ID: 1124953311

View in Genome Browser
Species Human (GRCh38)
Location 15:34343043-34343065
Sequence CCAGTATTACCTCAACGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124953311_1124953313 5 Left 1124953311 15:34343043-34343065 CCTGCTCGTTGAGGTAATACTGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1124953311_1124953314 16 Left 1124953311 15:34343043-34343065 CCTGCTCGTTGAGGTAATACTGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124953311 Original CRISPR CCAGTATTACCTCAACGAGC AGG (reversed) Exonic
904863616 1:33559399-33559421 CCAGTTTAACCTCAACGATGTGG - Exonic
910813428 1:91262494-91262516 ACAAAATTACCTCAACAAGCCGG - Exonic
912516003 1:110216893-110216915 CCAGTAATACCTCTAGGTGCTGG - Intronic
919168249 1:193921840-193921862 CCAGTCTTACCTCCAACAGCGGG - Intergenic
922098803 1:222465310-222465332 CCAGTATTACCTGGACCTGCAGG + Intergenic
922984313 1:229854085-229854107 GGAGTATTACCCCAAGGAGCTGG + Intergenic
1063360714 10:5455007-5455029 CCAGTATTACATCGACAAGCTGG + Exonic
1080863078 11:36167411-36167433 CCAGTATGACCTCATCGTGATGG - Intronic
1108537846 13:51404385-51404407 CCAGTCTTATCTCCAAGAGCTGG + Intronic
1120408600 14:84121179-84121201 CCAGTTTTTCCTCAATGATCTGG + Intergenic
1120493944 14:85210447-85210469 CAAGCAGTACCTCAACTAGCTGG - Intergenic
1124953311 15:34343043-34343065 CCAGTATTACCTCAACGAGCAGG - Exonic
1125447185 15:39770905-39770927 CCAGTGTGAGCTCAAGGAGCAGG - Intronic
1133432836 16:5753613-5753635 CCAATATGACATCAACCAGCTGG - Intergenic
1156331293 18:36126315-36126337 CCAGTGTCACATCAAAGAGCCGG - Exonic
1174029121 20:47607035-47607057 CCAGTATTATCTAAATGACCCGG + Intronic
1174953254 20:55066763-55066785 CCAGTGATACCTCCACGTGCGGG - Intergenic
955251517 3:57287613-57287635 GCAGAATTACCTCATGGAGCAGG - Intronic
968509080 4:987465-987487 CCTGGTTTACCTCAAAGAGCAGG - Intronic
971103859 4:23499627-23499649 GCAGCCTTACCTCAAAGAGCAGG + Intergenic
976331987 4:83842857-83842879 CAAATATTACCCCAAAGAGCTGG - Intergenic
977659432 4:99565967-99565989 CCAGTATTCCCTAAATGACCCGG - Intronic
985025116 4:185732819-185732841 CCAGTATGACCTCAATTAACTGG - Intronic
999312014 5:150557681-150557703 CCAGTGTTGCCTCAACGGCCTGG - Exonic
1008864898 6:56198496-56198518 TCAGTCTTACCTCAAAAAGCTGG + Intronic
1010186718 6:73152868-73152890 CCATTATTACGATAACGAGCAGG + Intronic
1011488039 6:87863296-87863318 ACACAAGTACCTCAACGAGCAGG - Intergenic
1052378224 9:27741672-27741694 CCCGTATTTCCTCACCAAGCAGG - Intergenic
1199893982 X:152115153-152115175 CAAGTATTAAGTCAAGGAGCCGG - Intergenic