ID: 1124953308

View in Genome Browser
Species Human (GRCh38)
Location 15:34343019-34343041
Sequence AGATCGAGTCTATACGCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124953308_1124953313 29 Left 1124953308 15:34343019-34343041 CCTTCAGCGTATAGACTCGATCT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1124953308_1124953309 -8 Left 1124953308 15:34343019-34343041 CCTTCAGCGTATAGACTCGATCT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1124953309 15:34343034-34343056 CTCGATCTCCCTGCTCGTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 48
1124953308_1124953312 1 Left 1124953308 15:34343019-34343041 CCTTCAGCGTATAGACTCGATCT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1124953312 15:34343043-34343065 CCTGCTCGTTGAGGTAATACTGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124953308 Original CRISPR AGATCGAGTCTATACGCTGA AGG (reversed) Exonic
910202553 1:84714264-84714286 AGATCAAGTCTCTACCCTGATGG - Intergenic
914908062 1:151763050-151763072 ACATCGCGTCTATAAGCTGGTGG - Exonic
916389207 1:164312118-164312140 AGATCGAATCTCTACGTTGCTGG + Intergenic
924121694 1:240806341-240806363 AGATCGGGTGTTTACTCTGATGG + Intronic
1071576279 10:86729167-86729189 AGAACAAGTCTCTACCCTGACGG + Intronic
1074351345 10:112740143-112740165 AGATCAAGTCTACAAGATGATGG - Intronic
1084439123 11:69161053-69161075 AGATCAAATCTACATGCTGAGGG - Intergenic
1113007429 13:105722863-105722885 AGAGCGTGTTTATACACTGAAGG - Intergenic
1124953308 15:34343019-34343041 AGATCGAGTCTATACGCTGAAGG - Exonic
1125690033 15:41588596-41588618 TGATCAAGTCTAGAAGCTGAAGG + Intergenic
1128431459 15:67598760-67598782 AGATAGAGTCTACACTCTGGAGG - Intronic
1140233529 16:73138373-73138395 AGATGGAATCTACCCGCTGACGG + Intronic
1166702630 19:44891156-44891178 AGACCGAGTCTTGACGCTGGTGG + Intronic
942430878 2:175910150-175910172 AGCTTGAGTCTGTAGGCTGATGG - Intergenic
988272955 5:29041079-29041101 AGGTATAGTCTATACACTGACGG - Intergenic
1000832124 5:166115745-166115767 AGATCCAGTCTAAATGCAGATGG - Intergenic
1004084473 6:12431580-12431602 AGTTCTGGTCTATATGCTGAGGG - Intergenic
1024303694 7:47908230-47908252 AGAAGGAGTCTATATGCTCAAGG - Exonic
1032802569 7:135328628-135328650 AGATTGAGTCTCCACACTGAAGG - Intergenic
1039346513 8:36711186-36711208 AGATAGTGTATATATGCTGATGG - Intergenic
1189118214 X:38365765-38365787 AGATGGAGTCTATACCAGGATGG + Intronic