ID: 1124954414

View in Genome Browser
Species Human (GRCh38)
Location 15:34350724-34350746
Sequence GGTCATAGTGGGCTTCAGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 7, 3: 17, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124954414_1124954424 -1 Left 1124954414 15:34350724-34350746 CCCGGCTGAAGCCCACTATGACC 0: 1
1: 0
2: 7
3: 17
4: 175
Right 1124954424 15:34350746-34350768 CCTGGAGGAGGGACTGCCATTGG 0: 1
1: 0
2: 2
3: 29
4: 314
1124954414_1124954426 13 Left 1124954414 15:34350724-34350746 CCCGGCTGAAGCCCACTATGACC 0: 1
1: 0
2: 7
3: 17
4: 175
Right 1124954426 15:34350760-34350782 TGCCATTGGCTGTGCAGGAGTGG 0: 1
1: 0
2: 1
3: 17
4: 245
1124954414_1124954425 8 Left 1124954414 15:34350724-34350746 CCCGGCTGAAGCCCACTATGACC 0: 1
1: 0
2: 7
3: 17
4: 175
Right 1124954425 15:34350755-34350777 GGGACTGCCATTGGCTGTGCAGG 0: 1
1: 0
2: 0
3: 16
4: 170
1124954414_1124954427 14 Left 1124954414 15:34350724-34350746 CCCGGCTGAAGCCCACTATGACC 0: 1
1: 0
2: 7
3: 17
4: 175
Right 1124954427 15:34350761-34350783 GCCATTGGCTGTGCAGGAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124954414 Original CRISPR GGTCATAGTGGGCTTCAGCC GGG (reversed) Exonic
900174807 1:1286954-1286976 GGTCAGAGTGGGGTTCAGACTGG + Exonic
901132006 1:6967776-6967798 AGGCACAGTGGGCTTCTGCCTGG + Intronic
902608020 1:17580067-17580089 AGTCAGAGTGGCCTTCAGCAGGG + Intronic
907406102 1:54254401-54254423 GGTGACAGTGGAGTTCAGCCGGG - Intronic
907481436 1:54748072-54748094 GGTCACGTTGGGCTTGAGCCTGG - Intergenic
909631795 1:77775803-77775825 TGTCACAGTGGTCTTCAGCAAGG - Intergenic
912498436 1:110106311-110106333 GGTCACAGCAGGCTACAGCCCGG + Intergenic
913691131 1:121281010-121281032 GTTCAGAGGGGCCTTCAGCCTGG + Intronic
916641007 1:166729246-166729268 GGTCACATTGGGATTCATCCAGG + Intergenic
917121168 1:171645845-171645867 GGCCATGGTGGGATTCAGCAGGG - Intronic
917429983 1:174956262-174956284 CGTCATAGTGCACTGCAGCCTGG + Intronic
920478455 1:206299486-206299508 GTTCAGAGGGGCCTTCAGCCTGG + Intronic
1066410233 10:35161448-35161470 GGTCCCAGTGGACTCCAGCCTGG + Intronic
1067776989 10:49171030-49171052 GGTCCTCGTGGGCTTCCTCCTGG - Intronic
1067808792 10:49411035-49411057 GGTCCTGGTGGGCTCCTGCCTGG - Intergenic
1067944534 10:50681848-50681870 GGTCATGGTGGGCTTCTGCCGGG - Intergenic
1070866035 10:79708719-79708741 GGTCATGGTGGGCTTCCGCCGGG - Exonic
1070879828 10:79846850-79846872 GGTCATGGTGGGCTTCCGCCGGG - Exonic
1071632937 10:87230940-87230962 GGTCATGGTGGGCTTCCGCCGGG - Exonic
1071646386 10:87363158-87363180 GGTCATGGTGGGCTTCCGCCGGG - Exonic
1074704503 10:116119020-116119042 GGTCATAGCTGGCTCCTGCCTGG + Intronic
1074925004 10:118059724-118059746 GGTCATAGTGAGCATCATGCTGG - Intergenic
1081106525 11:39077287-39077309 GATAATAGTGGGATTCATCCCGG + Intergenic
1082762810 11:57143693-57143715 GGTCAGAGTGGGCTTTTGCAAGG - Intergenic
1084180025 11:67441572-67441594 GGGCAGAGTGGGCCTCAGCCTGG - Intronic
1084270757 11:68027954-68027976 TGTCATGGTGGTCTACAGCCTGG - Exonic
1084898650 11:72293813-72293835 GGTCCTAGTGGGGTTCATACTGG + Intronic
1091663179 12:2399527-2399549 GGTCAGAGAGGAGTTCAGCCGGG - Intronic
1100799389 12:98215511-98215533 GGTCAGAGTGGGCTTTAGAGAGG - Intergenic
1101710026 12:107256617-107256639 GGTAATATTGAGCTTCATCCTGG + Intergenic
1101988751 12:109467576-109467598 GGCCCTAGTGCACTTCAGCCTGG + Intronic
1106228075 13:27799986-27800008 GGTCAGAGTGGGCATGAGTCTGG + Intergenic
1106978827 13:35253600-35253622 GGTCATAGTTGGCTGAAACCTGG - Intronic
1107915980 13:45151423-45151445 GTTCATAGTGAGCTACAGCCTGG + Intronic
1108208050 13:48111110-48111132 TGACATGCTGGGCTTCAGCCAGG + Intergenic
1108220293 13:48226995-48227017 TGTCCTACTGGGCTTCATCCAGG - Intergenic
1108483505 13:50900720-50900742 GGTCACAGTGGGCTTCATAAAGG - Intergenic
1111991695 13:95123404-95123426 CGTGCTAGTGTGCTTCAGCCTGG - Intronic
1114174083 14:20303533-20303555 GGTCATAGTGGGATGGAGACAGG - Intronic
1118974512 14:70665213-70665235 GGTCAGAGAGGACTTCAGGCAGG + Intronic
1119597018 14:75944425-75944447 GGTGAAAGTGGGATCCAGCCAGG - Intronic
1120861682 14:89260526-89260548 GGACAAAGTGGGCTGCACCCAGG - Intronic
1121721622 14:96112863-96112885 GGTGAAAGTGGTATTCAGCCAGG + Intergenic
1121782546 14:96631245-96631267 GGGCATAGTGGGCTCCAGGCTGG + Intergenic
1122853051 14:104547082-104547104 GGTCCTCATGGGCATCAGCCAGG + Intronic
1123121448 14:105918811-105918833 GGTCATGGTGGGTTCCAGCTGGG + Intronic
1124032914 15:26027658-26027680 GTTCATAGTGCGCTGCAGGCTGG + Intergenic
1124954414 15:34350724-34350746 GGTCATAGTGGGCTTCAGCCGGG - Exonic
1125479780 15:40072192-40072214 GGTCAGTGTTGGCTTCAGGCGGG - Intergenic
1127930467 15:63593525-63593547 GGGCAGAGTGGTCTTCAGACAGG + Intronic
1128386704 15:67154212-67154234 TGGCATAGGGGGCTGCAGCCTGG + Intronic
1129544195 15:76377143-76377165 GGTCTTAGTGGGCTTGAACCAGG + Intronic
1131029656 15:89175876-89175898 GGTCGTCGTGGGCTTCAGCCTGG + Exonic
1132500217 16:281667-281689 GGCCAGAGGGGGCTCCAGCCTGG + Intronic
1135063596 16:19290902-19290924 GGTCATAGCTTGCTGCAGCCTGG + Intronic
1135193610 16:20376067-20376089 GGTCATCGTTGGCTTCTTCCAGG - Exonic
1136487598 16:30583277-30583299 GGTCAGAGTGTCCTTGAGCCAGG + Exonic
1138352443 16:56353167-56353189 TGCCAGAGTGGGCTACAGCCTGG - Intronic
1139558516 16:67727643-67727665 GGAAAGAGTGGGCTCCAGCCAGG - Intronic
1140967153 16:79977922-79977944 GGTCACAGTTGGCTGCAGCAGGG - Intergenic
1142082754 16:88158598-88158620 GCTGAGAGTGGGCTTCAGCCAGG - Intergenic
1142565748 17:839136-839158 GTTCATAGTGAGCGTCAGGCCGG + Intronic
1144392465 17:14807465-14807487 GGTCATAGAGGGTTTCTTCCTGG + Intergenic
1144856944 17:18274475-18274497 GCACACAGTGGGCTTCAGCTGGG + Exonic
1145911944 17:28548121-28548143 GGGCTCAGTGGGCTTCAGGCTGG + Intronic
1147141428 17:38462827-38462849 GGTCCTAGTGGGCATCAGCCAGG - Exonic
1148642752 17:49200691-49200713 GAGCAGAGTGGGCTGCAGCCGGG + Intergenic
1151129194 17:71878425-71878447 GATCACAGTGGCCTTCTGCCTGG + Intergenic
1151566644 17:74902272-74902294 GGGCTCAGTGGGCATCAGCCAGG - Intergenic
1155468112 18:26161670-26161692 GATCATAGTGCACTACAGCCTGG - Intronic
1156479473 18:37427060-37427082 TGCCATGGTGGGCTTCACCCAGG - Intronic
1157840108 18:50949397-50949419 GGTCATAGAGCACTGCAGCCTGG + Exonic
1158500991 18:58001702-58001724 GATCATAGCTGGCTGCAGCCAGG + Intergenic
1160437880 18:78865827-78865849 GGTCCTAATGGCCTTCACCCTGG - Intergenic
1160437917 18:78865964-78865986 GGTCCTAATGGCCTTCACCCTGG - Intergenic
1160831191 19:1105555-1105577 GGTCGGGGTGGGCTCCAGCCTGG + Intronic
1161258656 19:3323495-3323517 GGTGATCGGCGGCTTCAGCCGGG + Intergenic
1162363515 19:10233590-10233612 GGTGCTATTGGACTTCAGCCTGG + Intergenic
1162767801 19:12930494-12930516 TGGCAAAGTGGGCTTCAGCAAGG - Exonic
1162904069 19:13813132-13813154 GGCCATGGTGGGCTGCAGGCTGG - Exonic
1163439504 19:17314570-17314592 GGACCTTGGGGGCTTCAGCCTGG + Intronic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1165101605 19:33441684-33441706 GGTCAAGGTCGGCCTCAGCCAGG - Intronic
1166003143 19:39890078-39890100 GGACAAGGTGGGCATCAGCCAGG + Intronic
1167596159 19:50429220-50429242 GGCCAGAGTGGTCTTCAGCATGG - Exonic
1168646392 19:58061600-58061622 CGTGGTAGTGGGCTTCAGCCAGG + Exonic
925972842 2:9119145-9119167 GGTCATGGAGGGCTTCAAGCAGG - Intergenic
926153422 2:10436836-10436858 GTGCAAAGTGGGCATCAGCCAGG + Intergenic
929982275 2:46692687-46692709 GGTCATGGTGGGCTTCACTAAGG - Intergenic
932704330 2:74011448-74011470 GGGCCTAGAGGGCTTCAGCTTGG + Intronic
935733984 2:106091567-106091589 AGTCATAGTGGGCTTAAGCAAGG - Intergenic
941042141 2:160634616-160634638 GGTCACAGTGCTCTTTAGCCTGG + Intergenic
941687415 2:168461326-168461348 GGCAAGAGTGGGCTTCAGGCCGG + Intronic
943625761 2:190197623-190197645 GGTCATTGTGGGATTCTACCTGG - Intronic
944099991 2:196014546-196014568 GGTCAGGGTGGGTTTCAGCTTGG - Intronic
945809101 2:214526558-214526580 AGTCAAAGTGGAATTCAGCCAGG - Intronic
946154131 2:217796119-217796141 GCTCCTAGTGGCTTTCAGCCTGG + Intergenic
947235549 2:227937227-227937249 GGTCCTGGTGGTCTTCAGCTGGG - Intergenic
948036643 2:234863434-234863456 CCTCAGAATGGGCTTCAGCCGGG - Intergenic
948990233 2:241550385-241550407 TGGAAGAGTGGGCTTCAGCCAGG - Intergenic
1170847873 20:19977187-19977209 GGTCAGAGGGGGGTGCAGCCAGG + Intronic
1172166734 20:32904055-32904077 GGTTACAGTGAGCTCCAGCCTGG - Intronic
1172468526 20:35174675-35174697 GGGCAGAGTCAGCTTCAGCCTGG - Intronic
1176180862 20:63748677-63748699 GGTCATTGCCGGGTTCAGCCTGG - Intronic
1176679471 21:9811644-9811666 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1176679757 21:9813052-9813074 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1176680324 21:9815870-9815892 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1176680608 21:9817279-9817301 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1176681176 21:9820091-9820113 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1176681460 21:9821510-9821532 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1176681749 21:9822919-9822941 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1176682022 21:9824328-9824350 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1181175162 22:21031164-21031186 TGTCATCCTGGGCTTCATCCTGG - Exonic
949517691 3:4821985-4822007 CTTCATAGTAGGCATCAGCCTGG - Intronic
950884187 3:16348487-16348509 GGACACAGTGGGCTCCAGCTGGG - Intronic
955291280 3:57694341-57694363 GATCATAGCGCGCTGCAGCCTGG - Intergenic
955859390 3:63311407-63311429 GCTCATAGTGGTCTTTGGCCCGG - Intronic
955915845 3:63907225-63907247 GGTAGAAGTGGGATTCAGCCTGG + Intronic
957040584 3:75332730-75332752 GTTCATAGTGGCCTCCTGCCTGG + Intergenic
960420955 3:117444696-117444718 GGTCAGAGAGGTGTTCAGCCAGG - Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961045369 3:123704291-123704313 GTTCATAGTGGCCTCCTGCCTGG + Intronic
964967167 3:162510012-162510034 GGTCATAGTGATCTTGAGGCTGG - Intergenic
965789950 3:172376647-172376669 GGTATTTGTGGGTTTCAGCCTGG + Intronic
966718331 3:183036234-183036256 GGCCATAGTGGGGTTCATCCTGG - Intronic
970030370 4:11667129-11667151 GGTCATAGTGGTGTTCAGTTTGG + Intergenic
974849240 4:67385504-67385526 GGTGAAAGTGGGCATCCGCCAGG - Intergenic
975803825 4:78091721-78091743 GGTCATAGTGCCCTACAGCCCGG + Intronic
982035819 4:151344634-151344656 GGTCATAGTGGGCAACAGATGGG + Intergenic
982259558 4:153482655-153482677 TGTCATAGTGAACTGCAGCCTGG + Intronic
982398544 4:154940311-154940333 GGTCACAGTGGAATACAGCCTGG - Intergenic
983939517 4:173525391-173525413 GGTCATAGTGGACACCAGCTAGG + Intronic
989563084 5:42873278-42873300 GATCATTGTGGCCTTCAGCAGGG - Intronic
997440754 5:133907199-133907221 GGGCCTAGTGGGGTCCAGCCAGG + Intergenic
999453222 5:151694057-151694079 GGCCAGAGCTGGCTTCAGCCTGG - Intergenic
1000742503 5:164987171-164987193 GGTCAGAGAGGAGTTCAGCCAGG + Intergenic
1000908150 5:166988718-166988740 GGACATGGAGGGCTCCAGCCAGG - Intergenic
1001702348 5:173716261-173716283 GGTCCTGGTGGGCTCCAGGCAGG - Intergenic
1002298783 5:178246188-178246210 GGTCATGGTGGCGCTCAGCCCGG - Intronic
1003255892 6:4474599-4474621 GGAGATGGTGGGCTTCATCCTGG - Intergenic
1003682116 6:8266574-8266596 GGTCACTGTGGGCTGCACCCGGG + Intergenic
1006056202 6:31386415-31386437 GGTCCTATTGGGCTTCTGCAAGG + Intergenic
1006452185 6:34111692-34111714 GGTCAGAATGGGCAGCAGCCAGG + Intronic
1007511915 6:42380427-42380449 GGCTATGCTGGGCTTCAGCCTGG - Intronic
1011826033 6:91306674-91306696 GTTGATAGTGGGCTAGAGCCTGG + Intergenic
1014523180 6:122470142-122470164 GGTCGTAGTGAACTGCAGCCTGG - Intronic
1015370149 6:132441219-132441241 GGTCATAGCGGCCTACAGGCAGG - Intergenic
1015967961 6:138713902-138713924 GGTCATAGTGAGCTTTTGGCTGG - Intergenic
1019138912 6:169930935-169930957 GGTCACACTGGGGTTCAGCCAGG - Intergenic
1021936519 7:25637130-25637152 GGTCACAGTGGGAGTTAGCCAGG - Intergenic
1026088898 7:67283927-67283949 GGTCATAGTGTATTTCAGCCGGG + Intergenic
1026725356 7:72866420-72866442 GGTCATAGTGTATTTCAGCCGGG - Intergenic
1026747444 7:73024279-73024301 GGTCATAGCGTATTTCAGCCGGG - Intergenic
1026751094 7:73052418-73052440 GGTCATAGCGTATTTCAGCCGGG - Intergenic
1026754743 7:73080532-73080554 GGTCATAGCGTATTTCAGCCGGG - Intergenic
1026758395 7:73108566-73108588 GGTCATAGCGTATTTCAGCCGGG - Intergenic
1027033650 7:74909571-74909593 GGTCATAGCGTATTTCAGCCGGG - Intergenic
1027089010 7:75284919-75284941 GGTCATAGCGTATTTCAGCCGGG + Intergenic
1027092653 7:75312847-75312869 GGTCATAGCGTATTTCAGCCGGG + Intergenic
1027096296 7:75340814-75340836 GGTCATAGCGTATTTCAGCCGGG + Intergenic
1027118489 7:75499245-75499267 GGTCATAGCGTATTTCAGCCGGG + Intergenic
1027273311 7:76536221-76536243 GGTCATAGCGTATTTCAGCCGGG - Intergenic
1027323046 7:77026878-77026900 GGTCATAGCGTATTTCAGCCGGG - Intergenic
1027326755 7:77055285-77055307 GGTCATAGCGTATTTCAGCCGGG - Intergenic
1029397301 7:100317084-100317106 GGTCATAGCGTATTTCAGCCGGG + Exonic
1029719000 7:102350777-102350799 GGTCATAGCGTATTTCAGCCGGG - Intergenic
1029753614 7:102558481-102558503 GGTCATAGCGTATTTCAGCCGGG + Exonic
1029771562 7:102657565-102657587 GGTCATAGCGTATTTCAGCCGGG + Exonic
1033501048 7:141950091-141950113 GGTCATAGTGGAACTCAGACTGG - Intronic
1033670554 7:143488791-143488813 GGTCATAGTGGCCTCCAGTGTGG - Intergenic
1034973725 7:155436029-155436051 GGTCATGCTGGGCTTTAGTCTGG + Intergenic
1035046970 7:155974079-155974101 GGTCATGGTGGGCTCCAGACAGG + Intergenic
1036409311 8:8484084-8484106 GATCATAGTGCACTACAGCCTGG - Intergenic
1039290457 8:36088952-36088974 GGTCAGAGAGGAGTTCAGCCAGG - Intergenic
1039930181 8:41979537-41979559 GGCCAAGGTGGGCTCCAGCCTGG + Intronic
1049592417 8:143468680-143468702 GGTCATAGCAGGCCACAGCCTGG + Intronic
1049775264 8:144401080-144401102 GGGCAGAGGGGGCATCAGCCAGG + Intronic
1052438723 9:28465333-28465355 GGTCAGAGAGGAGTTCAGCCGGG - Intronic
1057354439 9:94322287-94322309 CGTCATGGTGGGCTTCCGCCGGG + Exonic
1057653322 9:96935348-96935370 CGTCATGGTGGGCTTCCGCCGGG - Exonic
1058525525 9:105853936-105853958 AGTCTTAGTGGTCTTCAGCAGGG + Intergenic
1203664639 Un_KI270754v1:14179-14201 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203664922 Un_KI270754v1:15586-15608 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203665488 Un_KI270754v1:18402-18424 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203665767 Un_KI270754v1:19812-19834 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203666058 Un_KI270754v1:21222-21244 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203666635 Un_KI270754v1:24038-24060 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203666914 Un_KI270754v1:25450-25472 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203667205 Un_KI270754v1:26861-26883 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203667784 Un_KI270754v1:29677-29699 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203668062 Un_KI270754v1:31089-31111 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203668353 Un_KI270754v1:32500-32522 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203668926 Un_KI270754v1:35319-35341 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203669202 Un_KI270754v1:36726-36748 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1203669775 Un_KI270754v1:39542-39564 GGTCATTGTGTGCTGCAGCGAGG - Intergenic
1185523415 X:758819-758841 GGTCATAGATGTCTTCACCCAGG + Intergenic
1193958887 X:87899181-87899203 GGTCATACTGGGCTTGATTCTGG + Intergenic
1195256997 X:103100840-103100862 GGTGATAGTACGCTACAGCCTGG - Intergenic
1196749510 X:119102442-119102464 GATCATAGTGCACTACAGCCTGG + Intronic
1197758004 X:130009798-130009820 GGTCATAGCAGGCTTCAGTCAGG - Intronic