ID: 1124949269

View in Genome Browser
Species Human (GRCh38)
Location 15:34301510-34301532
Sequence CTAGACTTGTTGGGAAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124949269_1124949275 29 Left 1124949269 15:34301510-34301532 CCAATTTTTCCCAACAAGTCTAG 0: 1
1: 0
2: 1
3: 16
4: 153
Right 1124949275 15:34301562-34301584 GTAGAAAGTAGTGAAAATGTAGG 0: 1
1: 0
2: 3
3: 14
4: 303
1124949269_1124949274 7 Left 1124949269 15:34301510-34301532 CCAATTTTTCCCAACAAGTCTAG 0: 1
1: 0
2: 1
3: 16
4: 153
Right 1124949274 15:34301540-34301562 AAGGAAGAAAATGGTAATTAAGG 0: 1
1: 0
2: 2
3: 86
4: 727
1124949269_1124949273 -2 Left 1124949269 15:34301510-34301532 CCAATTTTTCCCAACAAGTCTAG 0: 1
1: 0
2: 1
3: 16
4: 153
Right 1124949273 15:34301531-34301553 AGATACTAGAAGGAAGAAAATGG 0: 1
1: 0
2: 8
3: 99
4: 931
1124949269_1124949276 30 Left 1124949269 15:34301510-34301532 CCAATTTTTCCCAACAAGTCTAG 0: 1
1: 0
2: 1
3: 16
4: 153
Right 1124949276 15:34301563-34301585 TAGAAAGTAGTGAAAATGTAGGG 0: 1
1: 0
2: 5
3: 29
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124949269 Original CRISPR CTAGACTTGTTGGGAAAAAT TGG (reversed) Intronic
901939880 1:12653838-12653860 CTAAACTTCCTGGGAAAAAGAGG - Intronic
904980831 1:34499939-34499961 ATAAACTTGTTGAGACAAATAGG + Intergenic
905005068 1:34703033-34703055 CTAGTCTTCTTGGGAGAAATTGG + Intergenic
905370919 1:37482336-37482358 CAAGCCTTGCTGGGAAGAATAGG - Intronic
905486074 1:38297857-38297879 CTTGTCTTGCTGGGACAAATGGG - Intergenic
907196368 1:52690432-52690454 ATAGAAGTGTTTGGAAAAATTGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
909592110 1:77362041-77362063 ATAGAGTTGTTGAGAAGAATGGG + Intronic
912247800 1:107978917-107978939 CTGGACTTGGTGGGGAAAAGAGG + Intergenic
912681995 1:111734763-111734785 CTAGACTTTGAGGGATAAATAGG - Intronic
916515383 1:165511986-165512008 CCCGACTTGTTGCGAAAAAGTGG + Intergenic
917063662 1:171068030-171068052 CTAAGATTGTTGGGAAGAATAGG - Intergenic
917237409 1:172909330-172909352 CCAGACTTTTTGGGCAGAATAGG + Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917710666 1:177680908-177680930 GTAGGCTTGTTGGGCAAGATGGG - Intergenic
918227816 1:182502115-182502137 CTAGACTTATCGAGAAAAAAAGG - Intronic
920826253 1:209426580-209426602 CTAAATTTGTTCAGAAAAATGGG - Intergenic
921546858 1:216483598-216483620 CTAAACTTCCTGGGAAAAAGAGG + Intergenic
1065532306 10:26684542-26684564 CTAGAATAGTTGGTTAAAATGGG - Intergenic
1073585351 10:104704664-104704686 CTAGAGTACTAGGGAAAAATTGG - Intronic
1076255439 10:129020622-129020644 CTAGCCTAGTATGGAAAAATGGG + Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1079439792 11:20499891-20499913 CTACATTTGGCGGGAAAAATTGG - Intronic
1080603196 11:33841175-33841197 CAAGTCTTCATGGGAAAAATAGG + Intergenic
1081881987 11:46461258-46461280 ATAAACTTGTTGAGACAAATGGG + Intronic
1083104085 11:60340823-60340845 ATTGACTTCTTGGGAAAAAACGG + Exonic
1088141748 11:106625249-106625271 CTTGACTTGTTTGGAAAATGTGG - Intergenic
1089268878 11:117287598-117287620 CTACCCATGTTGGGAAAAACTGG - Exonic
1091646106 12:2273634-2273656 CTAGACTTCTTGGGGTAACTTGG + Intronic
1095852591 12:46827103-46827125 TTAGATTTATTGGGAACAATAGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097818381 12:64100613-64100635 CAAGACTTATGGGGAAAAATAGG - Intronic
1101832190 12:108267401-108267423 CTAGAGTTGTTGGGATTAAGTGG - Intergenic
1102719505 12:115003834-115003856 TTAGACTTGTTGGGTAAACAGGG - Intergenic
1103051462 12:117783548-117783570 CCAGAATTTTTGGGAAAGATAGG - Intronic
1104627325 12:130368581-130368603 CTAGCCTATTGGGGAAAAATTGG + Intronic
1105043525 12:132982163-132982185 CCAGACTTTTTGGTAAAAATTGG - Intergenic
1106785912 13:33108089-33108111 AGAGATTTGTTGGGATAAATGGG + Intronic
1107034655 13:35888123-35888145 CTAGACTTTTTGGCAAAAGTGGG - Intronic
1108823877 13:54388184-54388206 CTAATCTTGTGGGGAAAAAAAGG - Intergenic
1110482912 13:76002651-76002673 CTAGAATTGTTTGTATAAATTGG + Intergenic
1112707812 13:102091717-102091739 CCAGAATTGTGGGGAAAAAAAGG - Intronic
1112891235 13:104234409-104234431 ATAGACATGTTAGGAAATATAGG + Intergenic
1114783629 14:25569574-25569596 CTAGGTTTGTTTGCAAAAATGGG - Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1117778842 14:59210811-59210833 CTAAACTTGTTTGGAAAATAAGG + Intronic
1117862113 14:60103270-60103292 CTAGATATCATGGGAAAAATGGG + Intronic
1121853744 14:97247524-97247546 CTAGATTGGATGGGGAAAATAGG - Intergenic
1124949269 15:34301510-34301532 CTAGACTTGTTGGGAAAAATTGG - Intronic
1129760230 15:78124981-78125003 ACAGACTTGTTGGGCCAAATGGG - Intronic
1130082310 15:80744674-80744696 AGTGACTTGTTGGGAAAAAAGGG - Intronic
1130717858 15:86353764-86353786 CCAGACTTTTAGGGAAGAATGGG + Intronic
1131333999 15:91530006-91530028 ATAGTATTGTTGGGAAAAACAGG - Intergenic
1141700227 16:85638959-85638981 CTTGACTTTCTGGGAGAAATGGG + Intronic
1149207741 17:54267931-54267953 CCAGACTTGATGGGAACATTCGG - Intergenic
1150012565 17:61519121-61519143 CTAGACTTTGTAGGGAAAATAGG - Intergenic
1150057852 17:62035703-62035725 GTAGAATTTTTGGGCAAAATAGG - Intronic
1153205987 18:2701590-2701612 CTAGTCTTGAGGGTAAAAATGGG + Intronic
1153630849 18:7068243-7068265 CTGGTCTGGTGGGGAAAAATAGG - Intronic
1155376353 18:25162209-25162231 TTAGAATTGATGGGAAAAAAAGG + Intronic
1155576756 18:27256022-27256044 CTAGAGGAGTTGGGAAGAATGGG - Intergenic
1157373221 18:47137822-47137844 CTTGACTTGAAGGGAAAAATAGG - Intronic
1158257214 18:55565127-55565149 CTAAAGTTGCTGGGAAGAATGGG + Intronic
1159029495 18:63216572-63216594 AAAGACTTGATGGTAAAAATAGG - Intronic
1159142986 18:64419677-64419699 CTATAATTGTTGAGAAATATTGG + Intergenic
1160310893 18:77789139-77789161 CTAGAGTTGTTTATAAAAATGGG - Intergenic
1160482062 18:79250593-79250615 CTTGAATTATTGAGAAAAATAGG - Intronic
926694234 2:15759924-15759946 CTAGACTTTTTTGTAAAGATGGG + Intergenic
926734971 2:16066570-16066592 AAAGACTAATTGGGAAAAATGGG + Intergenic
929472885 2:42214056-42214078 ATTGACATGTTAGGAAAAATTGG - Intronic
930950102 2:57130782-57130804 GTAGACCTGTAGAGAAAAATAGG - Intergenic
931235904 2:60412523-60412545 ATAGATTTATTGGGAAAAAAAGG - Intergenic
931666180 2:64610880-64610902 GTAGAATTGTTGGGATAAACAGG - Intergenic
932861768 2:75300587-75300609 GTAGACTTGTTAGGAAAAATAGG + Intergenic
933004489 2:76973068-76973090 TTTGACTTGTTGAGGAAAATGGG + Intronic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
936743630 2:115546503-115546525 ATAAAATTGTTGAGAAAAATTGG - Intronic
939442521 2:142267803-142267825 ATAGACTCCTTGGCAAAAATAGG + Intergenic
940995378 2:160143914-160143936 CTACACCTGTGTGGAAAAATGGG + Intronic
943173744 2:184440119-184440141 CTAGGCTAGTTGGGCAACATGGG - Intergenic
943552882 2:189362696-189362718 CTAGACTTGCTTAGAAGAATAGG - Intergenic
944144963 2:196497616-196497638 CTAGCCTTGGTGGGGAGAATGGG - Intronic
946812721 2:223543267-223543289 CTACAGTTGTTGGCTAAAATAGG - Intergenic
1171417894 20:24995866-24995888 CTGGACTTGTGGGGAAGAAGGGG - Intergenic
1178194543 21:30328817-30328839 CTAGCATAGTTGGGGAAAATGGG - Intergenic
1181340068 22:22171705-22171727 CTGGACCTGTTGAGAAAAACAGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952075064 3:29685938-29685960 GAAGACTTGTTGGTAAATATGGG - Intronic
956846470 3:73188245-73188267 TTAGATATGGTGGGAAAAATAGG - Intergenic
958098902 3:88983528-88983550 CTAGAAATGTTTGGAAAATTGGG + Intergenic
958150007 3:89679548-89679570 GTAAACATGTTAGGAAAAATGGG - Intergenic
962390158 3:134964801-134964823 CTAGACTTGTTTCGAAAAGAGGG + Intronic
963257671 3:143161897-143161919 CTGGACTTATTTTGAAAAATTGG - Intergenic
963409929 3:144914062-144914084 CTAGACTTTATGGGATAAAATGG + Intergenic
963933360 3:151027075-151027097 CTAAATTTGTTGGGAAGAATGGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965724778 3:171703754-171703776 CTTGACTTGGAGGGAAAACTTGG + Intronic
971851601 4:31992249-31992271 CCACACTTGTTTGGAAATATAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973309004 4:48686687-48686709 CTAGACATGGTGGTACAAATTGG - Intronic
976147684 4:82058246-82058268 CTTGATTTGTTAGGAAAAAGTGG + Intergenic
977680280 4:99791318-99791340 CTAGACATGTTTTGACAAATTGG - Intergenic
982831005 4:160060264-160060286 CAAGAATTATTAGGAAAAATGGG - Intergenic
984172578 4:176378643-176378665 CGAGATTTGTTGAGAAAAACTGG - Intergenic
987364806 5:17139503-17139525 CAAGAATTTTAGGGAAAAATTGG - Intronic
989417501 5:41197083-41197105 CTAAAATTCTTGGGAAAATTGGG + Intronic
989789280 5:45376985-45377007 GAAGACTTGTTGAGAAAACTTGG + Intronic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990435538 5:55787244-55787266 GTAGAATTGTAGGGAAAAACAGG + Intronic
991001614 5:61789130-61789152 GTAGACTAATTGGGGAAAATAGG + Intergenic
992154681 5:73943351-73943373 CTTAACTTGGTGAGAAAAATAGG - Intergenic
993411570 5:87580033-87580055 CTAGACTTGTTTTGGAAATTGGG - Intergenic
993767760 5:91882408-91882430 CTAGGCTTATGGGAAAAAATGGG - Intergenic
995540763 5:113183812-113183834 CAAGACTTGTGGGGAGAAAGGGG + Intronic
995901549 5:117073636-117073658 TCAGAATTGTTGGAAAAAATAGG - Intergenic
996372723 5:122770347-122770369 ATAGACTTGTTTGTAAATATAGG - Intergenic
998628567 5:143873529-143873551 CTAGACAAGTTGACAAAAATTGG + Intergenic
998754850 5:145365965-145365987 CTAGACATCCTGGCAAAAATGGG + Intergenic
1008014398 6:46502212-46502234 TTAAACTTCTTGAGAAAAATTGG - Intergenic
1008365128 6:50669388-50669410 CTGGACTTGTCAGGAAAATTGGG - Intergenic
1009448649 6:63774793-63774815 CTAGACATGGTGGAAGAAATTGG + Intronic
1009466743 6:63980205-63980227 CTTCACTTATTGGGGAAAATAGG + Intronic
1011228283 6:85131741-85131763 TCAGACTTGTTAGGAAAACTAGG + Intergenic
1011369989 6:86626317-86626339 AAAGACTTGTTAAGAAAAATAGG - Intergenic
1012603184 6:101123692-101123714 ATAGACTTGAAGGGAAAAAATGG - Intergenic
1012676528 6:102119879-102119901 CTTGACTTGTTGGGAGTCATGGG + Intergenic
1012822845 6:104109651-104109673 CTAGAATAATTGGGGAAAATAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018098419 6:160414321-160414343 CAAGAGTTGATGGGAGAAATTGG - Intronic
1020819756 7:12952469-12952491 CCAGACTTGTGAGGAAAAGTGGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1028913462 7:96233158-96233180 CCAGACTTGCTGGGGAAAGTAGG + Intronic
1030227067 7:107165208-107165230 AAAAACTTTTTGGGAAAAATTGG + Intergenic
1030877316 7:114831226-114831248 CTGTTCTTGTTGGGAAAAATTGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032287697 7:130554561-130554583 CTACACTTGTTGGGCAAAGAGGG - Exonic
1033813405 7:145044515-145044537 GGTGATTTGTTGGGAAAAATGGG + Intergenic
1034020756 7:147639754-147639776 CTAGACTTCTTGAGACAAACAGG - Intronic
1037041029 8:14234048-14234070 CTAGACTTAGTGGGGGAAATTGG + Intronic
1037194944 8:16177542-16177564 CTAGAGTTGTTGTAACAAATGGG - Intronic
1037938895 8:22935123-22935145 ATAGAATTGAAGGGAAAAATAGG + Intronic
1044842481 8:96348820-96348842 ATAGATTTGTGGGGAAAATTGGG + Intergenic
1044917564 8:97131766-97131788 CCCTACTTGTTGGGAAGAATAGG + Intronic
1046705028 8:117440149-117440171 CTAAACTTGCTGGGGCAAATTGG - Intergenic
1048257497 8:132916187-132916209 CTAGACATCTTCTGAAAAATAGG + Intronic
1048643048 8:136385979-136386001 CTGGACTAATAGGGAAAAATGGG + Intergenic
1049043212 8:140128510-140128532 CCAGACTTTTTTGGAAAAATTGG - Intronic
1051023199 9:12570680-12570702 CTAGAATTGAAGGGAATAATTGG - Intergenic
1051678455 9:19582340-19582362 ATAGACTTGGTGGGAAAGATGGG - Intronic
1052105510 9:24510108-24510130 AGAGACTTATTGGGGAAAATTGG + Intergenic
1052234885 9:26199112-26199134 CAAGACATGTTGGCAAAAAAAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052890580 9:33695750-33695772 TGAGGCCTGTTGGGAAAAATGGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056856624 9:90135386-90135408 CTGGAATTGTTGGAAAAAATTGG - Intergenic
1057962139 9:99467025-99467047 ATAGACTTGTTGAGAGAACTAGG + Intergenic
1060119405 9:120974157-120974179 CAAGACATGTTGGAAAAACTGGG - Intronic
1186452508 X:9685237-9685259 CTTGACTTCTGGGGAATAATGGG + Intronic
1186592500 X:10945947-10945969 CTAAACTCGGTGGGAAAATTTGG - Intergenic
1189083863 X:38000133-38000155 CCAGACAGGTTGGGAAAAAAGGG + Intronic
1189185485 X:39051260-39051282 CTAGGCTTGTTTTGACAAATGGG + Intergenic
1190620929 X:52286069-52286091 CTTGACTGGTTGGGATAGATTGG + Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1196536595 X:116852345-116852367 CTATACTTAGTGGGAGAAATAGG + Intergenic
1201919830 Y:19222269-19222291 CTGGACTTCTTGGGTCAAATAGG + Intergenic
1202257545 Y:22937694-22937716 CTAGAATTCTAAGGAAAAATAGG - Intergenic
1202410535 Y:24571441-24571463 CTAGAATTCTAAGGAAAAATAGG - Intergenic
1202460246 Y:25098631-25098653 CTAGAATTCTAAGGAAAAATAGG + Intergenic