGAGAAATGATTGTCGG + Intergenic
1033413512 7:141142049-141142071 AGACAGGGTGGAATAATTATTGG - Intronic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1033933260 7:146550589-146550611 ACACAGGGGGAAATAATTGTTGG - Intronic
1034324479 7:150218251-150218273 TGAGAGACTGAAATGATTGGAGG - Intergenic
1034768715 7:153750980-153751002 TGAGAGACTGAAATGATTGGAGG + Intergenic
1035495437 7:159321321-159321343 AGACAGACTGAAGTGTTTGAAGG - Intergenic
1035834121 8:2729778-2729800 AGAAATAGTGAAATCATTGATGG - Intergenic
1037856218 8:22372472-22372494 AGACAGGGTGATATGTGTGTTGG - Intronic
1038286884 8:26213185-26213207 AAACAAAGTGAAATGAGTTTGGG - Intergenic
1038619857 8:29131747-29131769 AGAAACAGTGAAATGAATTTTGG - Intronic
1039461422 8:37748699-37748721 AGACAGAGTGAAATCAGGCTGGG - Intronic
1040938001 8:52800937-52800959 AGAAAGAGTTTAATGATTGCAGG - Intergenic
1040945422 8:52880272-52880294 AGAAAGAGTTTAATGATTGCAGG + Intergenic
1041415890 8:57608739-57608761 AGACAGAGTGCAATGACTGGGGG + Intergenic
1041754410 8:61298108-61298130 AGATAGATTGCAATGAGTGTAGG + Intronic
1042394369 8:68275173-68275195 AGACAGAGTGATATTGTTGAAGG - Intergenic
1043042958 8:75284823-75284845 AGGCAGAGTGAAATTACTGGGGG - Intergenic
1043819704 8:84847288-84847310 AGGCTGAGTGAAGTGACTGTGGG - Intronic
1043865858 8:85374985-85375007 AGTCAGAGTAAAATGATAATGGG + Intronic
1044235521 8:89825792-89825814 AAATAGACTCAAATGATTGTGGG - Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045411564 8:101925852-101925874 AGACAGGAGGAAATGATGGTGGG + Intronic
1045856576 8:106771318-106771340 AGAAAGAAAGAAATTATTGTTGG + Intergenic
1045982083 8:108201596-108201618 AGACAAAGTGAAAAAATTGAGGG + Intronic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1047031985 8:120891906-120891928 AGGGAAAGTGAAATGGTTGTGGG - Intergenic
1047428496 8:124768345-124768367 ACACAAAGTGATATGATAGTTGG + Intergenic
1047653535 8:126950358-126950380 AGAAAGAATGTTATGATTGTAGG + Intergenic
1047676954 8:127212784-127212806 AGACAGGGTGAACTGTGTGTTGG - Intergenic
1048167733 8:132078299-132078321 TGACATAGTGAAAAGATTGTGGG + Intronic
1048893803 8:138970792-138970814 AGACAGAGTTCAATGATTTCAGG + Intergenic
1049909166 9:248932-248954 TGACAGAGTGAAGTGAGTGAGGG + Intronic
1050019688 9:1270022-1270044 AGACAGAGAGAAAGAAATGTGGG - Intergenic
1051483957 9:17588268-17588290 AGACAGAATGCTACGATTGTTGG + Intronic
1053224544 9:36341875-36341897 TGCCAGAGTGAAATTATTGCAGG - Intronic
1053307231 9:36993650-36993672 AGCCAGAGAGAAAGGACTGTGGG + Intronic
1054748193 9:68877173-68877195 GGTCAAGGTGAAATGATTGTGGG - Intronic
1055612252 9:78034782-78034804 GGACAGGGTGATATGATTGTGGG - Intergenic
1056113226 9:83416726-83416748 AGACAGAGAGAAATGTTTTAGGG - Intronic
1056415235 9:86369054-86369076 AGAAAGAGTTTAATGATTGCAGG + Intergenic
1056496805 9:87163936-87163958 ACATAGAGTGAAGAGATTGTTGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1058445797 9:105053802-105053824 AGAAAGAGTTCAATGATTGCAGG - Intergenic
1059246325 9:112852701-112852723 AGACAGAGTGATGTAATGGTAGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1060439928 9:123628751-123628773 AGACACAGTGAAAAAAATGTGGG + Intronic
1185489008 X:506435-506457 AGAGAGAGTGAAATATGTGTGGG - Intergenic
1185749652 X:2600623-2600645 GGACAGAGAGAAGTGATGGTAGG + Intergenic
1185777250 X:2813262-2813284 AGACAGAGTGAGCTGATGTTAGG + Intronic
1187693909 X:21899175-21899197 AGAGAGAGAGAAATGACTTTTGG - Intergenic
1187886824 X:23896610-23896632 AAACAGATCGAAATGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188933301 X:36142069-36142091 AGAAAGGGGAAAATGATTGTTGG + Intronic
1192069528 X:67922544-67922566 AGAGAGAGTGTAGTGGTTGTGGG + Intergenic
1192559281 X:72115021-72115043 AGACAGGGTGGAATTATTATTGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192882651 X:75303283-75303305 AGACAGAGAGCAATGATCTTTGG - Intronic
1193431813 X:81416475-81416497 AGACTGAGTGAAATGAATTAAGG + Intergenic
1193440952 X:81538647-81538669 AGAGAAAATGAAGTGATTGTGGG + Intergenic
1194126180 X:90020055-90020077 GAACACAGTGAAATGATGGTGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195322769 X:103733576-103733598 AGATAAAGTGAAAAGATTGAAGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196323704 X:114375315-114375337 AGACAGACAGAAATGAGTGCTGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1198999215 X:142613604-142613626 AGACAGAGTGCACAAATTGTTGG + Intergenic
1199155502 X:144542522-144542544 AGAAAGAAAGAAATGAGTGTGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1201292771 Y:12438200-12438222 AGACAGAGTGAGCTGATGTTAGG - Intergenic