ID: 1124953313

View in Genome Browser
Species Human (GRCh38)
Location 15:34343071-34343093
Sequence CATGATCGCTTATAAGCCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124953310_1124953313 6 Left 1124953310 15:34343042-34343064 CCCTGCTCGTTGAGGTAATACTG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1124953311_1124953313 5 Left 1124953311 15:34343043-34343065 CCTGCTCGTTGAGGTAATACTGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 40
1124953308_1124953313 29 Left 1124953308 15:34343019-34343041 CCTTCAGCGTATAGACTCGATCT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124953313 Original CRISPR CATGATCGCTTATAAGCCAG CGG Exonic
910712328 1:90194640-90194662 TATGATAGCATATAAGTCAGAGG + Intergenic
920843682 1:209575970-209575992 CATGCTCACCCATAAGCCAGAGG - Intergenic
1062893110 10:1080486-1080508 CATGATGGCTCAAGAGCCAGTGG - Intronic
1063006627 10:1977694-1977716 CTTGTGCTCTTATAAGCCAGAGG + Intergenic
1066749790 10:38642392-38642414 CATCATCTCTTAAAAGTCAGTGG - Intergenic
1066966858 10:42275384-42275406 CATCATCTCTTAAAAGTCAGTGG + Intergenic
1071877298 10:89854815-89854837 CATGAACACTTACAACCCAGGGG - Intergenic
1072702832 10:97656428-97656450 CATGACCCTTGATAAGCCAGAGG - Intronic
1074533185 10:114310838-114310860 CATGACCTCTGAAAAGCCAGAGG - Intronic
1079818620 11:25094929-25094951 CATGATTTCTGTTAAGCCAGTGG - Intergenic
1088057840 11:105607166-105607188 AATGAACGGTTATAAGCAAGGGG - Intergenic
1089054849 11:115577241-115577263 CAGGATTGCTTATTAGCCAAGGG + Intergenic
1098886385 12:75964791-75964813 CATGATTACTCTTAAGCCAGAGG - Intergenic
1107111701 13:36704866-36704888 CATTATCACTCATAAGCCACAGG - Intergenic
1111360169 13:87165760-87165782 CATGCTTCCTAATAAGCCAGTGG + Intergenic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1126306670 15:47266519-47266541 CATTACGGCTTATAAGGCAGTGG - Intronic
1130034386 15:80343765-80343787 CATGGTCTCTTATCAACCAGAGG - Intergenic
1131343781 15:91627455-91627477 AATCATCGCGTAGAAGCCAGTGG - Intergenic
1150066488 17:62113995-62114017 CATGATGTCTTATAGGGCAGTGG - Intergenic
1155880887 18:31146701-31146723 CATGAACACTTATATGCCATTGG - Intronic
1159651302 18:70982261-70982283 CATAATAGCTTATATTCCAGAGG - Intergenic
930961349 2:57266133-57266155 CATGATTCCTTTTAAGCCTGTGG - Intergenic
941653534 2:168119122-168119144 CATGGTCGGTTTTAAGCGAGAGG + Intronic
943351353 2:186799958-186799980 CATGTTCACTTATAAGTCAGAGG - Intergenic
943981390 2:194555842-194555864 CATGATCATTTGTAAGCAAGTGG + Intergenic
1170278858 20:14623685-14623707 CATCATCCCTGAAAAGCCAGTGG + Intronic
955887625 3:63617806-63617828 CATGACAGCTTATAAAGCAGAGG - Intergenic
961215108 3:125153597-125153619 CATTATCTCTTAGAAGTCAGTGG - Intronic
967290311 3:187913379-187913401 CATGGAGGCTTATAAGCAAGTGG + Intergenic
995131671 5:108637004-108637026 AATGATCGTTTATAAGTGAGAGG - Intergenic
995353404 5:111209369-111209391 CATACTCTCTGATAAGCCAGAGG + Intergenic
1005138457 6:22598867-22598889 CATGTTAGCTAATATGCCAGAGG + Intergenic
1010486606 6:76421920-76421942 CATGATTTTTTATAAGCAAGGGG - Intergenic
1027496681 7:78895903-78895925 CATGATGGATTATAAGTAAGTGG + Intronic
1033772062 7:144563898-144563920 CATGTTCCCTTATAAGGCAGAGG - Intronic
1041662012 8:60410186-60410208 CATGCTCGCTGTTAAGCCTGTGG - Intergenic
1042878922 8:73466404-73466426 CATCCTCTCTAATAAGCCAGAGG - Intronic
1059374732 9:113873255-113873277 CATGAGCTTTTATAGGCCAGAGG + Intergenic
1195858613 X:109357282-109357304 CTTGATCTCTGAAAAGCCAGTGG + Intergenic
1197053258 X:122086612-122086634 CATGAGCTCTAATAAGGCAGAGG + Intergenic
1197539233 X:127734762-127734784 CATGATCTCTGATAAGTCAAAGG - Intergenic
1198112433 X:133513688-133513710 CATGATTGCTTCTAATCCAAGGG + Intergenic