ID: 1124952378

View in Genome Browser
Species Human (GRCh38)
Location 15:34336144-34336166
Sequence TTTCTAAGAAGACAAAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1400
Summary {0: 1, 1: 0, 2: 7, 3: 98, 4: 1294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124952375_1124952378 -6 Left 1124952375 15:34336127-34336149 CCAAAATACCCATTTCATTTCTA 0: 2
1: 0
2: 3
3: 41
4: 445
Right 1124952378 15:34336144-34336166 TTTCTAAGAAGACAAAAATGAGG 0: 1
1: 0
2: 7
3: 98
4: 1294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124952378 Original CRISPR TTTCTAAGAAGACAAAAATG AGG Intronic
900286589 1:1903969-1903991 CTACTAAAAATACAAAAATGGGG + Intergenic
901378961 1:8860175-8860197 GTACTAAAAATACAAAAATGAGG - Intergenic
901440885 1:9277615-9277637 TTACTAAAAATACAAAAATTAGG - Intergenic
901692786 1:10984458-10984480 TTTATAAGAAGAGGAAAATTGGG - Intergenic
901745373 1:11369565-11369587 ATGCTAAGAAGAAAAAGATGGGG - Intergenic
901910815 1:12456335-12456357 CTACTAAGAATACAAAAATTAGG + Intronic
902423684 1:16302509-16302531 TTTCAAAAAAGAAAAAAAGGTGG - Intronic
902429004 1:16347688-16347710 TTACTAAAAATACAAAAATTAGG + Intronic
902562784 1:17288241-17288263 TTACTAAAAATACAAAAATTTGG + Intergenic
903650295 1:24917874-24917896 GTTCTCAGATGACAAAACTGAGG + Intronic
903902387 1:26657369-26657391 CTTCTAAAAATACAAAAATTAGG + Intergenic
903941386 1:26934148-26934170 TCTCAAAGAAGAAAAAAAAGAGG + Intronic
904066004 1:27751667-27751689 TTTCTACAAATACAAAAATTAGG - Intronic
904743044 1:32693245-32693267 CTACTAAAAAGACAAAAATTAGG - Intronic
904777897 1:32922785-32922807 CTTCTAAGAAGACATACACGTGG + Intergenic
904955399 1:34279507-34279529 TTTCATAGATGAGAAAAATGAGG - Intergenic
905098885 1:35500936-35500958 TTGCTAAAAAAAAAAAAATGGGG - Intronic
905583918 1:39102732-39102754 TTTCTAAGAAGGCTGCAATGGGG - Intronic
906437816 1:45811932-45811954 TTACTAAAAATACAAAAATTAGG - Intronic
906916495 1:50016614-50016636 GTTCTCAGAAGACATATATGTGG + Intronic
907122245 1:52017915-52017937 TTACTAAAAATACAAAAATTAGG + Intergenic
907177004 1:52533665-52533687 TTTCTAAGAAAGGAAACATGAGG + Intronic
907236691 1:53055882-53055904 TTTCTAAGATGACATATGTGGGG - Intergenic
907555417 1:55339320-55339342 TTTCATAGGAGACAAAACTGAGG + Intergenic
907617702 1:55941233-55941255 TTTATAAGAGGAGAAAACTGAGG + Intergenic
907619375 1:55960912-55960934 TTTTATAGAAGACAAAACTGAGG + Intergenic
907866719 1:58406058-58406080 TGTCTCAGAAAACAAAACTGAGG + Intronic
908224715 1:62044611-62044633 CTTCTAAGAAAGCAAAAAGGAGG - Intronic
908309903 1:62870528-62870550 TTCCAAAGAAGACATAAAAGTGG - Intergenic
908437048 1:64117272-64117294 TTTCAAAGATGAGGAAAATGAGG - Intronic
908556329 1:65260167-65260189 TTTGTCAGATGAGAAAAATGAGG - Intronic
908564340 1:65339180-65339202 TTCTTAAGAAAAAAAAAATGAGG + Intronic
908642623 1:66242245-66242267 TTTCAAAGAAGAGAAAATGGAGG - Intronic
908653743 1:66365083-66365105 TTTCTAAGAAGTGAAACCTGAGG - Intronic
908674165 1:66583504-66583526 TTTTTATGAAAATAAAAATGAGG - Intronic
908739121 1:67308557-67308579 TTTCACAGAAGAGAAAACTGAGG - Intronic
908784306 1:67719993-67720015 TTTCTAAGAAAACAAACACTGGG - Intronic
909543859 1:76821874-76821896 ATCCTAAAAAGAGAAAAATGTGG - Intergenic
909626787 1:77726112-77726134 CTACTAAAAATACAAAAATGAGG - Intronic
909897038 1:81084334-81084356 TTTAAAAGAAGACATACATGTGG - Intergenic
910414401 1:86982514-86982536 TCTCAAAAAAAACAAAAATGGGG - Intronic
910678026 1:89834433-89834455 TTTCAAAGATTACAAAACTGAGG + Intronic
910729841 1:90382915-90382937 TTTCAGAGAAGTCTAAAATGTGG - Intergenic
911353650 1:96788642-96788664 TTTTTAAGAACACAAATATAAGG + Intronic
911655747 1:100441439-100441461 TCCCTAAAAAGGCAAAAATGTGG - Intronic
911793066 1:102042923-102042945 TTTCTAAGAGTACAGCAATGAGG - Intergenic
911796482 1:102083019-102083041 TTTGTATGAAGACAAAAAAGCGG + Intergenic
911874426 1:103141060-103141082 TTCCAAAGAAGACATACATGTGG + Intergenic
912014148 1:105011275-105011297 TTTCTTAAAAGAAAGAAATGTGG - Intergenic
912215187 1:107602341-107602363 TTTCTAACAAAAGAAAAATAAGG + Intronic
912215476 1:107606339-107606361 TTTCTAGGGAGAAAAAAATCAGG - Intronic
912830093 1:112945161-112945183 TTACTAAAAATACAAAAATTAGG - Intronic
913303719 1:117400559-117400581 TCTCAAAAAAGACAAAAAAGAGG - Intronic
913615413 1:120555052-120555074 TTTCTAGAAAAACAAAAATTAGG - Intergenic
913678797 1:121168628-121168650 TTTTTTGGAAAACAAAAATGGGG - Exonic
913935050 1:125031725-125031747 TTCCAAAGAAGACATCAATGCGG - Intergenic
914030629 1:143956274-143956296 TTTTTTGGAAAACAAAAATGGGG - Exonic
914158819 1:145111688-145111710 TTTTTTGGAAAACAAAAATGGGG + Exonic
914326643 1:146623913-146623935 TTTGTTATAAGAGAAAAATGAGG + Intergenic
914574862 1:148955855-148955877 TTTCTAGAAAAACAAAAATTAGG + Intronic
915244886 1:154549644-154549666 TTTCTAAGAAAAAGAAAATGAGG - Exonic
915247935 1:154569284-154569306 TTTCTATGAAGACATTAATCTGG + Intronic
915363835 1:155302535-155302557 TTACTAAAAATACAAAAATTAGG - Intergenic
915799940 1:158780060-158780082 TTGCTAAGAAGACAACAAAAGGG - Intergenic
915818402 1:158994643-158994665 TTTCAAAGAAGACATATGTGTGG - Intergenic
916094869 1:161340122-161340144 TTACTAAAAATACAAAAATTAGG + Intronic
916176150 1:162040678-162040700 TTTCTATGAAAACAGAAATAAGG + Intergenic
916280574 1:163046975-163046997 CTTATAAGAAGACAAAGATGTGG + Intergenic
916388852 1:164307919-164307941 TTTCTATGAAGCCAAAATTAAGG + Intergenic
916544470 1:165789592-165789614 TTTCTGAGAAGAAAGAAGTGTGG - Intronic
916886364 1:169072370-169072392 TCTTAAAGAAGACAAAACTGTGG + Intergenic
917117758 1:171619682-171619704 CTACTAAAAATACAAAAATGTGG + Intergenic
917214078 1:172659640-172659662 TTTCTAAGAAAAAAAAAAAAAGG - Intronic
917230172 1:172828004-172828026 GTTCTAAGAAAACTAAACTGTGG + Intergenic
917681307 1:177370783-177370805 TTCCAAAGAAGACATACATGTGG + Intergenic
917782172 1:178409820-178409842 TTTCTCAGAAGAGGATAATGTGG + Intronic
917898743 1:179519174-179519196 GTTTTGAAAAGACAAAAATGTGG - Intronic
918069726 1:181126121-181126143 TTACTAAAAATACAAAAATTAGG - Intergenic
918187575 1:182141877-182141899 CTTTTAAGAATACAAAAATAGGG - Intergenic
918449605 1:184645871-184645893 TTACTAAAAATACAAAAATTAGG + Intergenic
918483075 1:185000629-185000651 TTTTAAAGAAGACATAAATGAGG - Intergenic
918516908 1:185373466-185373488 TTTCCCAGAAGACAACAGTGGGG + Intergenic
918667546 1:187171199-187171221 TTTCTAAAAAGACAGAAAATAGG + Intergenic
919733272 1:200928212-200928234 CTGCTAAAAAGACAAAAAGGAGG - Intergenic
920341457 1:205277667-205277689 CTACTAAAAATACAAAAATGAGG - Intergenic
920386070 1:205570621-205570643 TTTTTAAGAAGAGAATAATTTGG - Intronic
920466095 1:206187166-206187188 TTTTTTGGAAAACAAAAATGGGG - Exonic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920746633 1:208635231-208635253 TTTATAAGAAGAGAAAACAGAGG + Intergenic
920884054 1:209909153-209909175 TCTCAAAGAAAAAAAAAATGGGG + Intergenic
921646406 1:217623735-217623757 CTACTAAGAATACAAAAATTAGG + Intronic
921875832 1:220195037-220195059 TTTCTAAAAGGACTAAAATTTGG + Intronic
922015642 1:221643816-221643838 TTTCTCAGACGAGAAAATTGAGG + Intergenic
922036470 1:221853104-221853126 TTTCTAAGAAGATGAGAGTGTGG - Intergenic
922052003 1:222000274-222000296 TTTCAAAGGAGACAAACATATGG - Intergenic
922072951 1:222214589-222214611 TTTTTACGAAGAATAAAATGTGG - Intergenic
922285687 1:224168623-224168645 CTACTAAGAATACAAAAATTAGG - Intergenic
922297903 1:224268131-224268153 TGTCTAAAAAGACATAAATCTGG + Exonic
922310172 1:224381280-224381302 CTACTAAAAATACAAAAATGGGG + Intergenic
922502645 1:226108783-226108805 TTACTAAAAATACAAAAATTAGG - Intergenic
923179631 1:231503784-231503806 TTCCAAAGAAGACATACATGCGG - Intergenic
923400626 1:233613241-233613263 TTTTTAAAGTGACAAAAATGTGG - Intergenic
924142853 1:241044275-241044297 TTTCTAAAAATACAAAAATTAGG - Intronic
924222418 1:241891835-241891857 TTTCTAATTAAACAAAAATTGGG - Intronic
924451509 1:244182906-244182928 TTTCTCAGATGAGAAAATTGAGG - Intergenic
924521430 1:244809549-244809571 CTACTAAAAATACAAAAATGAGG - Intergenic
924524927 1:244837514-244837536 TTTCTTAAAGGACAAGAATGTGG - Intronic
924817907 1:247458899-247458921 TTTTTAAGAAAACACAAGTGAGG - Intergenic
1062880561 10:974631-974653 TGTCTCAGAACACAGAAATGAGG + Intergenic
1062935805 10:1387398-1387420 TTTCTAATTAGAAATAAATGAGG + Intronic
1062987088 10:1779173-1779195 TTGCTAAAAATACAAAAATTAGG - Intergenic
1063034067 10:2267818-2267840 TTTAGAAGAAAACTAAAATGTGG + Intergenic
1063182747 10:3620564-3620586 TTTCCAAGAAGACAAAGTGGTGG + Intergenic
1063218059 10:3941921-3941943 CTACTAAAAATACAAAAATGAGG + Intergenic
1063690992 10:8286920-8286942 TTTCAAGAAAGACAAAAATGGGG + Intergenic
1064281626 10:13956496-13956518 TTTAACAGAAGACAAAACTGAGG + Intronic
1064477826 10:15710414-15710436 TTTTTAAGAAGAAAGAAAAGGGG - Intronic
1064510609 10:16086532-16086554 TTCAAAAGAAGACATAAATGAGG + Intergenic
1064595793 10:16943376-16943398 TGTCAAAGGAGACAAATATGTGG - Intronic
1064739909 10:18422405-18422427 TTTCTAAGAAGCCAGAAAAATGG - Intronic
1065270336 10:24025058-24025080 TTTCTTAGAACACAAAAAGTGGG - Intronic
1065874540 10:29985508-29985530 TTCTGAAGAAGACAAAACTGTGG - Intergenic
1066016783 10:31253918-31253940 TTTCTTAAAAGACAAATCTGGGG - Intergenic
1066154428 10:32659685-32659707 TTCCAAAGAAGACATACATGTGG + Intronic
1066616566 10:37301088-37301110 TTTTAAAGAGGACAAAACTGAGG + Intronic
1068162507 10:53283744-53283766 TTTATAAACAGAGAAAAATGCGG + Intergenic
1068257594 10:54533640-54533662 ATTCTAAGATGACAAAAAAAAGG - Intronic
1068353455 10:55880523-55880545 TTACTAAAAATACAAAAATTAGG + Intergenic
1068402589 10:56549471-56549493 TTTCTTAAAAGACATACATGTGG - Intergenic
1068478311 10:57556555-57556577 TTTCAAAGAGGAAATAAATGAGG - Intergenic
1068594739 10:58890621-58890643 TATTTAGGAAGACAAAAAAGAGG - Intergenic
1068814098 10:61290413-61290435 TTCAAAAGAAGACATAAATGAGG - Intergenic
1069268326 10:66491912-66491934 CTACTCAGAAGACTAAAATGGGG - Intronic
1069309503 10:67016800-67016822 TATCAAAGAAGTCAAAAAAGAGG - Intronic
1069405568 10:68094725-68094747 TTTCAAAGAAAACAAAAAATAGG + Intergenic
1069546668 10:69334108-69334130 TCTCAAAAAAGAAAAAAATGGGG + Intronic
1069600438 10:69702442-69702464 TTTTGAAGAAGACAAACATTCGG - Intergenic
1069646043 10:69998525-69998547 TTACTAAAAATACAAAAATTAGG + Intergenic
1070070226 10:73081210-73081232 TTTTTAAAAAGACAAAGAGGAGG + Intronic
1070420667 10:76233471-76233493 CTTAAAAGAAGACAACAATGAGG + Intronic
1070885346 10:79891341-79891363 TTTCTAGAAAGCCAAAAATAAGG + Intergenic
1071137820 10:82471734-82471756 CTACTAAAAATACAAAAATGTGG + Intronic
1071438715 10:85670559-85670581 TGTCTATAAAGACAAAATTGAGG + Intronic
1071588923 10:86853291-86853313 TTTCTAAGAAAAAAAAAAACAGG + Intronic
1071598996 10:86947209-86947231 TTTCTAAGAGCCCACAAATGTGG - Intronic
1071919358 10:90331893-90331915 TATTGAAGAAGATAAAAATGAGG - Intergenic
1072095515 10:92175115-92175137 TTTTTCAGAGGACAAAATTGAGG - Intronic
1072314831 10:94191635-94191657 TTTCTCAGAAAAAAAAAGTGGGG + Intronic
1072614245 10:97038851-97038873 TTTCACAGATGACAAAACTGAGG + Intronic
1072727054 10:97821334-97821356 TTTATAATAAGAAAAAAAAGTGG + Intergenic
1072771547 10:98144136-98144158 TCTCTACAAAAACAAAAATGTGG + Intronic
1072961291 10:99931627-99931649 TATTTAAGAAGTCGAAAATGAGG + Intronic
1072974828 10:100048528-100048550 TTTCTAAAAAAAGAAAAATTAGG + Intronic
1073089359 10:100921380-100921402 TTTGTAAAAAGAAAAAAAGGAGG - Intronic
1073303462 10:102485019-102485041 TTTCAGAGAAGCCAAAAATTTGG + Intronic
1073885347 10:108033125-108033147 TTTCTATTAAGGCACAAATGTGG - Intergenic
1074432560 10:113406367-113406389 TTTATAAGAAGAGGAAAATTTGG + Intergenic
1074688077 10:115978052-115978074 TTTCACAGAAGAGAAAACTGAGG - Intergenic
1074743446 10:116507357-116507379 TTTTTAAGAAGAGAAAAATATGG + Intergenic
1075162128 10:120033655-120033677 TTTCTCAGAACACAAAAGGGTGG - Intergenic
1076182784 10:128423448-128423470 TTTCAAAGAAAACAAAAAGCAGG + Intergenic
1076393184 10:130119129-130119151 CTACTAAGAATACAAAAATTAGG - Intergenic
1076708569 10:132317721-132317743 TGTCTAAAAAAATAAAAATGAGG + Intronic
1076926585 10:133493267-133493289 TTTCTAAAAAAAAAAAAAAGTGG - Intergenic
1077063955 11:630518-630540 TTTTTAAAAATACAAAAATTAGG - Intergenic
1077084197 11:740107-740129 TTACTAAAAATACAAAAATTTGG + Intergenic
1077084728 11:743573-743595 TTACTAAAAATACAAAAATTAGG - Intergenic
1077852765 11:6090379-6090401 TTTTTAAAAAGACATAGATGTGG - Intergenic
1078066175 11:8080976-8080998 TTTCACAGAAGACGAAACTGAGG + Intronic
1078221337 11:9353982-9354004 CTACTAAGAATACAAAAATTAGG + Intergenic
1078251158 11:9617606-9617628 CTACTAAAAAGACAAAAATTAGG - Intergenic
1078286678 11:9963298-9963320 TTACTAAAAATACAAAAATGAGG + Intronic
1078330440 11:10414871-10414893 TTTCTAAGAAGCTAAAGAAGAGG - Intronic
1078468324 11:11567302-11567324 TTTCTAATAAGTCAAGAATCAGG - Intronic
1078545993 11:12247322-12247344 TTTTTAAAAGAACAAAAATGGGG - Intronic
1079177176 11:18153145-18153167 TTTTTCAGAAGAGAAAAATTGGG - Intronic
1079226059 11:18605840-18605862 CTACTAAAAATACAAAAATGTGG - Intergenic
1079436375 11:20456631-20456653 TTTTTAAAAAGATCAAAATGGGG - Intronic
1079812228 11:25009004-25009026 TTCCTAAGAAGACAAAGGAGTGG - Intronic
1079896291 11:26122730-26122752 CTTCCAAAATGACAAAAATGAGG - Intergenic
1080090395 11:28341559-28341581 TTTTTCAGAAGAGTAAAATGAGG - Intergenic
1080338929 11:31233831-31233853 TTTTTTAGAAGGCAAAAATTCGG - Intronic
1080467482 11:32511364-32511386 TTTCTGAAAAAACAAACATGAGG + Intergenic
1080481463 11:32655465-32655487 TTGCAAAGAAGACAACAAAGGGG + Intronic
1080724367 11:34880861-34880883 TTTCTTAGATGAGAAAATTGAGG - Intronic
1080728717 11:34924383-34924405 TTACTAAAAATACAAAAATTAGG - Intronic
1080833171 11:35915463-35915485 TTTCAGAGAAGAGCAAAATGAGG + Intergenic
1080990657 11:37530253-37530275 TTGCTATAAAGATAAAAATGTGG - Intergenic
1081422844 11:42892143-42892165 TTTCTAATAAGACTATAATATGG - Intergenic
1081618458 11:44604406-44604428 TTTCACAGAAGAAAAAAATGAGG - Intronic
1081619465 11:44610714-44610736 TTTCTCAGAAGAGAAAAATGAGG - Intronic
1081740614 11:45437136-45437158 TTTCTAAGAAAAGAAAAATCTGG + Intergenic
1081767946 11:45625287-45625309 TTTATAAAAAGACAGAAATTTGG + Intergenic
1081892076 11:46551725-46551747 CTACTAAAAAGACAAAAATTAGG + Intronic
1082052930 11:47787586-47787608 CTACTAAAAATACAAAAATGAGG - Intronic
1082067736 11:47914637-47914659 CTACTAAAAAGACAAAAATTAGG - Intergenic
1083037019 11:59647964-59647986 CATCTAAGAGGAAAAAAATGAGG - Intronic
1083157629 11:60834621-60834643 TTTCAAAGAATAGAAAAATTAGG + Intergenic
1083239008 11:61372009-61372031 CTGCTAAGAATACAAAAATTAGG + Intergenic
1083355956 11:62066350-62066372 TTTGTAAGAAGAGAGAAATTTGG - Intergenic
1083971653 11:66080557-66080579 TTTCTCAGAAGGGAAAATTGAGG + Intronic
1083977046 11:66131110-66131132 TTCGTAAGAAGACATATATGAGG - Intronic
1084194258 11:67515222-67515244 TCTCTAAAAAAACAAAAAAGTGG - Intergenic
1085726189 11:78956661-78956683 TTTTTAAGAAGACACAATTCAGG + Intronic
1085732091 11:79008769-79008791 TTTCTAGAAACACAATAATGGGG + Intronic
1085738478 11:79059788-79059810 TTTTTAAAATGACAAAACTGTGG + Intronic
1085962023 11:81472029-81472051 ATTCTAAGAAGAAGAAACTGTGG + Intergenic
1086242188 11:84708532-84708554 TTGCAAAGAAAAAAAAAATGTGG - Intronic
1086303357 11:85453770-85453792 TTTAAAAAAAGACAAAAGTGAGG - Intronic
1086439029 11:86809601-86809623 TTTTTCAGAAGACAATAATCAGG + Exonic
1086597916 11:88596095-88596117 TTTCCAGGAATAGAAAAATGGGG - Intronic
1086770382 11:90756523-90756545 TTTTAAAGTAGACCAAAATGTGG + Intergenic
1087216438 11:95500162-95500184 TTTCTTAGATGACAAAAGAGAGG - Intergenic
1087381158 11:97406747-97406769 TTTCTCAAAAGAGAAAAATTTGG + Intergenic
1087568525 11:99894643-99894665 TTTATAAACAGACAAAAATAGGG + Intronic
1087771634 11:102216925-102216947 TCTGTAATAATACAAAAATGTGG + Intronic
1088412551 11:109551194-109551216 TTACTGAGATGGCAAAAATGAGG + Intergenic
1088420416 11:109638989-109639011 TTCATAAGAAGACATACATGTGG - Intergenic
1088486592 11:110346781-110346803 TTACTAAAAATACAAAAATTAGG - Intergenic
1088538597 11:110888171-110888193 GTTCCAAGAACACAATAATGGGG + Intergenic
1089141015 11:116284171-116284193 TCTCTAAAAAGAAAAAAAGGGGG - Intergenic
1089163272 11:116455900-116455922 TTTCTAACAAGTCAAAATTCAGG + Intergenic
1089231969 11:116985850-116985872 TTTCTATGTAGGGAAAAATGAGG - Intronic
1089543287 11:119204089-119204111 TTACTAAAAATAAAAAAATGAGG - Intergenic
1089721635 11:120429433-120429455 TTTCTAGGAGGAAAACAATGTGG + Exonic
1089871612 11:121678366-121678388 TTTTTTAGAAAACAAAAAAGGGG - Intergenic
1089893158 11:121901352-121901374 TTTTAAAGAAGAGAAAACTGAGG + Intergenic
1090194316 11:124801426-124801448 TTTCAAAGCAGACATAACTGAGG + Intergenic
1090596063 11:128322597-128322619 TTTAGAAGAAGACAAGAATGTGG + Intergenic
1090887014 11:130886478-130886500 TTTCCAGGAAGCTAAAAATGTGG - Intronic
1091127578 11:133114914-133114936 GTTTTAAGAAAACATAAATGGGG - Intronic
1091245099 11:134086412-134086434 TTTTAAAGAAAACAAAAATCTGG + Intronic
1091430575 12:430291-430313 TTTCTAAAAAAATAAAAATAAGG - Intronic
1092219657 12:6704163-6704185 TTTCAAAAAAAAAAAAAATGTGG - Intergenic
1092993565 12:13926651-13926673 TTTTTAAAAAGACAAATTTGTGG + Intronic
1093058686 12:14580313-14580335 TTACTAAAAATACAAAAATTAGG - Intergenic
1093088576 12:14894249-14894271 TTTATTAGATGACGAAAATGAGG - Intronic
1093103071 12:15051303-15051325 TGTTTAAGAAGACAAAAATATGG + Intergenic
1093113983 12:15186960-15186982 TTTCTAATAAGAAGAAAAAGAGG - Intronic
1093942627 12:25071188-25071210 TTACTAAAAATACAAAAATTAGG + Intronic
1094260347 12:28489921-28489943 TTTCTAAGAAGAGAAAAGTAAGG - Intronic
1094425980 12:30317577-30317599 TTTCTATGAAGACAAACACCTGG - Intergenic
1094548507 12:31428187-31428209 CTACTAAAAATACAAAAATGTGG + Intronic
1095343025 12:41114667-41114689 CTTCTATGAAGACAGGAATGAGG + Intergenic
1095507558 12:42913459-42913481 TTTGTAAGTAGACAAGACTGAGG + Intergenic
1095743349 12:45630777-45630799 TGTCTAAGAAAAAAAAAAGGGGG + Intergenic
1096854338 12:54468931-54468953 TATTTAAGAAAAAAAAAATGTGG + Intronic
1096903917 12:54915675-54915697 TTGTTAAGAAAACAAAACTGAGG - Intergenic
1097115500 12:56693820-56693842 TTCCTAAAAATACAAAAATTAGG + Intergenic
1097497004 12:60352434-60352456 TCTTTAAGAAGCCAAAAAAGGGG - Intergenic
1097518648 12:60640984-60641006 TTTTTAAGGAGATAAAAAGGGGG - Intergenic
1097527112 12:60750824-60750846 TTTCAAAGAAGACATTTATGTGG + Intergenic
1097730698 12:63124894-63124916 TCTCTAGGAAAACAAAAATCTGG + Intergenic
1097810738 12:64016065-64016087 TTTCAATGAAGACAAAAAAGTGG - Intronic
1097874221 12:64628659-64628681 TTACTAATAATACAAAAATTAGG - Intronic
1097890139 12:64769684-64769706 TTACTAAAAATACAAAAATTAGG - Intergenic
1098023446 12:66178483-66178505 TTTATAAGAAGAGAGAAATTTGG - Intergenic
1098062503 12:66578247-66578269 TTTGTAAAAATACAAAATTGAGG + Intronic
1098379299 12:69852180-69852202 ATTCTCAGAAAACAAATATGTGG + Intronic
1098572696 12:72006802-72006824 TTTTAAAGATGACAAAACTGGGG - Intronic
1098872247 12:75829523-75829545 TTCCGAAGAAGACATGAATGTGG - Intergenic
1099663250 12:85593788-85593810 TTCCAAAGGAGACATAAATGTGG - Intergenic
1099836615 12:87914734-87914756 TTTTTAAGAAAAAAAAAAGGAGG - Intergenic
1099845565 12:88023986-88024008 TTCAAAAGAAGACATAAATGTGG + Intronic
1099953793 12:89332979-89333001 TTTCACAGAAGAGAAAACTGAGG + Intergenic
1100061134 12:90576598-90576620 TTCTTAAGAAGAAAAAAATCAGG - Intergenic
1100102369 12:91124481-91124503 TTTCAAAGAAAACAATAATAAGG - Intergenic
1100233612 12:92635064-92635086 CTTATAAGAAGAGAAAAATTTGG - Intergenic
1100273148 12:93045409-93045431 TTTTTAATAAGAATAAAATGTGG + Intergenic
1100348767 12:93758067-93758089 TTTCTTAGAAGAAACAAATGTGG - Intronic
1100673912 12:96846090-96846112 TTTCTCAGAGTATAAAAATGAGG + Intronic
1100841565 12:98618324-98618346 TTTCTTAAAAGAAAAAATTGAGG + Intronic
1101160940 12:101975499-101975521 TTCATAAGAAGACATAACTGTGG - Intronic
1101458502 12:104863431-104863453 TCTCTAAAAAGAAAAAAAAGAGG + Intronic
1102100974 12:110278878-110278900 CTACTAAAAATACAAAAATGAGG + Intergenic
1102105717 12:110321060-110321082 CTACTAAAAATACAAAAATGAGG + Intronic
1102480896 12:113222177-113222199 TTTCCAGACAGACAAAAATGAGG - Intronic
1103304431 12:119952681-119952703 TTTGTAAAAATACAAAAATTAGG + Intergenic
1103471693 12:121186703-121186725 CTACTAAGAATACAAAAATTAGG + Exonic
1103900639 12:124302081-124302103 TTTCTAAGAAGAGGGAAATCTGG - Intronic
1103920033 12:124394559-124394581 CTTGTAAGAAGAGGAAAATGTGG + Intronic
1104231482 12:126888787-126888809 TTTTTCAGAAGGGAAAAATGAGG + Intergenic
1104339678 12:127936540-127936562 TTTCTCAGAACACAATGATGCGG - Intergenic
1104827058 12:131719443-131719465 TTTTTATGCAGAAAAAAATGAGG + Exonic
1105319054 13:19299664-19299686 TTTCTACTCTGACAAAAATGAGG + Intergenic
1106678871 13:31989547-31989569 GTTCTAGGAATACAAAGATGAGG + Intergenic
1106892304 13:34258850-34258872 ATTCCAAGAATGCAAAAATGTGG - Intergenic
1107059522 13:36142711-36142733 TTTATAAAAAGACAAATATAAGG + Intergenic
1107068229 13:36240670-36240692 TTCATAAGCAGAAAAAAATGAGG + Intronic
1107208022 13:37819036-37819058 TTTCAAAAAAGACATAATTGTGG + Intronic
1107608386 13:42086080-42086102 TTACTAAAAATACAAAAATTAGG - Intronic
1107632926 13:42361052-42361074 TTTCAAAGAGGAGAAATATGAGG - Intergenic
1107738782 13:43426828-43426850 TTGCTAATAAGATAAAAATAAGG + Intronic
1107849816 13:44559854-44559876 CTACTAAAAATACAAAAATGAGG - Intronic
1108040716 13:46337301-46337323 TTACTAAAAATACAAAAATTAGG - Intergenic
1108077983 13:46701477-46701499 ATTCTTAGAAAACAAAAATATGG + Intronic
1108296420 13:49023294-49023316 TTTCCAATAAAACAAAAATTGGG + Intronic
1108687205 13:52830359-52830381 TTTTAAAGATGAGAAAAATGAGG - Intergenic
1108887577 13:55206982-55207004 TTCCAAAGAAGACATACATGTGG + Intergenic
1108917303 13:55630689-55630711 TTCTAAAGAAGACAAACATGAGG - Intergenic
1108930965 13:55818551-55818573 TTTCAAAGAAGATAAATATGTGG + Intergenic
1108948209 13:56050667-56050689 TTTCTAGACAGACAAAATTGAGG + Intergenic
1108953517 13:56120438-56120460 TTTCTACAACAACAAAAATGTGG - Intergenic
1109250481 13:60013691-60013713 GTTTTAAGAGGAAAAAAATGTGG - Intronic
1109332572 13:60947644-60947666 TTTTTAAAAAGATAAAAGTGAGG - Intergenic
1109464408 13:62710719-62710741 TTTCTAAGAAGCTGAAAATAGGG - Intergenic
1109605266 13:64686066-64686088 TTTCAAAGAAGACAATTATGTGG - Intergenic
1109877234 13:68421316-68421338 TTTCTCAGAAGACAGACAAGCGG - Intergenic
1109994274 13:70103048-70103070 ATTCTAAGAAGACAAAACACAGG + Intronic
1110149642 13:72235391-72235413 CTTGAAAGAAGACATAAATGTGG - Intergenic
1110379593 13:74835174-74835196 CTTCAAAGAAGAGGAAAATGTGG - Intergenic
1110402377 13:75108302-75108324 TTCAAAAGAAGACATAAATGTGG + Intergenic
1110467560 13:75819158-75819180 TTTCTGGGAAAACAAAAATGGGG + Intronic
1111198215 13:84900628-84900650 TGTCTCAAAAGACAAAACTGTGG + Intergenic
1111352596 13:87050950-87050972 TTTGAAAGAAGTCTAAAATGTGG - Intergenic
1111357006 13:87119644-87119666 TTTCTGACAAGATAAAAATAGGG - Intergenic
1111620243 13:90715859-90715881 TTTCTTAGAAGTCACAAATCTGG - Intergenic
1111925403 13:94458463-94458485 TTTCTAAGACAAACAAAATGGGG - Intronic
1112353676 13:98657002-98657024 TTACTAAAAATACAAAAATTAGG + Intergenic
1112406763 13:99127638-99127660 TTACTAAAAATACAAAAATTAGG + Intergenic
1112566503 13:100555536-100555558 TTTTTAAAAAGAAAAAAATCTGG + Intronic
1113268213 13:108642840-108642862 TTTTTAATAAGACAAAATTTGGG - Intronic
1113344445 13:109461630-109461652 TTTCCAAAAAGTCAAAGATGAGG - Intergenic
1113427501 13:110221411-110221433 TTTATAAGAAGACCATACTGAGG - Intronic
1113988149 13:114335878-114335900 CTCCAAAGAAGACAAACATGTGG + Intergenic
1114172643 14:20289027-20289049 TTTGTATAAAGAAAAAAATGGGG + Exonic
1114180146 14:20359866-20359888 TTACTAAGAATACAAAAATTAGG - Intergenic
1114215134 14:20652341-20652363 CTTATAAGAAGAAAAAAATCTGG - Intergenic
1114326436 14:21593798-21593820 TCTCTAAAAAGAAAAAAATCCGG + Intergenic
1114474882 14:22987322-22987344 TTTCCAAGAAGAGGAAGATGAGG - Exonic
1114864766 14:26575950-26575972 TTTTTATGGAGACTAAAATGAGG + Intronic
1115080542 14:29445476-29445498 TTTATAATAAGAAAAACATGAGG + Intergenic
1115138232 14:30137193-30137215 TTTCTAATATGAAAAAAATGAGG + Intronic
1115835048 14:37393026-37393048 CTTATAAGAAGAGAAAAATTTGG + Intronic
1116008313 14:39321636-39321658 TTTTTAAGAAGTCAAAAATATGG - Intronic
1116484480 14:45430743-45430765 TTTAAAAGAAGACATACATGTGG - Intergenic
1116487133 14:45463443-45463465 TTTCCAAGAAGACAGAAAGTTGG - Intergenic
1116546606 14:46174934-46174956 ATTAAAATAAGACAAAAATGAGG + Intergenic
1116832448 14:49734983-49735005 TTAATAAGCAGACAAAAATGGGG + Intronic
1116971265 14:51068566-51068588 TTTTACAGATGACAAAAATGGGG + Intronic
1117283413 14:54262959-54262981 TTTCAAAGAAGAAGAAATTGAGG - Intergenic
1117448736 14:55830112-55830134 TTTCTCAGAAGACAAAACAGTGG + Intergenic
1117527661 14:56626218-56626240 TTGCTAAGAACATAATAATGTGG + Intronic
1117904954 14:60575290-60575312 TTTCTAAGGAGAGAAAATGGAGG + Intergenic
1118185909 14:63538417-63538439 CTTCTAAAAATACAAAAATTAGG - Intronic
1118230553 14:63944683-63944705 CTTCTAAAAATACAAAAATTAGG - Intronic
1119364313 14:74078827-74078849 CTACTAAAAATACAAAAATGTGG - Intronic
1119368797 14:74119998-74120020 TTACTAAAAATACAAAAATTAGG - Intronic
1119370288 14:74134636-74134658 ATTCTAAGAAAAGGAAAATGGGG - Intronic
1119374796 14:74181286-74181308 TTTTTAAGAAGAAAAAAAGCCGG + Intronic
1119493122 14:75054245-75054267 TTTCTAGGAAGATAATAAAGTGG - Intronic
1119532877 14:75375349-75375371 TTTCTACCATGAAAAAAATGTGG + Intergenic
1119713763 14:76843863-76843885 CTACTAAGAATACAAAAATTAGG - Intronic
1120310735 14:82824480-82824502 TTTCATAGATGACAAAACTGAGG + Intergenic
1120315831 14:82891327-82891349 TTACTAAAAATACAAAAATTAGG - Intergenic
1120354693 14:83416252-83416274 TCTGTAAGAGGACAAAAATAAGG - Intergenic
1120477586 14:85008018-85008040 CTTCTGAGAAGGCAAAAATTAGG - Intergenic
1120502933 14:85319554-85319576 TTTCTGAGAACATAAAAATAAGG + Intergenic
1120651846 14:87143460-87143482 TTTTTAAAAAAAGAAAAATGAGG + Intergenic
1121150018 14:91624179-91624201 CTCCTAAAAAGACAAAAATTAGG + Intronic
1121182614 14:91940919-91940941 TTTCTAAAAACACAGAGATGGGG - Intronic
1121214693 14:92238759-92238781 TTTCAAAGATGAGAAAACTGAGG + Intergenic
1121217493 14:92259806-92259828 TTTTTCAGATGACAAAACTGAGG - Intergenic
1121285691 14:92733957-92733979 ATTAAAAGGAGACAAAAATGAGG - Intronic
1121658454 14:95616144-95616166 TCTCTAAGAAGAAAGAAAGGAGG + Intergenic
1121931146 14:97973312-97973334 TTTCTCAGATGAAGAAAATGAGG + Intronic
1122084523 14:99290452-99290474 GTTCTATGGAGACAAAGATGAGG + Intergenic
1122457948 14:101869814-101869836 CTACTAAAAATACAAAAATGAGG - Intronic
1122484262 14:102067530-102067552 TTACTAAGAAAAAAAAAGTGAGG - Intergenic
1123414391 15:20084357-20084379 TTTAGACGAAGAAAAAAATGAGG + Intergenic
1123523733 15:21091468-21091490 TTTAGACGAAGAAAAAAATGAGG + Intergenic
1124123773 15:26916338-26916360 GTGCCAAGAATACAAAAATGAGG - Intronic
1124825732 15:33093475-33093497 TATCTAAGAAGACAGAGCTGTGG + Intronic
1124952378 15:34336144-34336166 TTTCTAAGAAGACAAAAATGAGG + Intronic
1125275913 15:37992205-37992227 TTTTAAAGAAGACATACATGCGG + Intergenic
1125305168 15:38304113-38304135 TTTCTAGGAAGAAAATAATGTGG + Intronic
1125693397 15:41615303-41615325 TATATAATAAGACAAAAAGGGGG + Intergenic
1125928027 15:43579105-43579127 TTTCTAGGAACACCATAATGCGG - Exonic
1125941171 15:43678676-43678698 TTTCTAGGAACACCATAATGCGG - Intergenic
1126376019 15:47997187-47997209 CTTCTAAGAAAACAATATTGGGG + Intergenic
1126665499 15:51072867-51072889 TTTCTAAGCAGAATAAAGTGAGG - Intronic
1126749250 15:51859948-51859970 TTACTAAGAAGACAAATAGTGGG - Intronic
1126787095 15:52186257-52186279 TTTTTAAAAAGGCAAAAAAGAGG - Intronic
1127090379 15:55460927-55460949 TTACTAAAAATACAAAAATTAGG - Intronic
1127205416 15:56712150-56712172 TTTTTAAAAAGATGAAAATGTGG - Intronic
1127406899 15:58659106-58659128 TTACTAAAAATACAAAAATTAGG + Intronic
1127559862 15:60125532-60125554 AATCTCAGAAGACAGAAATGGGG + Intergenic
1127565944 15:60188359-60188381 TGTCTTAAAAGAGAAAAATGGGG - Intergenic
1129144858 15:73637563-73637585 TTTATAGAAAGAAAAAAATGAGG - Intergenic
1129328676 15:74815739-74815761 TTTCTCAGATGACGAAACTGAGG - Intronic
1129569106 15:76659582-76659604 TTTTTAAGAAGACAAACACATGG + Intronic
1129618229 15:77117927-77117949 TTTGTGAGTAGACAAGAATGTGG + Intronic
1129663101 15:77564286-77564308 TTTTTAAGAAAACAAAAATTGGG - Intergenic
1130006535 15:80104356-80104378 CTTCTAAAAATACAAAAATTAGG + Intronic
1130185957 15:81682553-81682575 CTTCTTAGAAGACATACATGTGG + Intergenic
1130427623 15:83817065-83817087 TTGCTAAGACAACAAAAATGTGG + Intronic
1130557223 15:84931068-84931090 CTACTAAGAATACAAAAATTAGG - Intronic
1130873458 15:87991373-87991395 TTTCTATGCAGAGTAAAATGTGG + Intronic
1131490523 15:92858459-92858481 ACTCTAAAAAGACAAGAATGTGG + Intergenic
1131491409 15:92866548-92866570 TTACTAAAAATACAAAAATTAGG - Intergenic
1132297401 15:100750350-100750372 TTCAAAAGAAGACAAATATGTGG - Intergenic
1132754662 16:1477085-1477107 TTACTAAAAATACAAAAATTAGG - Intergenic
1132923697 16:2415414-2415436 TTTCTTAAAAAAAAAAAATGAGG - Intergenic
1132987455 16:2775271-2775293 TTTTTAAAAAAAAAAAAATGAGG + Intronic
1133162458 16:3921014-3921036 CTACTAAAAATACAAAAATGAGG - Intergenic
1133736971 16:8623147-8623169 TTACTAAAAATACAAAAATTAGG + Intronic
1133809954 16:9154240-9154262 CCTCTAAGAAGAGAGAAATGTGG - Intergenic
1134033713 16:11013462-11013484 CTGCTAAAAATACAAAAATGAGG + Intronic
1134045217 16:11096031-11096053 TTTGTAAGAAAACAAAACTAAGG + Intronic
1134047939 16:11114930-11114952 TTCATAAGAAAACTAAAATGCGG - Intronic
1134067219 16:11236571-11236593 TTTCTCAGATGAGAAAACTGAGG - Intergenic
1134133593 16:11666006-11666028 TTTCTCAGACGAAAAAACTGAGG + Intergenic
1134423468 16:14116161-14116183 TTTGCAAGAAAAAAAAAATGAGG - Intronic
1135095900 16:19564561-19564583 TTACTAAAAATACAAAAATTCGG - Intronic
1135123157 16:19784209-19784231 CTTCGAAGAAAAAAAAAATGGGG - Intronic
1135143708 16:19943304-19943326 TTTCACAGAAGAGAAAAACGAGG - Intergenic
1135207785 16:20497442-20497464 TTTGTAAGGAGAGTAAAATGTGG + Intergenic
1135211114 16:20526258-20526280 TTTGTAAGGAGAGTAAAATGTGG - Intergenic
1135245752 16:20855509-20855531 TTTCCAAGAAGAGAAGAATAGGG + Exonic
1135495606 16:22948678-22948700 TTTCTCAGAGGGCAAAACTGAGG + Intergenic
1135534729 16:23284491-23284513 GTTCTAACAAGACCAACATGTGG - Intronic
1135570022 16:23542156-23542178 TTACTAAAAATACAAAAATTAGG - Intronic
1135726718 16:24859983-24860005 TTACTAAAAATACAAAAATTAGG + Intronic
1136534334 16:30890683-30890705 TTACTAAAAATACAAAAATTAGG + Intronic
1136593934 16:31233955-31233977 CTTAAAAGAAGACAATAATGAGG + Intergenic
1136867703 16:33770073-33770095 TTTTTAAAAAGCCAAATATGGGG + Intergenic
1138652041 16:58466179-58466201 CTACTAAGAATACAAAAATTAGG - Intronic
1138832531 16:60392583-60392605 TTGCTGAGCAGACAAAAATAAGG + Intergenic
1138950224 16:61903950-61903972 TTTTTAAAAAAAAAAAAATGAGG + Intronic
1139022930 16:62774446-62774468 TTTCAAAGAAGACATAAAAGTGG - Intergenic
1139050101 16:63113959-63113981 GTTATAAGAAGCCAAAATTGTGG - Intergenic
1139314593 16:66057551-66057573 TTTCAAAGATGAGAAAACTGAGG - Intergenic
1139382519 16:66542543-66542565 TTTCACAGAAAACAAAAATGAGG + Intronic
1139518735 16:67467338-67467360 CTACTAAAAAGACAAAAATTAGG + Intronic
1139575446 16:67839084-67839106 CTTCTAAAAATACAAAAATTAGG + Intronic
1139595652 16:67956519-67956541 CTACTAAAAATACAAAAATGTGG + Intronic
1139813449 16:69643729-69643751 TTTCTGGGAAGCCAAAAATTTGG - Intronic
1140006921 16:71087032-71087054 TTTGTTATAAGAGAAAAATGAGG - Intronic
1140190974 16:72816364-72816386 TTTCAAAGGGGATAAAAATGTGG + Intronic
1140422649 16:74833336-74833358 CTACTAAAAATACAAAAATGAGG - Intergenic
1140510447 16:75503770-75503792 TTTTGGAGAAGACAAAACTGGGG - Intergenic
1140623306 16:76762824-76762846 TTTCTAAGTATAAAAAAAGGTGG + Intergenic
1141307192 16:82876416-82876438 TTGAAAATAAGACAAAAATGTGG - Intronic
1141439182 16:84018383-84018405 TTACTAAAAATTCAAAAATGTGG - Intronic
1141485475 16:84336577-84336599 TTACTAAAAATACAAAAATTAGG + Intergenic
1141599353 16:85115816-85115838 CTACTAAGAATACAAAAATTAGG - Intergenic
1141626663 16:85264943-85264965 TTTCTCAGAGGAGAAAACTGAGG - Intergenic
1141954335 16:87360182-87360204 TGTCTGAGAAAACAAAAGTGTGG + Intronic
1142170779 16:88621520-88621542 CTACTAAGAATACAAAAATTAGG - Intronic
1142330500 16:89449478-89449500 TTTCTAAGTATAGAAGAATGTGG - Intronic
1142404044 16:89876624-89876646 CTACTAAGAATACAAAAATTGGG + Intronic
1203104456 16_KI270728v1_random:1346130-1346152 TTTTTAAAAAGCCAAATATGGGG - Intergenic
1203129058 16_KI270728v1_random:1616238-1616260 TTTTTAAAAAGCCAAATATGGGG + Intergenic
1143076564 17:4349020-4349042 CTACTAAGAATACAAAAATTAGG + Intronic
1143161602 17:4875470-4875492 ACTCTAAAAAAACAAAAATGAGG + Intronic
1143561862 17:7701267-7701289 CTACTAAAAATACAAAAATGAGG - Intronic
1143951578 17:10636910-10636932 TGTCTAAAAAAAAAAAAATGTGG + Intronic
1144476818 17:15595850-15595872 TTCCTAAGAAGAAAACACTGGGG - Intronic
1144921426 17:18767498-18767520 TTCCTAAGAAGAAAACACTGGGG + Intronic
1145092235 17:19995427-19995449 AGACTAAGAATACAAAAATGGGG - Intergenic
1145261131 17:21355457-21355479 TTTTTCAGATGACAAAATTGAGG + Intergenic
1145803605 17:27710258-27710280 TTTCCAAGAAGAAAAATATAAGG - Intergenic
1145854261 17:28137455-28137477 TTTCTAAGATTAGAAAAATTGGG + Intronic
1145885959 17:28382627-28382649 TTTTCCAGAAGATAAAAATGAGG - Intronic
1146004617 17:29153465-29153487 TTTCATAGATGACGAAAATGAGG + Intronic
1146392667 17:32437331-32437353 TTACTAAAAATACAAAAATTAGG + Intergenic
1146466880 17:33093313-33093335 TTGCCAATAAGACAAATATGAGG - Intronic
1146706587 17:35004739-35004761 TTTCAAAGAAAACAAAAAGATGG - Exonic
1147035125 17:37674080-37674102 CTCCTAAAAATACAAAAATGAGG + Intergenic
1147458957 17:40556548-40556570 TTTCACAGAAGAGAAAACTGAGG - Intronic
1147884787 17:43677197-43677219 GTTCTAAGAGGAACAAAATGAGG - Intergenic
1147977103 17:44254274-44254296 TTTTTAAGAAAAAAAAAACGTGG - Intronic
1148260877 17:46182211-46182233 TTACTAAGAAGAGAAAAAGGAGG + Intronic
1148527518 17:48355188-48355210 CTTCTAAAAAGACTAAGATGGGG + Intronic
1149062517 17:52439597-52439619 TTTAAAAGAAGACATACATGTGG - Intergenic
1149080777 17:52654476-52654498 TTTCTAGGAAGTCAATAATAAGG + Intergenic
1149092576 17:52801864-52801886 TTCCAAAGAAGACATACATGTGG - Intergenic
1149536498 17:57437653-57437675 TTGTTAACAAGACAAAAATAAGG + Intronic
1149596622 17:57868185-57868207 TCTCAGAGAAGACCAAAATGAGG - Exonic
1149697574 17:58628410-58628432 CTACTAAGAATACAAAAATTAGG + Intronic
1149768769 17:59303163-59303185 TTTGAAAGAAGACATACATGTGG + Intergenic
1150032661 17:61755606-61755628 TTTGTAAGATGACAAAGATGAGG + Intronic
1150038328 17:61829033-61829055 ATTCAAAGAAGACAGAAAAGGGG + Intronic
1150066086 17:62110526-62110548 TTACTAAAAATACAAAAATTAGG - Intergenic
1150246616 17:63680512-63680534 GATCAGAGAAGACAAAAATGAGG - Intronic
1150539665 17:66083956-66083978 TTTTTAAATAGACAAAAAAGAGG + Intronic
1150688762 17:67344313-67344335 TTTCTGAAAAGCCAAAAATAGGG + Intronic
1150936776 17:69644246-69644268 TTTTACAGAAGAGAAAAATGAGG + Intergenic
1151090311 17:71431992-71432014 TTTCTAAGAAAAAATAAATTTGG + Intergenic
1151596836 17:75083138-75083160 TTACTAAAAATACAAAAATTAGG + Intergenic
1151625936 17:75275808-75275830 CTTCTAAAAATACAAAAATTAGG + Intronic
1151789716 17:76297204-76297226 TGTATAAGAATACAAAAATATGG + Intronic
1151882293 17:76903002-76903024 TTTCTGAGGAGGCAGAAATGAGG - Intronic
1152004658 17:77672541-77672563 CTTATAAGAAGAGGAAAATGTGG + Intergenic
1152342298 17:79731795-79731817 TTTTTAAAAAGCCAAATATGGGG + Intronic
1152674828 17:81634166-81634188 TTACTAAAAATACAAAAATTAGG - Intronic
1153042322 18:825260-825282 TTTTTAAGATGAGAAAAGTGGGG + Intergenic
1153076858 18:1172756-1172778 TTCATAAGAACACAAAAATCGGG - Intergenic
1153673375 18:7434111-7434133 TTTTTAAAAAGACCAAAAAGGGG - Intergenic
1154033056 18:10770425-10770447 ATTCTAAGAAAACCAAAATCTGG + Intronic
1155361230 18:25004859-25004881 GTGCTAGGAAGAAAAAAATGCGG - Intergenic
1155370826 18:25098436-25098458 TTTTTAATAAAAAAAAAATGAGG - Intronic
1155423137 18:25677247-25677269 TTTTTAAAAAGACAAAAAAAAGG - Intergenic
1155581435 18:27312501-27312523 GTTCTGAGAAGACATAAATTGGG + Intergenic
1155744450 18:29335179-29335201 TTTCTAAGAACACAAACACATGG + Intergenic
1155821534 18:30383715-30383737 TTTCCTGGAACACAAAAATGTGG - Intergenic
1156274757 18:35573837-35573859 TTTCTAGCAAAAAAAAAATGAGG - Intergenic
1156382268 18:36574041-36574063 TTTGGAAGAAGAAAAAACTGAGG - Intronic
1156626092 18:38911111-38911133 ATTTTAGGAAGACAAAGATGGGG + Intergenic
1156662990 18:39370070-39370092 TTTTTAAGAAGACATAAAAATGG + Intergenic
1156737832 18:40283161-40283183 TTGCTAAAAATACAAAAATTAGG + Intergenic
1156951488 18:42905447-42905469 TTTTTAAGAAGAGAAAAACATGG + Intronic
1157008337 18:43614480-43614502 TTTCTAAGTAAATAAAAATGTGG + Intergenic
1157213453 18:45763113-45763135 CTACTAAAAATACAAAAATGTGG - Intergenic
1157258063 18:46155928-46155950 GTTCTAAGAAGACATAGATGTGG - Intergenic
1157800123 18:50612646-50612668 ATTCTAAGAAGACAGGATTGGGG + Intronic
1158032485 18:52983020-52983042 TTACTAACAAGATAGAAATGGGG - Intronic
1158414571 18:57238486-57238508 TTTCTTTAAAGAAAAAAATGGGG - Intergenic
1158956798 18:62547864-62547886 TTGCTAAGAAGAAAAAAACAGGG - Intronic
1158987501 18:62833564-62833586 TTTCAAAAAAGGAAAAAATGAGG - Intronic
1159096606 18:63909020-63909042 TTTCTTAGCAGACAAAATGGGGG + Intronic
1159412530 18:68099248-68099270 TTTCTAGTAAAAAAAAAATGTGG - Intergenic
1159651094 18:70980429-70980451 TTTTTCAGAAGAAAAAACTGAGG - Intergenic
1159703993 18:71664319-71664341 TTTTAAAGAAAATAAAAATGAGG - Intergenic
1160316416 18:77851864-77851886 TCTCTGAAAAGACAAAAAGGAGG + Intergenic
1160340348 18:78084147-78084169 TTTCTCAGAAGAGGAAAGTGTGG - Intergenic
1160796076 19:946032-946054 TTTCTCAGCAGGGAAAAATGAGG + Intronic
1161449607 19:4337680-4337702 TTACTAAAAATACAAAAATTAGG + Intronic
1161505700 19:4642314-4642336 CTACTAAAAATACAAAAATGAGG + Intronic
1161682133 19:5685409-5685431 CTACTAAGAAGACAAAAATTAGG + Intronic
1162014061 19:7834350-7834372 TTTTTAAAAAAAGAAAAATGAGG + Intronic
1162206487 19:9060015-9060037 CTACTAAAAATACAAAAATGAGG + Intergenic
1162297501 19:9823522-9823544 CTACTAAAAATACAAAAATGTGG - Intronic
1162453765 19:10770023-10770045 TTTCAAAGATGACAAAACTGAGG - Intronic
1162549649 19:11351447-11351469 TGTCTAAAAAAAAAAAAATGAGG + Intronic
1162902589 19:13804168-13804190 CTTCTAAAAATACAAAAATTAGG + Intronic
1163016934 19:14462147-14462169 TTACTAAAAATACAAAAATTCGG + Intronic
1163252603 19:16135109-16135131 TTACTAAAAATACAAAAATTAGG + Intronic
1163257611 19:16166913-16166935 TTACTAAAAATACAAAAATTTGG + Intronic
1163277083 19:16291572-16291594 TTTCTCAGATGACAAAACTGAGG + Intergenic
1163298442 19:16428034-16428056 CTACTAAAAATACAAAAATGAGG + Intronic
1163526375 19:17824080-17824102 TTTCAAAAAAAAGAAAAATGCGG - Intergenic
1163731152 19:18950036-18950058 TTTCATAGAAGAGAAAACTGAGG + Intergenic
1163743105 19:19028849-19028871 CTACTAAAAATACAAAAATGTGG - Intronic
1164000609 19:21094938-21094960 TTCAAAAGAAGACAAACATGTGG - Intronic
1164108136 19:22127100-22127122 TTACTCTGAAGACAAACATGAGG - Intergenic
1164135788 19:22415087-22415109 TTTCAAAGAAGACACACATGTGG + Intronic
1164162620 19:22638001-22638023 CTTCGAAGAAGACATACATGTGG - Intronic
1164212289 19:23109711-23109733 TTACTAAAAATACAAAAATTAGG - Intronic
1164316544 19:24093081-24093103 TTCAAAAGAAGACAAACATGTGG - Intronic
1164619921 19:29689162-29689184 TTTCTAACAGGAAAAAAAGGAGG + Intergenic
1164630527 19:29758964-29758986 TTTCAAAAAAAAAAAAAATGTGG + Intergenic
1164640050 19:29818324-29818346 CTTCTAAAAATACAAAAATTAGG - Intronic
1165535083 19:36437301-36437323 CTTCTAAAAATACAAAAATTGGG - Intergenic
1165846420 19:38820807-38820829 TGTCTGAGAACAGAAAAATGGGG - Intronic
1166221338 19:41366621-41366643 CTACTAAAAATACAAAAATGAGG - Intronic
1166552146 19:43673033-43673055 CTACTAAGAATACAAAAATTAGG - Intergenic
1166608835 19:44170434-44170456 TTACTAAAAATACAAAAATTAGG + Intronic
1166726230 19:45029546-45029568 CTACTAAAAATACAAAAATGAGG + Intronic
1166901777 19:46069545-46069567 TTTATAAGAAGGGAAAAGTGTGG - Intronic
1167018760 19:46859407-46859429 CTACTAAAAATACAAAAATGAGG - Intergenic
1167064585 19:47174871-47174893 CTACTAAAAATACAAAAATGTGG - Intronic
1167086567 19:47313856-47313878 TTTTCCAGAAGAGAAAAATGAGG - Intronic
1167157284 19:47746665-47746687 TTACTAAAAATACAAAAATTAGG - Intronic
1167312124 19:48743028-48743050 TGTCTAAAAAGAAAAAAAAGAGG - Intronic
1167451839 19:49575161-49575183 CTACTAAAAATACAAAAATGAGG - Intronic
1167512792 19:49905010-49905032 CTTCTAAAAATACAAAAATTAGG - Intronic
1168036963 19:53727660-53727682 CTTCTAAAAATACAAAAATTAGG - Intergenic
924959675 2:22886-22908 CTTAAAAGAAGACAAACATGTGG - Intergenic
925607788 2:5676136-5676158 TTTTAAAGAAAACAAAAAAGTGG + Intergenic
926095346 2:10077943-10077965 CTTCTAAAAATACAAAAATTGGG + Intronic
926261008 2:11261650-11261672 TTACTAAAAATACAAAAATTAGG + Intronic
926379830 2:12275874-12275896 ATTCCAAGAAGACAAAATGGCGG - Intergenic
926436787 2:12846409-12846431 TTTCACAGAAGAGGAAAATGGGG + Intergenic
926455228 2:13059055-13059077 TTTCAAAGGAGACACTAATGAGG + Intergenic
926814378 2:16785826-16785848 TTACTAAAAATACAAAAATTAGG - Intergenic
927109584 2:19854850-19854872 TTACTAAAAATACAAAAATTAGG - Intergenic
927322631 2:21765167-21765189 GTTCCAAGAAGAAAAAATTGGGG - Intergenic
927348751 2:22080606-22080628 CTTCCAAGAAAACAGAAATGGGG + Intergenic
927761099 2:25754823-25754845 TTTCTGAGAAAAAAAAAAAGGGG + Intronic
928295254 2:30077118-30077140 GATCCAAGAAGAGAAAAATGTGG + Intergenic
928308085 2:30187677-30187699 CTTATAAGAAGAGAGAAATGTGG + Intergenic
928464376 2:31508081-31508103 TTCCAAAGAAGACATAAAAGTGG - Intergenic
928620072 2:33079759-33079781 TTCCTAAGAAGCCAGAAAGGAGG - Intronic
928633353 2:33216652-33216674 TTGCACAGGAGACAAAAATGTGG + Intronic
928715751 2:34058005-34058027 TTTCTGAGAAAATAAAAACGAGG - Intergenic
928774102 2:34737861-34737883 TTTCTAAGAAAAGAAAGGTGAGG - Intergenic
929056131 2:37877896-37877918 TTTGGAAGAGGATAAAAATGGGG + Intergenic
929367189 2:41174041-41174063 CTTCTAAAAATACAAAAAAGTGG + Intergenic
929655484 2:43727110-43727132 TTTCTAAGAAAACAAAAGGGCGG + Intronic
929717278 2:44325684-44325706 TTTTTAAAAACAGAAAAATGTGG - Intronic
929821401 2:45276887-45276909 TTTTTAAAAAGAGAAAAAAGAGG + Intergenic
930471133 2:51815495-51815517 TTGCTATAATGACAAAAATGAGG - Intergenic
930528953 2:52567617-52567639 TTCAAAAGAAGACAAATATGTGG - Intergenic
930698798 2:54439007-54439029 TTACTAAAAATACAAAAATTAGG - Intergenic
930904024 2:56544132-56544154 TTTGTAAGAAGAACAAAAAGAGG + Intergenic
930966968 2:57340676-57340698 TTTAAAAGAAGACATACATGTGG - Intergenic
930989690 2:57637908-57637930 TTTCTCAGAAGACAAAAGTGAGG - Intergenic
931282409 2:60805829-60805851 TTTTTCAGAAGAGAAAACTGAGG - Intergenic
931314050 2:61110377-61110399 CTTCTAAAAATACAAAAATTAGG + Intronic
931577213 2:63730968-63730990 TATCTTAAAAGACAAGAATGAGG + Intronic
931726235 2:65113766-65113788 TTTTTTAAAAAACAAAAATGAGG - Intronic
931942535 2:67268133-67268155 TTTCTAAGAAAAAAAATATCAGG + Intergenic
931984543 2:67729045-67729067 TTTCCAAGAGGACAAAATTAAGG - Intergenic
932176613 2:69608671-69608693 AATGTCAGAAGACAAAAATGAGG + Intronic
932211850 2:69937912-69937934 TTTCTACTAATACAAAAATTTGG - Intronic
932247770 2:70210673-70210695 TTTTTAATAAGAGAACAATGAGG + Exonic
932271302 2:70412512-70412534 TTTCAAAGGTGACAAAACTGAGG - Intergenic
932784796 2:74590634-74590656 TTTCTAAGAGGGCAGAAGTGGGG + Intronic
932845086 2:75126849-75126871 TTTCAAAGAAGACATACCTGTGG + Intronic
932941784 2:76175196-76175218 TTTATAAGAAGACAGAAATTTGG - Intergenic
933154253 2:78954110-78954132 CTACTAAAAATACAAAAATGAGG + Intergenic
933347854 2:81112278-81112300 TTTAAAAGAAGACATACATGTGG + Intergenic
933824908 2:86150504-86150526 CTGCTAAGAAGACACAAAGGTGG + Intronic
934674949 2:96243050-96243072 TCTCTAAAAATACAAAAATTAGG + Intergenic
935049372 2:99511298-99511320 TTTTTAAGAAGAGAGAAATTTGG - Intergenic
935597644 2:104891855-104891877 TTTCTAAATATACAAAAATATGG + Intergenic
935694235 2:105757243-105757265 TTTCACAGAAGACAAAACAGAGG - Intronic
936784224 2:116073870-116073892 TTTCACAGATGACAAAACTGAGG + Intergenic
936868290 2:117103137-117103159 TTTCAAAGAAGACATACATGTGG - Intergenic
936919734 2:117675645-117675667 TTTCTAAGAAAGCAAAGATGAGG + Intergenic
936923515 2:117713185-117713207 TTACTAAAAATACAAAAATTAGG - Intergenic
937476051 2:122216402-122216424 TTTCCAAGATGAGAAAAATGAGG - Intergenic
937520723 2:122710361-122710383 TTTCTGTGATGATAAAAATGGGG - Intergenic
937537796 2:122912779-122912801 TTTTAAAAAAGACAGAAATGAGG + Intergenic
937683013 2:124664849-124664871 CTACTAAAAATACAAAAATGAGG - Intronic
937870496 2:126782686-126782708 TTTTTAAGATAACAAAACTGAGG + Intergenic
937883599 2:126885930-126885952 TTTCTAAGAGCAGAAAAATAAGG - Intergenic
937898890 2:127000930-127000952 CTTATAAAAAGACAGAAATGTGG - Intergenic
938165074 2:129019022-129019044 TTACTAAGAATACAAAAATTAGG + Intergenic
938178591 2:129159633-129159655 AATCAAAGAAGACATAAATGTGG + Intergenic
938183348 2:129205384-129205406 TTTGTAGGAAGACTAAAATATGG - Intergenic
938257380 2:129869751-129869773 TTACTAAAAATACAAAAATTAGG - Intergenic
938394448 2:130932371-130932393 TTACTAAAAATACAAAAATTAGG - Intronic
938509426 2:131925268-131925290 TTCCTAAGGAAAAAAAAATGAGG + Intergenic
938860642 2:135364581-135364603 TTACTAAAAATACAAAAATTAGG + Intronic
939643499 2:144668795-144668817 GTTCTAAGAAGAATAAATTGTGG + Intergenic
939670883 2:145010631-145010653 TTTGTAAGAAAAAAAAAATCAGG - Intergenic
939812657 2:146853769-146853791 TTTTTAAGATGAGAAAAATGAGG - Intergenic
940031054 2:149261657-149261679 TTTTTGGGAAGATAAAAATGAGG + Intergenic
940088050 2:149883832-149883854 GGTCTAACAAGACAAAAATTGGG - Intergenic
940140980 2:150490306-150490328 TTTCTATGAAGAAAAACATGGGG - Intronic
940579439 2:155558935-155558957 TTTGAAAGAAGACATATATGAGG + Intergenic
940645908 2:156392954-156392976 CTACAAAGAATACAAAAATGTGG + Intergenic
941228769 2:162882744-162882766 CTTATAAGAAGAGAAAAATGTGG - Intergenic
941491357 2:166145912-166145934 ATACTAAGAAGAGAAAAATTTGG + Intergenic
941947779 2:171119125-171119147 CTTCTAAAAAGACATAAGTGAGG - Intronic
941958224 2:171226889-171226911 ATTCTAGGATGACAAAAATGAGG - Intronic
942237501 2:173926425-173926447 TCACCAAGAATACAAAAATGAGG + Intronic
942252659 2:174060830-174060852 TTTCACAGATGACAACAATGTGG - Intergenic
942525254 2:176846261-176846283 TTTATAAGAGGACATAAAAGAGG - Intergenic
942528222 2:176879181-176879203 TTTTTAAGATGAGAAAACTGGGG - Intergenic
942573486 2:177337860-177337882 TTTTTTGGAAGACAAAATTGAGG - Intronic
942822963 2:180138092-180138114 TTTCAAACAAGACACAGATGAGG + Intergenic
942835130 2:180286354-180286376 TTTCTCAGAAGACATACAAGTGG + Intergenic
942917535 2:181329561-181329583 TTCAAAAGAAGACAAACATGAGG + Intergenic
943334150 2:186593240-186593262 TTTCTATAAAGAGAAAAATTAGG - Intronic
943335319 2:186606532-186606554 TCTCTAAGAAGGCAAAAGGGAGG - Intronic
943943128 2:194024343-194024365 TTACTAAAAATACAAAAATTAGG - Intergenic
944163089 2:196687402-196687424 CTTAAAAGAAGACATAAATGTGG - Intronic
944164244 2:196701494-196701516 TTTCTAAAAAGAAATAAATCTGG + Intronic
944354727 2:198773754-198773776 TTTTTAAAGAGACAAAAAGGTGG + Intergenic
944461820 2:199957232-199957254 CTTCTAAAAATACAAAAATTAGG + Intronic
944957676 2:204831181-204831203 TTTCTATGAATAGAAAAATTAGG + Intronic
945660191 2:212676367-212676389 ATTCTAAAAAAAAAAAAATGAGG - Intergenic
946072063 2:217042668-217042690 TTTTAAAGAAGAGAAAACTGAGG + Intergenic
946131635 2:217611246-217611268 CTTCTCAGAGGACAAAAATGAGG - Intronic
946147939 2:217744823-217744845 TTGCTAAAAAGAGAAAAAGGAGG + Intronic
946259551 2:218475432-218475454 TTACTAAAAATACAAAAATTAGG + Intronic
946263696 2:218520100-218520122 TTACTAAAAATACAAAAATTAGG - Intronic
946517777 2:220431955-220431977 TTTCAAAAAAGACAAATTTGTGG - Intergenic
946687961 2:222290859-222290881 TTTAAAATAAGAAAAAAATGGGG + Intronic
946702395 2:222425742-222425764 CTTCTAGGAAGAACAAAATGTGG - Intronic
946770537 2:223084356-223084378 TTTTTAAGATGAGAAAACTGAGG - Intronic
947157200 2:227174669-227174691 CTTCTAAAAATACAAAAATTAGG - Intronic
947258890 2:228198565-228198587 CTTCTAGGAAGACAAGAATCGGG - Intergenic
947265597 2:228276255-228276277 TCTCAAAGAAGACATACATGTGG - Intergenic
947307786 2:228766055-228766077 TTACTAAGAATACAAAGTTGAGG - Intergenic
947662282 2:231878579-231878601 TTTCAAAGCAGAAAACAATGTGG + Intergenic
948043516 2:234924490-234924512 TTCCTAAGAAGGCATACATGCGG - Intergenic
948965452 2:241376197-241376219 TTTCTGTGACCACAAAAATGAGG - Intronic
1168825300 20:808780-808802 TTTGTAAGAGGACATAATTGGGG + Intergenic
1168825361 20:809449-809471 TTTCTAATCAGGAAAAAATGTGG - Intergenic
1168866102 20:1088007-1088029 TTTCTGAGATGATAAAATTGAGG + Intergenic
1169026734 20:2377823-2377845 TTTCTAAGAGTTCAAAAATTAGG + Intergenic
1169128029 20:3144921-3144943 ATTTTAAGAAGAAAAATATGAGG + Intronic
1169425823 20:5496763-5496785 TTGCAAACAAGAAAAAAATGTGG + Intergenic
1169818468 20:9683520-9683542 TGTGTAAGAAGACAACAAGGAGG - Intronic
1170185872 20:13589929-13589951 ATTCTAAAAACAGAAAAATGTGG + Intronic
1170190424 20:13639569-13639591 TTTCCAAAAACAAAAAAATGTGG - Intergenic
1170587753 20:17747972-17747994 TCTGTAAAAAGACAAAAAAGGGG - Intergenic
1170945048 20:20883969-20883991 TATCAAAGAAGACAAATTTGAGG + Intergenic
1171005460 20:21461102-21461124 CTACTAAAAATACAAAAATGTGG + Intergenic
1171022690 20:21600957-21600979 CTACTAAAAATACAAAAATGTGG + Intergenic
1171148104 20:22803348-22803370 TTTCTAAGATCAGAAAAGTGAGG + Intergenic
1171174397 20:23040615-23040637 TTTCTACAAAGAAAAACATGTGG + Intergenic
1171444594 20:25194893-25194915 TTTCTAGGAAGACAGAAAATGGG + Intergenic
1171477684 20:25425968-25425990 TTTATAAGATGAAAAAAATCTGG - Intronic
1171480679 20:25453736-25453758 TTTCTAAGAGCCCAAAACTGTGG - Intronic
1172150080 20:32784201-32784223 CTACTAAGAATACAAAAATTAGG - Intronic
1172733615 20:37109368-37109390 TTACTAAAAATACAAAAATTAGG + Intronic
1172783980 20:37453948-37453970 TTGCGAAGAAGAGAAAAAGGTGG - Intergenic
1173313690 20:41924144-41924166 TTTCACAGAAGAGAAAACTGAGG - Intergenic
1173345334 20:42194181-42194203 TTTCAAAGATGAATAAAATGAGG - Intronic
1173664558 20:44755116-44755138 TTTTTAAAAAGACTAAAATAGGG + Intronic
1174131090 20:48343757-48343779 TTTCCCAGAAAACAAAGATGAGG + Intergenic
1174363929 20:50044857-50044879 TTTTGAAGAAGAGAAAACTGAGG - Intergenic
1174475995 20:50795828-50795850 TTTCTAAGAAAACTAGAATTGGG - Intronic
1174742592 20:53029870-53029892 TTTCTAATATGAAAAAAATTGGG - Intronic
1175073709 20:56356303-56356325 TCTCTAGGGAGAAAAAAATGAGG + Intergenic
1175426843 20:58872936-58872958 TTTACAAGAAGGCCAAAATGTGG - Intronic
1175599233 20:60259333-60259355 TTTCTTAGAGGGCAAAAATCAGG + Intergenic
1175641918 20:60637656-60637678 TTTTTAGGAAGAGAAAAATATGG + Intergenic
1176009270 20:62883524-62883546 CTACTAAGAATACAAAAATTGGG + Intronic
1176199188 20:63852652-63852674 TTACTAAAAATACAAAAATTAGG + Intergenic
1176317402 21:5259676-5259698 TTTGAAAGAAGACATACATGAGG - Intergenic
1176784054 21:13233294-13233316 TTCCTAAGGAAAAAAAAATGAGG - Intergenic
1176902962 21:14465743-14465765 TTTAAAAGAAGACATACATGTGG - Intergenic
1177178809 21:17723160-17723182 TTTATAAAAAGAAAAAAATTAGG + Intergenic
1177314804 21:19444929-19444951 TTTTTAAAATGAAAAAAATGAGG - Intergenic
1177565944 21:22820049-22820071 TTTTTAAGAAGATATAAATAGGG - Intergenic
1177584538 21:23073284-23073306 TTCCTAAGAAGACATTTATGTGG + Intergenic
1177823060 21:26052963-26052985 TTTTTAAAAAGTCAAAAATAGGG - Intronic
1177982104 21:27927126-27927148 TTCCTAAGGAAAAAAAAATGAGG - Intergenic
1178031815 21:28536338-28536360 TGTATAAGAAAACAAAAATGTGG + Intergenic
1178096441 21:29220789-29220811 TTTCTAGGAAGACCAAAAGGAGG - Intronic
1178135367 21:29621308-29621330 TTCCTAAGAACACTCAAATGTGG + Intronic
1178192065 21:30294909-30294931 CTACTAAAAATACAAAAATGAGG - Intergenic
1178352945 21:31885897-31885919 TTACTAAAAATACAAAAATTAGG - Intronic
1178530996 21:33375842-33375864 CTTCTAAAAATACAAAAATTAGG + Intergenic
1178787809 21:35670137-35670159 TTTCAAAGAAGACATAAAAATGG - Intronic
1178816348 21:35933424-35933446 TTTAAAAGAAGAAAAGAATGAGG + Intronic
1179106880 21:38408961-38408983 TTTTACAGAAGAGAAAAATGAGG - Intronic
1179128284 21:38611664-38611686 ATGCTAAGGAGAGAAAAATGAGG - Intronic
1179529390 21:42008980-42009002 TGTTTAAGAAGACAAGAAAGTGG - Intronic
1180094303 21:45548577-45548599 CTACTAAAAATACAAAAATGAGG + Intergenic
1180507894 22:16035390-16035412 TTCCAAAGAAGGCAAAAAAGCGG + Intergenic
1180660850 22:17465781-17465803 CTACTAAGAATACAAAAATTAGG - Intronic
1181122614 22:20682000-20682022 TTACTAATAATACAAAAATTTGG - Intergenic
1181179813 22:21059085-21059107 TTACTAATAATACAAAAATTTGG + Intronic
1181553065 22:23652122-23652144 TTACTAAAAATACAAAAATTAGG - Intergenic
1181619457 22:24078769-24078791 TTTATCAGAAGACAAATTTGTGG - Intronic
1181840494 22:25655052-25655074 TTACTAAACTGACAAAAATGAGG - Intronic
1181887441 22:26032442-26032464 GTTCTTATAAGAGAAAAATGTGG - Intergenic
1181940183 22:26469929-26469951 TTTCCCAGAAGAGAAAATTGAGG + Intronic
1182053493 22:27331290-27331312 TTTTACAGAAGACAAAACTGAGG - Intergenic
1182175821 22:28287544-28287566 TTGCTAAGGAGTCAAAGATGAGG + Intronic
1182330758 22:29550199-29550221 TTTCACAGATGACAAAACTGAGG + Intronic
1182383276 22:29911961-29911983 TTTGTAAGAAAACAATAAAGAGG - Intronic
1182523115 22:30896182-30896204 TTACTAAAAATACAAAAATTAGG - Intronic
1182784291 22:32893718-32893740 TTTCCAAGCAGACAAAATAGAGG - Intronic
1182837375 22:33354293-33354315 TTTCTAAGTATATAGAAATGAGG - Intronic
1183011381 22:34949737-34949759 TTTCGAAGATGAGAAAACTGAGG - Intergenic
1183084235 22:35476831-35476853 TTTTCAAGGAGACGAAAATGGGG - Intergenic
1183859998 22:40662941-40662963 CTACTAAGAATACAAAAATTAGG + Intergenic
1184000313 22:41668518-41668540 TTACTAAAAATACAAAAATTAGG - Intergenic
1184009740 22:41738286-41738308 TTACTAAAAATACAAAAATTAGG + Intronic
1184178660 22:42804678-42804700 CTTCTAAAAATACAAAAATTAGG - Intronic
1184939850 22:47755951-47755973 TTTATAAGGAAAAAAAAATGAGG + Intergenic
949337392 3:2990724-2990746 TTTATAACCACACAAAAATGAGG - Intronic
949702108 3:6770443-6770465 TTTCTGTGAAAACTAAAATGAGG + Intronic
949769534 3:7564323-7564345 TTTCACAGATGAAAAAAATGAGG + Intronic
949781464 3:7693538-7693560 TTGCAAACATGACAAAAATGAGG - Intronic
950768248 3:15290226-15290248 CTTCTAAAAATACAAAAATTAGG + Intronic
950790438 3:15467305-15467327 TTTTAAAGATGACAAAACTGAGG - Intronic
951017323 3:17744746-17744768 TTTCGCAGAACACAAAAAGGTGG - Intronic
951108115 3:18769319-18769341 TTTCTCAGAAAACAAAAATTTGG + Intergenic
951205475 3:19921998-19922020 CTTCTAAAAATACAAAAATTAGG + Intronic
951433688 3:22637507-22637529 TTTCAAAGAAGACATTCATGTGG - Intergenic
951598923 3:24350873-24350895 TTCATAAGAATACAAACATGTGG + Intronic
951789474 3:26463868-26463890 TTTCCAGGAAGAAAAAAATCAGG - Intergenic
951993954 3:28706120-28706142 TTTATTAGAAAAAAAAAATGGGG - Intergenic
952000903 3:28784795-28784817 TTTTTAAGCAAACAAAGATGTGG + Intergenic
952231539 3:31435984-31436006 TTTAGAAGAAGATAAAAATTGGG + Intergenic
952438654 3:33299758-33299780 TTTCCAATAAGACAAATATTTGG + Intronic
952744344 3:36763693-36763715 TTTCTCAGATGAGAAAACTGAGG - Intergenic
953030115 3:39174375-39174397 TTCAAAAGAAGACAAACATGTGG - Intergenic
953325103 3:42006381-42006403 TCTCTAAGAAAAAAAAAAGGGGG + Intergenic
953325110 3:42006430-42006452 TCTCTAAGAAAAAAAAAAGGGGG + Intergenic
954062778 3:48082635-48082657 TTACTAAAAATACAAAAATTAGG + Intronic
955011015 3:55014326-55014348 TTTACAAGAAGTGAAAAATGAGG - Intronic
955100933 3:55849120-55849142 TTTCTATGTGGACAAAACTGAGG + Intronic
955352306 3:58202848-58202870 TGTCTAAAAAAAAAAAAATGAGG + Intronic
956017881 3:64903096-64903118 TTTCAAACATGAGAAAAATGTGG - Intergenic
956405792 3:68927552-68927574 TTTTTAAAAAGATAAAAATATGG - Intronic
956565848 3:70637831-70637853 TTCCTAAGAAGACAAACATATGG - Intergenic
956631261 3:71318867-71318889 ATTCCAAGAAGTGAAAAATGGGG - Intronic
956638725 3:71394209-71394231 GTTCTGAGAAAACAAAAATCCGG - Intronic
956910381 3:73810042-73810064 TATCTGAGAGGACAAAAAGGAGG - Intergenic
957297518 3:78352135-78352157 TTTCTCAGAAGAAAAGACTGAGG + Intergenic
957406809 3:79782411-79782433 TTTTTAACAAAACATAAATGGGG + Intergenic
957708838 3:83826673-83826695 TTTCTAAGAAAACAAGTATTTGG + Intergenic
957726479 3:84073173-84073195 TTTCTCAGATGACAAATAGGAGG - Intergenic
957863310 3:85988775-85988797 TTTCTAAGATGAAAAATAAGTGG - Intronic
958001476 3:87755219-87755241 TTTCTAAAAACTAAAAAATGAGG + Intergenic
958022017 3:88009046-88009068 TTCCAAAGAAGACATACATGCGG + Intergenic
958053898 3:88384904-88384926 TTTCTGAGATGACAAAGATTGGG + Intergenic
958529431 3:95307877-95307899 TTTCAAAGAAGACATATAAGTGG - Intergenic
958807544 3:98830026-98830048 TTCCAAAGAAGACACATATGTGG - Intronic
958854505 3:99368269-99368291 TTTGAAAGAAGACATACATGCGG - Intergenic
958983083 3:100747839-100747861 TTTCTAGGAAGACCAAAAATGGG - Intronic
959080165 3:101792055-101792077 CTTCTCAGAAGACACACATGCGG - Intronic
959337938 3:105089787-105089809 TTTCTAAGAAAACAATACAGTGG + Intergenic
959388596 3:105744559-105744581 TTCTTAAAAAGACAAAAATATGG + Intronic
959509486 3:107194474-107194496 TTTTTTAAAAGACAAATATGTGG + Intergenic
959519697 3:107311272-107311294 TTCCAAAGAAGACATACATGTGG - Intergenic
959899820 3:111648167-111648189 ATTTCAATAAGACAAAAATGGGG - Intronic
960179300 3:114555996-114556018 TTTTTAAAAAGGCAAAAAAGTGG - Intronic
960218024 3:115066641-115066663 ATACTAAGAAGTCAGAAATGAGG - Intronic
960363273 3:116740245-116740267 TTTCTAAGTTGAGAAAACTGGGG + Intronic
960711854 3:120538221-120538243 CTACTAAAAATACAAAAATGAGG - Intergenic
960853584 3:122080126-122080148 TTTCTGAGAAAACAAGAATCAGG + Intronic
960887675 3:122413182-122413204 TTTCAAAGAAGACATACAAGTGG + Exonic
961372543 3:126440386-126440408 TTTCATAGATGACAAAACTGAGG + Intronic
961604556 3:128083911-128083933 CTACTAAAAAGACAAAAATTAGG + Intronic
962017549 3:131457727-131457749 TTTCTACTCTGACAAAAATGAGG + Intergenic
962042415 3:131720829-131720851 TTTCCAAGAAGCCAAATCTGAGG - Intronic
962362600 3:134754752-134754774 TTTTTAAGAAGACAAAAGTATGG - Intronic
962451881 3:135526297-135526319 TTTGGAAGAAGATAAAGATGTGG + Intergenic
962877085 3:139543322-139543344 TTACTAAAAATACAAAAATTAGG + Intergenic
962986047 3:140536952-140536974 TTTCATCTAAGACAAAAATGTGG - Intronic
963037553 3:141045659-141045681 TTTCATATAAGAGAAAAATGAGG + Intergenic
963136118 3:141906342-141906364 CTTCTAAAAATACAAAAATTAGG - Intronic
963157391 3:142113686-142113708 ATTCCAAGATGACAAAAATGGGG + Intronic
963236125 3:142958613-142958635 TTTCTAAGAATGCAAAATTTTGG - Intronic
963424165 3:145103027-145103049 TTTCAAAGAATACAAAAAGAGGG + Intergenic
963706412 3:148693735-148693757 ATGTAAAGAAGACAAAAATGAGG - Intergenic
963768099 3:149359511-149359533 TTCCAAAGAAGACAAACAAGTGG + Intergenic
964051791 3:152402713-152402735 TTTGAATGAAGAAAAAAATGGGG + Intronic
964151886 3:153535521-153535543 TTTCTCAGAAGACATAAAAATGG + Intergenic
965066154 3:163852344-163852366 TTTCTTTGACGACAAGAATGTGG + Intergenic
965106609 3:164363601-164363623 TTTCTAAGAAGAGGTAAATTGGG + Intergenic
965368675 3:167832525-167832547 TCTCAAAGAAGACAAAAAAGTGG - Intergenic
965434510 3:168632290-168632312 TTACTAAAAATACAAAAATTAGG - Intergenic
965464619 3:169012518-169012540 TTCCAAAGAAGACATACATGTGG - Intergenic
965567837 3:170139856-170139878 TTTCTAAGAAGAAGAATATTAGG + Intronic
965656794 3:170995120-170995142 TTTTTAAAAAAACAAAAATTTGG + Intergenic
965725254 3:171709041-171709063 TCTCTAAGCAGAGAAAAATCAGG - Intronic
965739380 3:171857740-171857762 TTTCAAAGAAGACATACAGGTGG + Intronic
965965512 3:174484029-174484051 TTTGTAAGAATAGAAAACTGAGG - Intronic
965967127 3:174506343-174506365 CTTCTAAAAATACAAAAATTAGG - Intronic
965978535 3:174657190-174657212 TCTCTACAAAAACAAAAATGTGG - Intronic
966056955 3:175705214-175705236 TTTCACAGAAGAGGAAAATGAGG + Intronic
966103509 3:176306217-176306239 TTTTAAGGTAGACAAAAATGTGG - Intergenic
966230313 3:177644222-177644244 TTTCTAAGATGACAGAAATAAGG + Intergenic
966307589 3:178554113-178554135 TTTCTCAGATGAGGAAAATGAGG + Intronic
966351713 3:179038411-179038433 TCTCTAAAAAAAGAAAAATGAGG + Intronic
966433379 3:179856122-179856144 TTTTTCAGAAGAGAAAACTGAGG - Intronic
966501474 3:180646258-180646280 TTCTTAAGAAGACAAAATTTTGG - Intronic
966630176 3:182064024-182064046 TTGCTCAGAAAACAAAACTGAGG - Intergenic
966637331 3:182150380-182150402 TTTTTAAGAAGAAAAGAAAGAGG - Intergenic
966713652 3:182994076-182994098 TTTAAAAGAAGACACACATGCGG - Intergenic
966823848 3:183946969-183946991 TTTCTTAGAAGACTAGAAAGAGG + Intronic
966949474 3:184803331-184803353 TCTCTAAGATGAGAGAAATGAGG - Intergenic
967119042 3:186366282-186366304 TTTCTAAGAAAACTAAAATGAGG - Intergenic
967147268 3:186616804-186616826 CTACTAAAAATACAAAAATGTGG + Intronic
967225115 3:187283685-187283707 TTTGAAAGTAGAGAAAAATGTGG + Intronic
967616863 3:191580293-191580315 CTACTAAGAATACAAAAATTAGG + Intergenic
967696227 3:192534554-192534576 TTTCTAAAAATACAAAAATTAGG - Intronic
967704196 3:192630856-192630878 TTTCTAAGAAAAAAAAAAGTGGG - Intronic
968221130 3:196941255-196941277 TTACTAAAAATACAAAAATTAGG - Intronic
968711581 4:2123323-2123345 CTACTAAGAATACAAAAATTAGG + Intronic
969149121 4:5153333-5153355 TTTCTCAGAAGACAAAAGGGAGG - Intronic
969182748 4:5454702-5454724 TTTCACAGAAGACAAAACCGAGG - Intronic
969186108 4:5475532-5475554 TTACTAAAAATACAAAAATTAGG + Intronic
969727713 4:8933276-8933298 TTTGTAACAAGACACAATTGGGG + Intergenic
970043845 4:11827403-11827425 TGTCTAAGAAGTGAAAACTGAGG + Intergenic
970083874 4:12323120-12323142 TTTTTAAGAACACCAAAATAGGG - Intergenic
970112816 4:12657796-12657818 CTTATTAGAAGAGAAAAATGTGG + Intergenic
970412940 4:15827760-15827782 TTTAAAAGAAGGCAAAAATAAGG - Intronic
970628500 4:17916165-17916187 TGTGTAAGAAAACAAAAATTAGG - Intronic
970657063 4:18242856-18242878 TTTCAAAGATGTCAAAACTGAGG + Intergenic
970712381 4:18878265-18878287 TTTCTCAAAAGAAAAACATGAGG + Intergenic
971098137 4:23431624-23431646 TTTCTAATACGACCACAATGAGG + Intergenic
971134436 4:23852627-23852649 TTTCTATGAAGAAAAAAAAACGG - Intronic
971310991 4:25525653-25525675 TTTTTTAGATGACAAAACTGGGG - Intergenic
971384367 4:26129552-26129574 TTTTTCAGATGAGAAAAATGAGG - Intergenic
971548080 4:27912705-27912727 TTTCTAAAATGAGAAAAATATGG + Intergenic
971821503 4:31561765-31561787 TTTCTAAAAAGACTAAGATAAGG - Intergenic
971950291 4:33335934-33335956 TTTCTAAGATGTGAAAAATGAGG + Intergenic
971995135 4:33955332-33955354 CTGCTAAGAAGACACACATGGGG + Intergenic
972107693 4:35511480-35511502 TTTCTAAGAAGACATACAGGTGG - Intergenic
972372703 4:38440111-38440133 TTTCTCAGATGACTAAGATGTGG + Intergenic
972425433 4:38928232-38928254 TCTCTAAGAAGAAAATACTGTGG - Intronic
972718359 4:41671795-41671817 TTACTAAAAATACAAAAATTAGG + Intronic
972739394 4:41876363-41876385 TTTCACAGAAGACAAAACTGAGG + Intergenic
972746457 4:41936764-41936786 TATCTTAAAAGACAAAAAAGGGG - Intronic
972803193 4:42499316-42499338 TTTCCTAGAAAACAAAAGTGGGG - Intronic
973124296 4:46565265-46565287 TTCAAAAGAAGACAGAAATGTGG - Intergenic
973243493 4:47984451-47984473 TTACTAAAAATACAAAAATTAGG + Intronic
973270893 4:48262359-48262381 TTACTAAAAATACAAAAATTAGG - Intronic
973802242 4:54490475-54490497 TTTCTTATAAAAGAAAAATGTGG - Intergenic
973945978 4:55956234-55956256 ATTCTAATGAGACAAAATTGTGG + Intronic
974198334 4:58605784-58605806 TTTTAAAGAAGACATACATGTGG - Intergenic
974360095 4:60866208-60866230 TTTCTAAGAGGAAAAAAAAGAGG + Intergenic
974430360 4:61789212-61789234 GTTCCAAGAAAACAAAAATTTGG - Intronic
974678017 4:65121555-65121577 TTTCTAGGAAAAAAAAAATCAGG + Intergenic
974801180 4:66820399-66820421 TGACTAAGAAGGAAAAAATGTGG - Intergenic
974862285 4:67537354-67537376 TTCATAAGAAAACAAAAGTGAGG + Intronic
974971684 4:68837373-68837395 TGTTTAAGAAAACAAAAATGAGG + Intergenic
975020187 4:69476476-69476498 TTACTAAAAATACAAAAATTAGG - Intergenic
975248534 4:72149448-72149470 TTTCTCAAAAGACTAGAATGTGG - Intergenic
975476856 4:74833506-74833528 TTACTAAAAACACAAAAATTAGG + Intergenic
975682322 4:76889094-76889116 CTTCTAAAAATACAAAAATTAGG + Intergenic
975768192 4:77691867-77691889 TTAGTTAGAACACAAAAATGTGG + Intergenic
975896639 4:79100447-79100469 TTTCAAAGAAGACATACATGTGG - Intergenic
975948946 4:79744445-79744467 TTTTGAAGAAAAAAAAAATGAGG - Intergenic
976060018 4:81116802-81116824 TCTCAAAGAAGACATACATGTGG - Intronic
976474076 4:85462451-85462473 TTTTTAAGAAAAAAAAAATGGGG + Intergenic
976665969 4:87592474-87592496 TTTCTCAGAAGACAAACAGATGG + Intergenic
976677893 4:87723626-87723648 TTTCAAAGAAGCCAACAGTGTGG + Intergenic
976850021 4:89534292-89534314 TCTCAAAGAAGACATACATGTGG - Intergenic
976955575 4:90894589-90894611 TTGAGAAGAAGACAAAAAAGGGG - Intronic
977063539 4:92285583-92285605 TTTCCAAGAAAAAAAAAATATGG - Intergenic
977108087 4:92915849-92915871 TTCATAAGAAGACATACATGTGG - Intronic
977260469 4:94791151-94791173 TTACTAAAAATACAAAAATTAGG - Intronic
977283918 4:95078117-95078139 CTACTTAGAAGACAATAATGTGG - Intronic
977381136 4:96275021-96275043 TTTCTTAAAAGGCAAAAATCAGG - Intergenic
977597409 4:98898306-98898328 CTTCTAAGACGGCAAAAATGCGG + Intronic
978679678 4:111364738-111364760 TCTCAAAGAAGACATACATGTGG + Intergenic
979028471 4:115607899-115607921 TCTCTGAGAAGGCAAATATGGGG - Intergenic
979374488 4:119929727-119929749 CTTAAAAGAAGACAACAATGAGG - Intergenic
979479664 4:121201469-121201491 TTTCTAAGAAGACATAAATATGG + Intronic
980002331 4:127505163-127505185 TTTGTTAGAAGACAAAGATTTGG + Intergenic
980154230 4:129085221-129085243 TTTAAAAGAAGACATATATGCGG + Intronic
980306677 4:131070231-131070253 TTTTTATTAAGAAAAAAATGAGG + Intergenic
980555477 4:134397910-134397932 TTCAAAAGAAGACATAAATGTGG - Intergenic
981394577 4:144233081-144233103 TTTGTAAGAATAAAAAAATCAGG + Intergenic
981638913 4:146912847-146912869 ATTTTAAGGAGACAAAAATATGG + Intronic
981778100 4:148393653-148393675 TTAATAAGAAGACAGAAATCAGG + Intronic
981802517 4:148674738-148674760 TTTCTAAAAAGGCAAAACTATGG - Intergenic
981829987 4:148988298-148988320 CTACTAAGAATACAAAAATTAGG - Intergenic
981968739 4:150638493-150638515 TTTTCAAGAACACAAAACTGGGG + Intronic
982212387 4:153048978-153049000 CTTCTCAGAAGACATATATGTGG - Intergenic
982502952 4:156181412-156181434 TTTATAAGAAGAAAAAAACATGG + Intergenic
982609263 4:157552345-157552367 GTTCCAAGAAAAAAAAAATGAGG - Intergenic
982776531 4:159447260-159447282 TTTCAAAGATGAGAAAATTGAGG + Intergenic
982852253 4:160333748-160333770 TTAGTAAGAAGAAAAAAATAAGG + Intergenic
982910317 4:161133363-161133385 TTCTAAAGAAGACATAAATGTGG - Intergenic
983638562 4:169923339-169923361 TTGCTAGGAAAACAAAAAAGTGG - Intergenic
984251257 4:177337852-177337874 CTACTAAAAACACAAAAATGAGG + Intronic
984624780 4:181994986-181995008 TTTCTAAGAAAAGTAGAATGAGG + Intergenic
985232447 4:187835665-187835687 TTTCTAGAAAAAAAAAAATGAGG + Intergenic
985238149 4:187899521-187899543 TTTGTAATAAGATAATAATGCGG + Intergenic
985372041 4:189296005-189296027 ATCCAAAGAAGACAAAGATGAGG - Intergenic
985581691 5:699803-699825 TTACAAAGAAGACACAAAAGTGG + Intergenic
985596311 5:791118-791140 TTACAAAGAAGACACAAAAGTGG + Intergenic
985811001 5:2085107-2085129 TTTCTAAGATGAAAAATATATGG + Intergenic
986427081 5:7644308-7644330 TCCCCAAGTAGACAAAAATGTGG - Intronic
986483681 5:8214249-8214271 TTTCTAAAAAGAAAGAAAGGGGG - Intergenic
986653411 5:9987634-9987656 TTTCAAAGAAGACAGAAGAGAGG - Intergenic
986808906 5:11335053-11335075 CTACTAAGAAGACAAGAAGGAGG - Intronic
986836634 5:11646313-11646335 TTTATAATGAGGCAAAAATGAGG + Intronic
986974239 5:13377275-13377297 TGTCTAAGAAGACAGAAATGTGG + Intergenic
987023403 5:13898617-13898639 TTTCGTAGATGACAAAACTGTGG - Intronic
987129097 5:14843958-14843980 CTTCGAGGAAGAGAAAAATGTGG - Intronic
987341786 5:16946029-16946051 TTTGTAAAAATACAAAAATTAGG + Intergenic
987384125 5:17312869-17312891 TTTCAGTGAAAACAAAAATGGGG + Intergenic
987552746 5:19405191-19405213 TTTCTCACAAGAGAAAAAAGTGG + Intergenic
987608541 5:20171500-20171522 TTTAAAAGAAGACATACATGTGG - Intronic
987803555 5:22731089-22731111 CTTCTAAGAAGTCCAAAGTGTGG - Intronic
987871382 5:23623022-23623044 TTTCTAAGAAAGCAAAAACAGGG + Intergenic
987873911 5:23655467-23655489 TTTATAAGAATAGAAAAATCAGG + Intergenic
987969115 5:24919251-24919273 TTACTAAGATGAAAAAAATTAGG - Intergenic
988333081 5:29868427-29868449 TTTTAAACAAAACAAAAATGGGG - Intergenic
988340794 5:29968510-29968532 TTTAAAAGAAGACATACATGTGG + Intergenic
988536794 5:32075870-32075892 TTTCTATTAAAACAAAAATAAGG - Intronic
988651334 5:33154928-33154950 TTTTGTAGAAGATAAAAATGAGG + Intergenic
988866402 5:35339826-35339848 CTTCTAGGAAGAGAAGAATGTGG + Intergenic
989202558 5:38778954-38778976 TTTATAAGAAGGGAAAAATATGG + Intergenic
989298953 5:39865477-39865499 TTTCAAAAAAGACACACATGTGG - Intergenic
989301455 5:39899003-39899025 TTTATAAGAAGAAGAACATGTGG + Intergenic
989425211 5:41289058-41289080 TTTCTAATTAGAAAAAAATCAGG - Intergenic
989782356 5:45283499-45283521 TTCCAAAGAAGACATACATGCGG + Intronic
989974349 5:50565387-50565409 TTTCTATGAAGAAAAACATTAGG - Intergenic
989982613 5:50662492-50662514 TTTCTAAGAAAAAGAAAAAGAGG + Intergenic
990223581 5:53623881-53623903 CTACTAAGAATACAAAAATTAGG - Intronic
990738876 5:58892277-58892299 TTTTGAAGAAGAGAAATATGAGG - Intergenic
991141163 5:63244759-63244781 TTTGTAAAAATATAAAAATGTGG + Intergenic
991227943 5:64294403-64294425 TTTCAAAGAAGAAAAATATCTGG + Intronic
992153678 5:73932573-73932595 TTGCTAAGAAGACAAGGATTAGG + Intronic
992502854 5:77359005-77359027 TTTCTCAGGAAAAAAAAATGTGG - Intronic
992682715 5:79168663-79168685 TTACTAAGAATACGAAAATGAGG + Intronic
992700271 5:79334724-79334746 TTTTTAATCAGAAAAAAATGAGG + Intergenic
992735209 5:79712511-79712533 TTTTTAAGAAGAAAAAAAATAGG - Intronic
992757211 5:79919088-79919110 TTTAAAAGAAGACATACATGTGG + Intergenic
992794365 5:80242451-80242473 TTACTAAAAATACAAAAATTAGG + Intronic
993114373 5:83702405-83702427 TTGCTAACAAGACAAAATTCTGG - Intronic
993176496 5:84492962-84492984 TATCTCAGAAGAAAAAAAAGTGG + Intergenic
994114640 5:96048660-96048682 TGTCTAAGAAAAAAAAAATCAGG - Intergenic
994358590 5:98824285-98824307 TTCATCAGAAGACAAAATTGTGG + Intergenic
994606809 5:101977986-101978008 TTTCAAACAAAACTAAAATGTGG + Intergenic
994609038 5:102012379-102012401 TTTAAAAGAAGAAATAAATGTGG - Intergenic
994970937 5:106735906-106735928 TTTAAAAGAAGACATACATGTGG + Intergenic
995020473 5:107361422-107361444 TTTTTAAGAAGATAAATATATGG + Intergenic
995109692 5:108415112-108415134 TTTCTATGAAGTCCAAAATTTGG - Intergenic
995138738 5:108708724-108708746 CTTCTAGGAAAACAAAAATGGGG + Intergenic
995364923 5:111347671-111347693 TTTATAAGAAGAGAGAAATCTGG - Intronic
995547768 5:113249945-113249967 TTTCCAAGAAGCCAAAAAAGTGG + Intronic
995847361 5:116508667-116508689 TTTTTAAGAAGTCAAAAATCTGG - Intronic
995847971 5:116514405-116514427 TCTCAAAGAAGACATACATGTGG - Intronic
996204606 5:120716708-120716730 CTTCTAAAAATACAAAAATCTGG + Intergenic
996219382 5:120910912-120910934 TTTCTAAAAAGAAGAAATTGAGG + Intergenic
996253755 5:121372214-121372236 TTTCCAAGAGGAAATAAATGGGG - Intergenic
996651833 5:125887275-125887297 ATAGTAAGAAGCCAAAAATGTGG - Intergenic
996918270 5:128736053-128736075 TTTTGAAGTAGACAAATATGTGG - Intronic
996943706 5:129042077-129042099 TTTCTAATAAGACAAATAGTTGG - Intergenic
997264724 5:132488531-132488553 TTTCCGAGAAGAGAAAACTGAGG - Intronic
997937977 5:138131064-138131086 TTACTAAAAATACAAAAATTAGG + Intronic
998116430 5:139541294-139541316 TTTCGAAGAAAAAAAAAAAGCGG + Intronic
998389772 5:141780052-141780074 TATTTAACAAGACAAAAAAGTGG - Intergenic
998477635 5:142434994-142435016 TTACTAAAAATACAAAAATTAGG + Intergenic
998740776 5:145198838-145198860 TTTTTAAGATGAAGAAAATGAGG + Intergenic
998859843 5:146431827-146431849 TTTGAAAGAAGACATACATGCGG - Intergenic
999310977 5:150551985-150552007 TTTGTAAGAGGAGGAAAATGGGG + Intronic
999669884 5:153949778-153949800 TGTCAAAAAAGAGAAAAATGGGG - Intergenic
999685371 5:154098017-154098039 TTTAGCAGAAGACAAAACTGAGG + Intronic
999685751 5:154101640-154101662 TTTCTCAAAAGACAAACATGTGG - Intronic
999693029 5:154165369-154165391 TTTTACAGATGACAAAAATGAGG - Intronic
999717247 5:154371222-154371244 TTTTTAAGAAGAGAGAAATCTGG - Intronic
1000372707 5:160552480-160552502 TCTTTAAGATGACAAAACTGAGG - Intergenic
1000585001 5:163086564-163086586 TTTTTAAAAAGACAAATATCTGG - Intergenic
1000654505 5:163860024-163860046 TCTCAAAGAAAACAAAAATCAGG - Intergenic
1000859304 5:166437352-166437374 TTCTTAAGATGAAAAAAATGAGG - Intergenic
1001031665 5:168267688-168267710 TTTCTAAAATAATAAAAATGAGG - Intergenic
1001185819 5:169570879-169570901 TTTCTAAGAAATCAAAATTAAGG + Intergenic
1001737729 5:174020411-174020433 TTTAAAAGAAAAGAAAAATGTGG - Intergenic
1001755902 5:174168363-174168385 TTTCTCAGCAGAAAAAAATGAGG - Intronic
1001770143 5:174289179-174289201 TTTATAAAAAGACAAAATTGGGG + Intergenic
1001810225 5:174621935-174621957 CTACTAAGAATACAAAAATTAGG + Intergenic
1001876978 5:175210227-175210249 TTTATAAGAGGTAAAAAATGAGG - Intergenic
1001913176 5:175537852-175537874 TTTTTAAGGAGAAAAAAATAAGG - Intergenic
1002812869 6:650912-650934 TTTCTAAAAAGGAAAAAATTTGG + Intronic
1002821151 6:726031-726053 TTTGAAAGAAGACATACATGTGG + Intergenic
1002973685 6:2051669-2051691 TTCCAAAGAATACAAAAATAGGG - Intronic
1003162069 6:3644608-3644630 TGGCTAAGAAGACAAAACAGTGG + Intergenic
1003196769 6:3921564-3921586 CTACTAAAAATACAAAAATGAGG - Intergenic
1003282732 6:4708322-4708344 TTACTAAAAATACAAAAATTAGG - Intronic
1003910506 6:10739787-10739809 TTACTAAAAATACAAAAATTAGG - Intergenic
1003958140 6:11185146-11185168 GTTCTGAGAAGAAAAAAAAGAGG - Exonic
1004357361 6:14941564-14941586 CTACTAAAAAAACAAAAATGAGG + Intergenic
1004545498 6:16594645-16594667 CTTCTAAAAATACAAAAATTAGG - Intronic
1004669875 6:17785637-17785659 TTTCTCTGCAGAAAAAAATGAGG + Exonic
1005143555 6:22662333-22662355 CTACTAAAAATACAAAAATGAGG - Intergenic
1005633213 6:27728516-27728538 GTTTTAGGAAGACAAAACTGAGG + Intergenic
1006017359 6:31092627-31092649 CTTCTAAAAATACAAAAATTAGG + Intergenic
1006177851 6:32133678-32133700 TTACTAAAAATACAAAAATTAGG + Intergenic
1006464240 6:34181929-34181951 TCTCAAAGAAAAAAAAAATGAGG + Intergenic
1006506751 6:34494027-34494049 TTTGACAGAAGACAAAACTGAGG + Intronic
1006538114 6:34716569-34716591 TTACTAAAAATACAAAAATTAGG + Intergenic
1006962600 6:37949241-37949263 CTTCTCAAAAGACAAATATGTGG - Intronic
1007520197 6:42446076-42446098 TTACTAAAAATACAAAAATTAGG - Intronic
1008146701 6:47900403-47900425 ATTCTAAGAAGATAAACAAGTGG - Intronic
1008164637 6:48121069-48121091 TTTCACAGAAGAGAAAATTGAGG + Intergenic
1008208529 6:48692304-48692326 TTTAAAAGAAGACATAGATGTGG + Intergenic
1008338987 6:50341854-50341876 TTGAAAAGAATACAAAAATGGGG + Intergenic
1008523987 6:52389230-52389252 GATCTAAGAAAACGAAAATGTGG - Intronic
1008532683 6:52478751-52478773 TTTTTCAAAAGATAAAAATGTGG - Intronic
1008565180 6:52761094-52761116 AATCTAAGAAGAGAAAATTGAGG - Intronic
1008569509 6:52802395-52802417 ATTCTAAGAAGAGAAAATTGAGG - Intronic
1008574264 6:52844668-52844690 ACTCTAAGAAGAGAAAATTGAGG - Intronic
1008906853 6:56687223-56687245 TTTCTATTAAGATAAAAATAAGG + Intronic
1008947919 6:57119360-57119382 TTACTAAAAATACAAAAATTAGG + Intronic
1009473131 6:64053560-64053582 TTTTAAAGAAGACAACATTGAGG - Intronic
1009803391 6:68571657-68571679 TTTTTAAGAAGACTAAAAATAGG + Intergenic
1009890390 6:69673623-69673645 TTTCTTAGAAGACAAAAGGAAGG + Intergenic
1010041789 6:71393239-71393261 GTCCTCAGAAGAAAAAAATGTGG - Intergenic
1010084316 6:71898753-71898775 ACTCTAAGAAGAGAAAACTGAGG + Intronic
1010085112 6:71908291-71908313 TTTCCCAGAAGAGAGAAATGAGG + Intronic
1010391224 6:75340105-75340127 TTTATAAGAAGTAAAATATGTGG - Intronic
1010783198 6:79969529-79969551 TTTCAAAGAAGACATACATGTGG + Intergenic
1010907193 6:81505718-81505740 ATCTTAAGAAAACAAAAATGGGG + Intronic
1010952422 6:82053504-82053526 TTTCTAGAAAGACAAAATAGGGG + Intergenic
1011092879 6:83626342-83626364 TTTATATGAAGCCAAAAAAGAGG - Intronic
1011136748 6:84108464-84108486 CTTGAAAGAAGACATAAATGTGG - Intergenic
1011146105 6:84218684-84218706 TTTCCAAGAGGACACAAATTAGG - Intronic
1011304399 6:85910678-85910700 TTTATAAGAAGAAAAGAAAGGGG + Intergenic
1011372277 6:86650123-86650145 TTACTAAGAAGTCAAAATTTAGG + Intergenic
1011469361 6:87692346-87692368 TTCCTGAGATGAGAAAAATGAGG + Intronic
1011492605 6:87907658-87907680 GGTCAAAGAAGCCAAAAATGGGG + Intergenic
1011646054 6:89459049-89459071 ATTTTAAGAAGACAAAAAAAAGG - Intronic
1011913405 6:92470744-92470766 TTTCTAAGGAAAGAAGAATGAGG - Intergenic
1012174448 6:96062954-96062976 TTTCTGAGGAAACAGAAATGGGG + Intronic
1012414006 6:98992768-98992790 TTTCCAGGAAAAAAAAAATGTGG - Intergenic
1012706947 6:102543585-102543607 TTTCAGAGAAGACATACATGTGG + Intergenic
1012805521 6:103887721-103887743 GCTCTATGGAGACAAAAATGGGG + Intergenic
1012890492 6:104891824-104891846 TTTATAAAAGGAGAAAAATGAGG - Intergenic
1012992578 6:105940924-105940946 TTTCCAAGATGACAAATAAGTGG - Intergenic
1013084794 6:106847235-106847257 TTTCTAGGAAGAAAAGAAAGGGG - Intergenic
1013268753 6:108526473-108526495 TTTATAAGATGACACAACTGAGG - Intronic
1013435803 6:110105193-110105215 TTTCTAAGATGACAAAACTAAGG + Intronic
1013718729 6:112996257-112996279 TTTCTCAAATGAGAAAAATGGGG - Intergenic
1014032051 6:116717391-116717413 CTTCTAAGCAAACAAAGATGAGG - Intronic
1014043841 6:116861075-116861097 TTTTGTAGAAGAGAAAAATGAGG + Intergenic
1014465484 6:121751519-121751541 TTTCAAAAAAGACATACATGTGG - Intergenic
1014904815 6:127013144-127013166 TTTCACAGATGAGAAAAATGAGG + Intergenic
1015030967 6:128595514-128595536 ATTCTAAGAAAAAAAAAATAGGG + Intergenic
1015094544 6:129399230-129399252 GTTCTAAGAAGAACAAAATAAGG + Intronic
1015788890 6:136946520-136946542 TTTCTAAGAAGAAGCAGATGAGG - Intergenic
1015870894 6:137775395-137775417 ACTTTAAGAAGAGAAAAATGAGG - Intergenic
1016301226 6:142633879-142633901 TTACTAACAAGATAAATATGTGG - Intergenic
1016622894 6:146133275-146133297 TTTCTGAGAAGCCCAAAATTAGG - Intronic
1017113538 6:150954779-150954801 CTACAAAGAATACAAAAATGAGG - Intronic
1017864268 6:158429301-158429323 CTACTAAAAATACAAAAATGAGG - Intronic
1017873467 6:158504655-158504677 TTTCTAAAAAAAAAAAAATTAGG - Intronic
1018240135 6:161766310-161766332 TGTCTAAAAAAAAAAAAATGTGG - Intronic
1018398452 6:163399523-163399545 TTACTAAAAATACAAAAATTAGG + Intergenic
1018549744 6:164981998-164982020 TGTATACGAGGACAAAAATGAGG + Intergenic
1018949704 6:168371123-168371145 TTTCAAAGATGACAGAAAGGGGG - Intergenic
1020407113 7:7849338-7849360 TTTCTAAGGTCACACAAATGGGG + Intronic
1020483166 7:8687490-8687512 TTTCTATGATTAGAAAAATGAGG - Intronic
1020533909 7:9369888-9369910 TTTAAAAGAAGACATAAAAGTGG + Intergenic
1020865383 7:13554608-13554630 ATTTTAAAAATACAAAAATGTGG + Intergenic
1020936885 7:14476914-14476936 CTACTAAAAATACAAAAATGAGG - Intronic
1021368032 7:19805936-19805958 TTTCTAGGAGGTCAAAATTGTGG + Intergenic
1021459906 7:20874775-20874797 TTTATAACATTACAAAAATGTGG + Intergenic
1021802854 7:24325308-24325330 TTTGTAAAAAAAAAAAAATGTGG - Intergenic
1021833255 7:24639979-24640001 CTACTAAGAATACAAAAATTAGG - Intronic
1021919746 7:25472826-25472848 TTTCTAAAAAAAAAAAAATTGGG - Intergenic
1021962120 7:25883704-25883726 TTTTAAAGATGACAAAACTGAGG - Intergenic
1022431484 7:30326919-30326941 TTCAAAAGAAGACATAAATGTGG - Intronic
1022451105 7:30516115-30516137 TTTCTATGAAGGAAAGAATGAGG - Intronic
1022766659 7:33420217-33420239 TTTTACAGAAGATAAAAATGAGG - Intronic
1023609936 7:41962497-41962519 TTTCAAAGAAGACTTACATGGGG + Exonic
1024155637 7:46620808-46620830 TTTATGAGAAGGCCAAAATGAGG - Intergenic
1024207008 7:47172311-47172333 TTTATAGGATGACAAAAATGTGG + Intergenic
1024502939 7:50132266-50132288 TTTTTAAGATGAGAAAATTGAGG - Intronic
1024584583 7:50830775-50830797 AGTCAAAGAAGACAAAAATGAGG - Intergenic
1024739911 7:52342356-52342378 TTACTAAAAATACAAAAATTTGG - Intergenic
1024830871 7:53454443-53454465 TTGCTAAAAATACAAAAATTAGG + Intergenic
1025696314 7:63777346-63777368 TTTTCCAGGAGACAAAAATGTGG - Intergenic
1025779386 7:64586364-64586386 TTTCAAAAAAGACATACATGTGG - Intergenic
1026241263 7:68577392-68577414 CTTCTAAAAATACAAAAATTTGG + Intergenic
1026472921 7:70709544-70709566 CTACTAAAAATACAAAAATGAGG + Intronic
1026780538 7:73263771-73263793 TTACTAAAAATACAAAAATTAGG - Intergenic
1027021397 7:74817210-74817232 TTACTAAAAATACAAAAATTAGG - Intronic
1027066629 7:75128725-75128747 TTACTAAAAATACAAAAATTAGG + Intronic
1027258717 7:76448334-76448356 CTACTAAAAATACAAAAATGAGG + Intergenic
1027310103 7:76946576-76946598 CTACTAAAAATACAAAAATGAGG + Intergenic
1027680590 7:81215690-81215712 TTCCAAAAATGACAAAAATGCGG + Intergenic
1028039019 7:86023770-86023792 TTTCTGACAAGTAAAAAATGTGG + Intergenic
1028107832 7:86901654-86901676 TTTCTAGGTACACAAAACTGTGG - Intronic
1028225219 7:88243136-88243158 TTTATAAGAAAAGAAAAAGGAGG + Intergenic
1029053835 7:97718905-97718927 TTCCAAAGAAGACATACATGTGG + Intergenic
1029368685 7:100133493-100133515 TTACTAAAAATACAAAAATTAGG - Intergenic
1029470209 7:100749747-100749769 TTTTTAAAAAGACAATAATGAGG + Intronic
1029911545 7:104155871-104155893 TTTCTTAAAAGAAAAAAATATGG - Intronic
1030501182 7:110361825-110361847 CTTATTAGAAGACAAAAAAGTGG - Intergenic
1030724313 7:112907449-112907471 TTTCTAAGACAATAAAAATCTGG + Intronic
1030851932 7:114498712-114498734 TTTCTAACCAGTTAAAAATGTGG - Intronic
1030870682 7:114752161-114752183 TTTCCAAGAGGAAAAAAAAGAGG - Intergenic
1030922267 7:115406355-115406377 ATTATAAGAAGACATAAATATGG - Intergenic
1031043171 7:116860186-116860208 TTTTACAGAAGAAAAAAATGAGG - Intronic
1031409584 7:121425255-121425277 TTTTTACGATGTCAAAAATGTGG + Intergenic
1031499831 7:122500395-122500417 TTTTTAAGACGATAAATATGTGG - Intronic
1031570439 7:123352658-123352680 GTTCTAAGGCGCCAAAAATGTGG - Intergenic
1031575256 7:123408232-123408254 ATTTTAAGAAGAAAATAATGAGG + Intergenic
1031575261 7:123408320-123408342 ATTTTAAGAAGAAAATAATGAGG + Intergenic
1031896069 7:127349135-127349157 TTGCTAAAAACAGAAAAATGTGG + Intronic
1031998756 7:128250576-128250598 TTTCACAGAAGAGAAAAATATGG - Intronic
1032067482 7:128782509-128782531 TTTCTAAAAAACCAGAAATGGGG - Intergenic
1032143131 7:129352535-129352557 TTACTAAGATGAGAAAAATTGGG - Intronic
1032207710 7:129882934-129882956 AAACTAGGAAGACAAAAATGTGG + Intronic
1032272360 7:130421659-130421681 TTTTTAAAAAGACAAAAATAAGG + Intronic
1032294047 7:130618838-130618860 TTTTGAAGGAGACAAGAATGAGG - Intronic
1032301357 7:130690307-130690329 AATGAAAGAAGACAAAAATGGGG - Intergenic
1032321948 7:130893830-130893852 TTCCAGAGAAGAGAAAAATGTGG - Intergenic
1032563126 7:132913179-132913201 CTTCAACGAAGCCAAAAATGTGG + Intronic
1032724869 7:134581265-134581287 ATACTAAAAATACAAAAATGTGG - Intergenic
1032890881 7:136193339-136193361 TTTTTAAGAAGGGAGAAATGTGG + Intergenic
1032921391 7:136552063-136552085 TATTTAAAAGGACAAAAATGAGG + Intergenic
1032969750 7:137147281-137147303 TTACAAAGAAGAAAAAAAGGAGG + Intergenic
1033024989 7:137763593-137763615 TTTCTAAGTTTTCAAAAATGAGG - Intronic
1033089097 7:138368614-138368636 TTTCTAAGAAAAAAAAAAACAGG - Intergenic
1033338981 7:140477620-140477642 CTACTAAGAATACAAAAATTAGG - Intronic
1033354409 7:140587866-140587888 TTTCTAAGAAAAAGAAAATTTGG - Intronic
1033441591 7:141384991-141385013 TATCTAAGAACAAAGAAATGTGG - Intronic
1033474083 7:141674156-141674178 CTTCTATGAGGACAAAAAGGGGG - Exonic
1033495613 7:141891090-141891112 TTTTTAAAAAGAGAAGAATGGGG + Intergenic
1033531906 7:142272590-142272612 TTTCTAAGAACACAAAACGATGG - Intergenic
1033975554 7:147096209-147096231 TGGCCAAGAAGACATAAATGTGG + Intronic
1033981750 7:147173732-147173754 ATTCAGAGATGACAAAAATGAGG + Intronic
1034138154 7:148790922-148790944 TTTCTTAGAGGAGAAAACTGAGG + Intronic
1034145784 7:148870261-148870283 TTTCGAAGTAGCCCAAAATGGGG + Intronic
1034877802 7:154740918-154740940 TTTATAGAAAGAAAAAAATGGGG - Intronic
1035631754 8:1112191-1112213 TTTAAAAGAAGACATACATGTGG - Intergenic
1035941563 8:3907286-3907308 TTTTTAAGAAGACATTAACGTGG + Intronic
1036602752 8:10277426-10277448 TTTCTAAGAATAGGAAATTGAGG + Intronic
1036976325 8:13417147-13417169 TTTTTAGGAAGAGAAAAATGAGG + Intronic
1037338576 8:17816324-17816346 CTTCTCAGAAGACATACATGTGG + Intergenic
1037540866 8:19869657-19869679 CTTCAAAGAAGACAAAAACGTGG + Intergenic
1037776618 8:21839831-21839853 TTTGTAAAAATACAAAAATTAGG - Intergenic
1037925512 8:22841119-22841141 TTTTAAAGAAGAGAAAACTGAGG + Intronic
1038141544 8:24850496-24850518 TTACTAAAAACACAAAAATTAGG + Intergenic
1038309579 8:26436003-26436025 TTACTAAAAATACAAAAAAGAGG - Intronic
1038385673 8:27142307-27142329 ATTGTAAGAATACAAAAATACGG + Intergenic
1038869423 8:31478362-31478384 CTTCTAAGAAGAGGAAAATTTGG - Intergenic
1039211572 8:35221221-35221243 TTTATAAGCATAGAAAAATGTGG - Intergenic
1039380573 8:37081187-37081209 TTTCTCAGAAGGAAAGAATGAGG + Intergenic
1039478636 8:37855435-37855457 TTACTAAAAATACAAAAATTAGG - Intergenic
1039625069 8:39040994-39041016 TTTCTAAGAAGAAAACGTTGAGG + Intronic
1039654849 8:39392798-39392820 TTCTTAAGAAGACAAAATTGAGG - Intergenic
1039663520 8:39494747-39494769 TTTATAAGAACAAAAAAATCAGG + Intergenic
1039696852 8:39922163-39922185 CTACTAAGAATACAAAAATTAGG - Intronic
1039980254 8:42403709-42403731 TTACTAAAAATACAAAAATTAGG + Intronic
1040490206 8:47913555-47913577 TTACTAAAAATACAAAAATTAGG - Intronic
1040620205 8:49083630-49083652 TTTCTAAGAATTCGAAAGTGTGG + Intergenic
1041239745 8:55839287-55839309 TTACTAAAAATACAAAAATTAGG + Intergenic
1041547127 8:59058340-59058362 TTTCTAAGATGACATAAAGGTGG + Intronic
1041589198 8:59557413-59557435 TTTCAAAAAGGACAAAAATAAGG - Intergenic
1041988692 8:63957992-63958014 TTATTAAAAAGCCAAAAATGAGG + Intergenic
1042057217 8:64777412-64777434 TTCTTAATTAGACAAAAATGGGG - Intronic
1042181265 8:66089971-66089993 TTTCAAAGACAACAAAACTGGGG - Intronic
1042421650 8:68597420-68597442 TTTCTAAAAAAACACAGATGAGG - Intronic
1042633926 8:70852140-70852162 TTTCAAAGAAGACATTTATGTGG + Intergenic
1042751770 8:72165139-72165161 TTTCAAACAAGACATATATGTGG - Intergenic
1042834961 8:73071233-73071255 TTTTTAGGAAGAAAAAACTGAGG + Intronic
1042857092 8:73278384-73278406 TTTTTAAAAAGAAAATAATGAGG - Intergenic
1043070283 8:75627997-75628019 TTTGTAACAAGACACAATTGGGG - Intergenic
1043146097 8:76656956-76656978 TTACTAAAAATACAAAAATTAGG + Intergenic
1043717134 8:83500929-83500951 TTTTTATGAAGACAAACATTAGG - Intergenic
1043991729 8:86763888-86763910 TTTCATAGGAGAGAAAAATGAGG - Intergenic
1044343619 8:91076684-91076706 TTCCTCAGAAGAGGAAAATGAGG + Intronic
1044392788 8:91671565-91671587 TGACTAAGAAGATCAAAATGTGG - Intergenic
1044471475 8:92574091-92574113 TGGCTAAGAAGACATGAATGAGG + Intergenic
1044540226 8:93400349-93400371 ATTCAAAGGGGACAAAAATGTGG - Intergenic
1044596449 8:93963500-93963522 CTTCTCAGAAGACATACATGTGG - Intergenic
1044645320 8:94436339-94436361 TTTTTAAAAAGAGAAAAGTGAGG - Intronic
1044999271 8:97866321-97866343 CATGTAAGCAGACAAAAATGAGG - Intergenic
1045290735 8:100830409-100830431 TTTCAAGGAAGAAAGAAATGTGG + Intergenic
1045331858 8:101162175-101162197 TTACTAAAAATACAAAAATTTGG - Intergenic
1045435230 8:102156808-102156830 CTTCTCAGAAGCCAAAAATAAGG + Intergenic
1045471039 8:102512445-102512467 TTTCTCAGAAAACAAAAATATGG - Intergenic
1045524883 8:102933168-102933190 TTTCTAACAAGACAACACTGAGG - Intronic
1045724539 8:105156992-105157014 TCTTTAAGAAGGCAAAAATATGG - Intronic
1045891271 8:107160646-107160668 TAACTAAAAAGACAAAAATTAGG - Intergenic
1046344411 8:112903603-112903625 TTTTTAAGAAGAAAAAACTCTGG + Intronic
1046536854 8:115525812-115525834 TTTCTAAGAGCACTGAAATGTGG + Intronic
1046602834 8:116337718-116337740 TTTCCAAGTAGACAAAGCTGTGG + Intergenic
1046710136 8:117501916-117501938 TTTCTATGAACACATTAATGAGG - Intergenic
1046778074 8:118185075-118185097 TTTCAAAGAAAACAAAAATTCGG - Intergenic
1047040525 8:120989723-120989745 TTCCAAAGAAAACATAAATGAGG - Intergenic
1047141766 8:122148772-122148794 TTTGGAAGAGGAAAAAAATGAGG - Intergenic
1047182205 8:122599742-122599764 TTTTAAAGAAGACGAAACTGAGG - Intergenic
1047400489 8:124542214-124542236 CTACTAAAAATACAAAAATGAGG - Intronic
1047691723 8:127362105-127362127 TTTTTAAAGAGAGAAAAATGTGG - Intergenic
1048104400 8:131391991-131392013 TTTTGAAGAAGATAAAATTGTGG + Intergenic
1048221482 8:132546306-132546328 TTTTGAAGAAGAGAAAACTGAGG + Intergenic
1048255609 8:132902969-132902991 TTTTTCAGATGACAAAACTGAGG + Intronic
1049431480 8:142567259-142567281 TTACCATGAAGATAAAAATGTGG + Intergenic
1049522190 8:143098328-143098350 TTTGGAAAAAGAGAAAAATGGGG + Intergenic
1050390745 9:5141486-5141508 TTTCAAAGAAGACATACATGTGG - Intronic
1050428165 9:5534080-5534102 TTTTTCAGAAAACAAAAATGAGG - Intronic
1050532622 9:6603892-6603914 TTACTAAAAATACAAAAATTAGG - Intronic
1050841848 9:10159155-10159177 TCTCAAAAAAGGCAAAAATGTGG + Intronic
1051386980 9:16519746-16519768 TTTCACAGAAGAGAAAAGTGAGG + Intronic
1051545437 9:18269517-18269539 TTTCTAAGAACAGATAGATGTGG + Intergenic
1051561305 9:18443574-18443596 TTTCTAAGAAAATGAATATGTGG + Intergenic
1051574813 9:18602967-18602989 CTTCTAAGAGGTAAAAAATGAGG + Intronic
1051613001 9:18979832-18979854 TTTTTAAAAAAAGAAAAATGAGG - Intronic
1051704113 9:19858708-19858730 TTTCAAAGAAGACATACATGTGG + Intergenic
1051760065 9:20453114-20453136 ATCCTAAGAAAACAAAAAAGTGG + Intronic
1051763160 9:20491343-20491365 TTTCAAGAAAGAGAAAAATGAGG + Intronic
1051958820 9:22732973-22732995 TATCTAAGAAGACAATGAAGTGG - Intergenic
1051977635 9:22971388-22971410 TTGTTAAGAAGAGAAAAATATGG + Intergenic
1051987935 9:23113148-23113170 TTTTAAAGATGAAAAAAATGAGG + Intergenic
1052429341 9:28346820-28346842 TCTCTAAGAAGGCATACATGTGG - Intronic
1052430233 9:28356896-28356918 TTTCTTAGAACAGAAATATGGGG + Intronic
1052517588 9:29503238-29503260 CTTCTGAGGAGACAAAATTGAGG - Intergenic
1052525246 9:29609145-29609167 TGTTTAAGAAGAAAAAAATAAGG + Intergenic
1052647900 9:31261050-31261072 TTACTAAAAATACAAAAATTAGG + Intergenic
1052748161 9:32461789-32461811 TTTCTAGAAAAATAAAAATGGGG - Intronic
1053309561 9:37008216-37008238 TTACTAAAAATACAAAAATTAGG - Intronic
1054712136 9:68522088-68522110 TTACTAAAAATACAAAAATTAGG + Intronic
1054723273 9:68624642-68624664 TGTCTTAAAAGACAAAAATTGGG + Intergenic
1054908206 9:70429389-70429411 CTACTAAAAATACAAAAATGAGG + Intergenic
1055143679 9:72906850-72906872 TTAATAAGTGGACAAAAATGTGG + Intronic
1055157061 9:73076924-73076946 TTCTTAAGAAGCCAATAATGAGG - Intronic
1055370173 9:75589896-75589918 TCTCTAAGAAGAGAAATATGTGG + Intergenic
1055420074 9:76130494-76130516 TTTCACAGACGACAAAACTGAGG - Intronic
1055547581 9:77395755-77395777 TGCCAAAGAGGACAAAAATGAGG - Intronic
1055734295 9:79311345-79311367 TTTCTCAGCTGTCAAAAATGGGG - Intergenic
1055760301 9:79599867-79599889 GTGCTATGAAGACAAAATTGGGG - Intronic
1055806852 9:80105423-80105445 CTACTAAAAATACAAAAATGAGG + Intergenic
1055820846 9:80261426-80261448 TTTTTAAGAAGAGAGTAATGAGG - Intergenic
1055838523 9:80474412-80474434 TTGTTAAGAAAAAAAAAATGAGG + Intergenic
1056180175 9:84075408-84075430 TGCCTAAAAAGACAAAAATAGGG - Intergenic
1056245818 9:84694223-84694245 TTTTTCAGAAGACAAAACTGGGG - Intronic
1056921617 9:90795288-90795310 TTACTAACAAAAGAAAAATGAGG + Intergenic
1057311243 9:93944707-93944729 TTTCTCAGATGAGAAAACTGAGG - Intergenic
1058488053 9:105462383-105462405 CTACTAAAAAGACAAAAATTAGG - Intronic
1058523395 9:105834132-105834154 TTTCTAAGATGAGGAAACTGAGG - Intergenic
1058795262 9:108491697-108491719 TTTCAAAGATGAGAAAACTGAGG + Intergenic
1058852680 9:109027844-109027866 CTACTAAGAATACAAAAATTAGG - Intronic
1059059302 9:111018106-111018128 TCTGTTAGAAGACAAAACTGTGG + Intronic
1059142762 9:111869785-111869807 CTACTAAGAATACAAAAATTAGG - Intergenic
1059221093 9:112619304-112619326 TTATTAAGGAGACAAAAAAGGGG - Intronic
1059344091 9:113616547-113616569 TTTTGTAGAAGACAAAACTGAGG + Intergenic
1059424576 9:114212699-114212721 TTTCTCGGAAGAGAAAACTGTGG - Intronic
1059808570 9:117830949-117830971 TTCCTAAAAAGACAATATTGGGG - Intergenic
1059836634 9:118162047-118162069 TCTCTGAGAAAAAAAAAATGGGG + Intergenic
1060029623 9:120203215-120203237 AATCTAAGAAAACAAAGATGAGG - Intergenic
1060093917 9:120769966-120769988 ATTCCAGGAAGACATAAATGGGG + Intronic
1060181135 9:121534705-121534727 TTTCTAAAAAGAATCAAATGAGG + Intergenic
1060773286 9:126348166-126348188 TTTCTAACAAAACAAAAAGGAGG - Intronic
1061006803 9:127932864-127932886 CTACTAAAAATACAAAAATGGGG - Intergenic
1061122233 9:128650701-128650723 TCTCTAAAAATACAAAAATGGGG - Intronic
1061281463 9:129600000-129600022 CTACTAAGAATACAAAAATTAGG + Intergenic
1203415666 Un_KI270582v1:4724-4746 TTTGAAAGAAGACATACATGAGG - Intergenic
1185579051 X:1196485-1196507 CTACTAAGAATACAAAAATTAGG - Intronic
1185674691 X:1839745-1839767 TTCCTAAGAAGACTAAAAGATGG + Intergenic
1185770631 X:2763176-2763198 CTACTAAAAATACAAAAATGTGG - Intronic
1185804508 X:3045035-3045057 TTTATAAAAACACAAAGATGTGG + Intronic
1186073004 X:5843270-5843292 TTTTTATGAAGACAAAAAGCTGG + Intronic
1186276551 X:7945242-7945264 TTTCTAAAAAAACTAAAATTTGG - Intergenic
1186440922 X:9585915-9585937 TTTTTAAGATGACGAAATTGAGG - Intronic
1186525411 X:10243839-10243861 TTATTTAGAAGACAAAACTGAGG + Intergenic
1186721462 X:12308784-12308806 TTGCTAAGGAAAAAAAAATGGGG + Intronic
1186854746 X:13615056-13615078 TTTTTGAGAATATAAAAATGTGG - Intronic
1187076932 X:15944532-15944554 TTTTTCAGATGACAAAAGTGTGG + Intergenic
1187558463 X:20375815-20375837 TTTTTAAAAATACAAAGATGTGG + Intergenic
1187567526 X:20466525-20466547 TTTCTAAGATGACTAAATTTAGG - Intergenic
1187577510 X:20573749-20573771 TTTCTAAGAAGACAAAAAATAGG - Intergenic
1187653941 X:21448006-21448028 TTTAGAAGGAGACAAATATGAGG + Intronic
1187767142 X:22654815-22654837 TTTCTAAGAAAACAAAATACAGG + Intergenic
1187778106 X:22786811-22786833 CTTCTAAGAAGACATACAAGTGG + Intergenic
1188142646 X:26570946-26570968 TTATTAAGAGAACAAAAATGAGG - Intergenic
1188403533 X:29778221-29778243 TATAAAAGAAGACAGAAATGTGG - Intronic
1188725058 X:33572688-33572710 TTTCAAAGAAGACATACACGTGG - Intergenic
1188847354 X:35089545-35089567 TTTTTAAGATGAAAAAACTGAGG + Intergenic
1188961318 X:36495786-36495808 TTCAAAAGAAGACATAAATGTGG + Intergenic
1188982685 X:36741275-36741297 TTTCAAAGAAGACATACATGAGG - Intergenic
1189057962 X:37719060-37719082 TTTCTGTCAAAACAAAAATGAGG - Intronic
1189100631 X:38185880-38185902 TTTCTAAAAAAAAAAAAAAGGGG + Intronic
1189392101 X:40584907-40584929 CTACTAAAAATACAAAAATGAGG - Intronic
1189404273 X:40705368-40705390 TTTCTAAGAATACTCAATTGTGG - Intronic
1189472668 X:41326276-41326298 CTACTAAGAATACAAAAATCAGG + Intergenic
1189505203 X:41606416-41606438 CTACTAAAAATACAAAAATGTGG - Intronic
1190092960 X:47455713-47455735 AATCAAAGAAGACAATAATGTGG + Intronic
1190198843 X:48343261-48343283 CTTCTAAAAATACAAAAATTAGG - Intergenic
1191219337 X:57970322-57970344 TTCCAAAGAAGACATACATGTGG - Intergenic
1191224094 X:58022614-58022636 TTTAAAAGAAGACATACATGTGG + Intergenic
1191896222 X:65996160-65996182 TTTATAACAAGAAAAAATTGGGG - Intergenic
1192293307 X:69820597-69820619 TCTCTAAGAAGACATACATGCGG + Intronic
1192709882 X:73569387-73569409 TGTCTAAGAAATTAAAAATGTGG + Intronic
1193125265 X:77864014-77864036 TCTCAAAGAAAAAAAAAATGTGG + Intronic
1193173247 X:78361219-78361241 TCTCAAAGAAGACAAGCATGCGG + Intergenic
1193280532 X:79643361-79643383 TTTCTAAGAAGACAATAAGCAGG - Intergenic
1193316229 X:80068226-80068248 TTCAAAAGAAGACAAAAATATGG - Intergenic
1193557389 X:82972781-82972803 TATCTAAGAAAACAAAAATGAGG - Intergenic
1193574296 X:83180530-83180552 TGTGTAAGAAGAGTAAAATGTGG - Intergenic
1193674492 X:84432964-84432986 TCTCAAAGAAGACAAAAAAATGG - Intronic
1193970664 X:88047500-88047522 TGTCTTAGAAGGCAAAACTGTGG + Intergenic
1194050661 X:89063513-89063535 TTTCTAAAAAGAAAAAAAAAAGG - Intergenic
1194092096 X:89590605-89590627 TTTGTAAAAATACAAAAATTAGG - Intergenic
1194220989 X:91191246-91191268 TTTGTAAAAAGATAGAAATGTGG + Intergenic
1194297070 X:92139426-92139448 CTACTAAAAATACAAAAATGTGG - Intronic
1194355876 X:92883290-92883312 TTTTAAAGAAGACATACATGTGG + Intergenic
1194364817 X:93002348-93002370 TTCCAAAGAAGACATACATGTGG - Intergenic
1194490885 X:94547739-94547761 TTTAGAAAAAGACAGAAATGGGG + Intergenic
1194889306 X:99357563-99357585 TGTCAAAGAAGACATTAATGTGG + Intergenic
1194909877 X:99628937-99628959 TTCAAAAGAAGACATAAATGTGG + Intergenic
1195164458 X:102205078-102205100 TTCCAAAGAAGACATAAAAGTGG - Intergenic
1195174101 X:102297995-102298017 TTTATAAGAAGAGGAAAATTGGG + Intergenic
1195184764 X:102389098-102389120 TTTATAAGAAGAGGAAAATTGGG - Intronic
1195194401 X:102482016-102482038 TTCCAAAGAAGACATAAAAGTGG + Intergenic
1195203600 X:102573156-102573178 TTTAAAAGAAGATAAAAATTAGG + Intergenic
1195212604 X:102664444-102664466 TTCAAAAGAAGACATAAATGCGG - Intergenic
1196472567 X:116045199-116045221 GTTCTAACAACAAAAAAATGAGG + Intergenic
1196959990 X:120990953-120990975 TAACTAAGAACATAAAAATGAGG - Intergenic
1197052687 X:122078407-122078429 TTTATAAGAACAAAAAAATCAGG - Intergenic
1197223911 X:123937831-123937853 CTACTAAAAATACAAAAATGTGG + Intergenic
1197477935 X:126946750-126946772 TTTTTAAGAAGTAAATAATGGGG - Intergenic
1197898301 X:131341166-131341188 TTTCTCAGAGGGAAAAAATGTGG + Intronic
1198548300 X:137717834-137717856 TTACTAAAAATACAAAAATTAGG - Intergenic
1198570510 X:137950430-137950452 TTCAAAAGAAGACATAAATGTGG - Intergenic
1198658442 X:138940203-138940225 TTCAAAAGAAGACATAAATGTGG - Intronic
1198794039 X:140377006-140377028 TTTAAAAGAAGACATACATGTGG + Intergenic
1198859455 X:141054198-141054220 TTTCTCAAAAAACTAAAATGAGG - Intergenic
1198903240 X:141533193-141533215 TTTCTCAAAAAACTAAAATGAGG + Intergenic
1199084570 X:143613918-143613940 TTTCAAAGAAGACATAAAAATGG + Intergenic
1199150422 X:144478678-144478700 TCTCTAAGAAGACACACATGTGG - Intergenic
1199218678 X:145291372-145291394 TTTTAAAGAAAACAAAAATATGG - Intergenic
1199274920 X:145929401-145929423 CTCAGAAGAAGACAAAAATGTGG + Intergenic
1199320518 X:146432656-146432678 TTTAAAAGAAGACATACATGTGG + Intergenic
1199370735 X:147044460-147044482 TCTCTAAAAAAAAAAAAATGAGG + Intergenic
1200444726 Y:3246641-3246663 TTTGTAAAAATACAAAAATTAGG - Intergenic
1200557494 Y:4654999-4655021 TTTGTAAAAAGATAGAAATGTGG + Intergenic
1200614584 Y:5364005-5364027 CTACTAAAAATACAAAAATGTGG - Intronic
1200664222 Y:6000267-6000289 TTTTAAAGAAGACATACATGTGG + Intergenic
1200794398 Y:7327501-7327523 ATTCCAAGAAAACAAAAATAAGG - Intergenic
1201269667 Y:12242622-12242644 TTACTAAAAATACAAAAATTTGG - Intergenic
1201792510 Y:17857769-17857791 TATGTAAGAAGAAAAAAATTGGG + Intergenic
1201809044 Y:18048217-18048239 TATGTAAGAAGAAAAAAATTGGG - Intergenic
1201926085 Y:19289410-19289432 GTTCTATGAAGATAAAAATGGGG + Intergenic
1202269508 Y:23057365-23057387 TTACTAAAAATACAAAAATTAGG + Intergenic
1202354047 Y:24027014-24027036 TATGTAAGAAGAAAAAAATTGGG + Intergenic
1202422502 Y:24691111-24691133 TTACTAAAAATACAAAAATTAGG + Intergenic
1202448287 Y:24978975-24978997 TTACTAAAAATACAAAAATTAGG - Intergenic
1202516732 Y:25643098-25643120 TATGTAAGAAGAAAAAAATTGGG - Intergenic