ID: 1124953314

View in Genome Browser
Species Human (GRCh38)
Location 15:34343082-34343104
Sequence ATAAGCCAGCGGTCCCAATT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124953311_1124953314 16 Left 1124953311 15:34343043-34343065 CCTGCTCGTTGAGGTAATACTGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG 0: 1
1: 0
2: 0
3: 4
4: 44
1124953310_1124953314 17 Left 1124953310 15:34343042-34343064 CCCTGCTCGTTGAGGTAATACTG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124953314 Original CRISPR ATAAGCCAGCGGTCCCAATT CGG Exonic
913690913 1:121279077-121279099 ATCAGCCCGCGCTCCCCATTGGG - Intronic
914146627 1:145000886-145000908 ATCAGCCCGCGCTCCCCATTGGG + Intronic
918517114 1:185375510-185375532 AGAAGCCAGGGATACCAATTAGG - Intergenic
920478235 1:206297552-206297574 ATCAGCCCGCGCTCCCCATTGGG - Intronic
1065119359 10:22513883-22513905 AAAAGGCAGCAGTCCCAGTTAGG - Intergenic
1068646227 10:59470900-59470922 AAAAGGCAGCAGCCCCAATTAGG + Intergenic
1074146408 10:110720864-110720886 AAAAGCCAGAGGTCCCACTATGG + Intronic
1086438998 11:86809273-86809295 ATAAGGCAGTGTTCCCATTTAGG + Exonic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1095491637 12:42740618-42740640 ATAATTCAGCAGTCCCATTTTGG + Intergenic
1095690914 12:45087636-45087658 ATAATCCAGCACTCCCATTTAGG - Intergenic
1097475158 12:60045591-60045613 ATAATCCAGCAATCCCACTTTGG - Intergenic
1098886384 12:75964780-75964802 TTAAGCCAGAGGTTCCAATTTGG - Intergenic
1104679438 12:130739354-130739376 ATAATCCAGCTGTGCCAGTTAGG - Intergenic
1108939509 13:55935398-55935420 ATATGCCAGAGGGCCCAGTTTGG + Intergenic
1116366353 14:44070270-44070292 ATAAGCTAGCAGTCCCACTTGGG - Intergenic
1119356616 14:74012387-74012409 ATGAGCCACCGGTCCCAGCTGGG + Intronic
1120799693 14:88674839-88674861 ATAATACAGCTGTCCCAAATAGG + Intronic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1130065870 15:80604594-80604616 TTAAGCAAGAGGTCCCAGTTGGG + Intergenic
1132204882 15:99979477-99979499 AAAAGCCAACGTTCCCAATGCGG + Intronic
1141673895 16:85507429-85507451 GTAACCCTGCGGTCCCAAATGGG - Intergenic
1154301906 18:13201464-13201486 ATAACCCAGCAGTTCCACTTTGG + Intergenic
940029284 2:149243818-149243840 TTAAGACAGTGGTCCTAATTTGG + Intergenic
1169471338 20:5888090-5888112 ATAAACCACCTGTACCAATTAGG - Intergenic
1178468040 21:32866603-32866625 ACATGCCAGTGGTCCCACTTGGG - Intergenic
956517076 3:70061331-70061353 CTAAGCCAGAGGTCCTAAATTGG + Intergenic
958018921 3:87974016-87974038 ATGAGCCACCAGTGCCAATTTGG + Intergenic
972366936 4:38384808-38384830 ATAAGCCAGCCTTGCAAATTAGG - Intergenic
981429556 4:144644731-144644753 ATAAGGCAGTTGTCCCATTTTGG - Intergenic
984013013 4:174392977-174392999 ATAATCCAGCAATCCCACTTTGG - Intergenic
987495657 5:18641058-18641080 AAAAGCCACCGGTTTCAATTAGG + Intergenic
996506852 5:124277359-124277381 ATCAGCCAGGCATCCCAATTAGG - Intergenic
999086743 5:148898802-148898824 ATAAGCCAGGAGACCCAACTAGG + Intergenic
999854893 5:155583529-155583551 GTAAACCAGGGGTCCCAGTTGGG - Intergenic
1001587371 5:172842533-172842555 AGGATCCAGCGGTCCCACTTTGG - Intronic
1008482096 6:51996289-51996311 ATGAGCCACCGCTCCCAGTTGGG + Intronic
1017859762 6:158384671-158384693 ATTAGCCAGCTGTCTAAATTGGG + Intronic
1018603559 6:165573903-165573925 ATAAGCCAGGGGTCCCTACTGGG - Intronic
1019860225 7:3651904-3651926 CTAAGCCAACGATCCCAAGTCGG + Intronic
1024246750 7:47476554-47476576 AAAAGCCAGAGGTCCCAATGAGG + Intronic
1046765065 8:118060251-118060273 TTAAGCCAGTGGTCACAAATTGG + Intronic
1050486872 9:6143653-6143675 ATAGGCCAGCGGTCTCCAATAGG + Intergenic
1056909521 9:90686015-90686037 ACCAGCCTGCAGTCCCAATTAGG - Intergenic
1061094101 9:128444485-128444507 AGCAGCCAGGGGTCCCAAGTCGG + Intergenic
1062016792 9:134295057-134295079 ACAGGCCAGCGGTCCACATTAGG + Intergenic
1191788734 X:64945737-64945759 AAAAGGCAGCAGTCCCAGTTAGG - Intronic
1196888548 X:120270533-120270555 CTAAACCAGCGATACCAATTAGG + Intronic
1197586960 X:128360313-128360335 ATAAGCAAGCAATCCAAATTTGG + Intergenic