ID: 1124953310

View in Genome Browser
Species Human (GRCh38)
Location 15:34343042-34343064
Sequence CAGTATTACCTCAACGAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124953310_1124953313 6 Left 1124953310 15:34343042-34343064 CCCTGCTCGTTGAGGTAATACTG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1124953310_1124953314 17 Left 1124953310 15:34343042-34343064 CCCTGCTCGTTGAGGTAATACTG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124953310 Original CRISPR CAGTATTACCTCAACGAGCA GGG (reversed) Exonic
903663189 1:24991188-24991210 CATTGTTACCTCACCCAGCAGGG - Intergenic
905126154 1:35717574-35717596 CAATATTACATAAACAAGCACGG + Intronic
918220775 1:182434431-182434453 CCATATTACCTTAATGAGCAGGG - Intergenic
922984314 1:229854086-229854108 GAGTATTACCCCAAGGAGCTGGG + Intergenic
924099371 1:240587968-240587990 CAGTTTTCCATCAAAGAGCAAGG - Intronic
1065287346 10:24198921-24198943 CAGTATTACATGAACAAGCCAGG + Intronic
1068633506 10:59322816-59322838 CAATAATACCTCAAAGAGGAGGG + Intronic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1097961289 12:65534140-65534162 CAGCACTACCTGAATGAGCAAGG - Intergenic
1100948966 12:99823968-99823990 CAGTATTAACTAAAACAGCATGG - Intronic
1103981192 12:124738061-124738083 CAGTAACACCTCAAAGATCATGG + Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1116750236 14:48873696-48873718 CAGTGTTACCTTAACTAACATGG - Intergenic
1117564566 14:56979713-56979735 CAGTATCTCCTCAAACAGCAGGG + Intergenic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
930205432 2:48583005-48583027 CAGTCTTATTTCAAAGAGCAGGG - Intronic
933328468 2:80868147-80868169 CAGTATTTCCTCAACTATAATGG - Intergenic
940816329 2:158301790-158301812 CCGTATTACCTAATCCAGCAAGG - Intronic
953482163 3:43261125-43261147 CAGTGTTACCTCTACTATCAAGG + Intergenic
954407167 3:50351645-50351667 CAGAATTCCCTCAACCAGCCAGG - Intronic
955251516 3:57287612-57287634 CAGAATTACCTCATGGAGCAGGG - Intronic
964904494 3:161702614-161702636 CAGTTTTACCTCATTCAGCATGG - Intergenic
980620283 4:135292374-135292396 CAGTATTAGTTCCATGAGCATGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
999486200 5:151998797-151998819 AAGTATAACCCCAAAGAGCAAGG - Intergenic
1001395333 5:171415355-171415377 CAGTACTAGCTTAATGAGCAAGG + Intergenic
1008864899 6:56198497-56198519 CAGTCTTACCTCAAAAAGCTGGG + Intronic
1009281085 6:61752706-61752728 GAATATGACCTCAATGAGCATGG - Intronic
1009902534 6:69825839-69825861 CAGCTTTACCTCAAGGAGGATGG + Intergenic
1012262882 6:97108484-97108506 CAGGATTCCCTCCACCAGCATGG + Intronic
1031089121 7:117332085-117332107 CACTTTTACTTCAACTAGCAAGG - Intergenic
1032436936 7:131908502-131908524 CAGTAATACCCCAAGGGGCAAGG + Intergenic
1036457947 8:8925960-8925982 CAGTATAACATCAACGAGGAAGG - Intergenic
1042075898 8:64994272-64994294 TACTATTACCTCTACGAGAATGG + Intergenic
1044369219 8:91389425-91389447 CATAAATACCTCAACAAGCATGG - Exonic
1052099152 9:24422470-24422492 CAGTATTATCTAAGAGAGCAAGG + Intergenic
1052378222 9:27741671-27741693 CCGTATTTCCTCACCAAGCAGGG - Intergenic
1052509843 9:29401824-29401846 AAGTATTTCCTAAACTAGCAGGG + Intergenic
1053001630 9:34579942-34579964 GAGGATTGCCTCAGCGAGCAGGG - Intronic