ID: 1124955264

View in Genome Browser
Species Human (GRCh38)
Location 15:34356118-34356140
Sequence CCTTCCCAGGGCACTGCTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124955264_1124955269 -4 Left 1124955264 15:34356118-34356140 CCTTTAGCAGTGCCCTGGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1124955269 15:34356137-34356159 AAGGCTCTTCAGGAGCCATGTGG 0: 1
1: 1
2: 0
3: 24
4: 184
1124955264_1124955270 -3 Left 1124955264 15:34356118-34356140 CCTTTAGCAGTGCCCTGGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1124955270 15:34356138-34356160 AGGCTCTTCAGGAGCCATGTGGG 0: 1
1: 1
2: 0
3: 21
4: 169
1124955264_1124955274 21 Left 1124955264 15:34356118-34356140 CCTTTAGCAGTGCCCTGGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1124955274 15:34356162-34356184 AGATGACAGAGGTACCCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 131
1124955264_1124955271 -2 Left 1124955264 15:34356118-34356140 CCTTTAGCAGTGCCCTGGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1124955271 15:34356139-34356161 GGCTCTTCAGGAGCCATGTGGGG 0: 1
1: 0
2: 1
3: 21
4: 224
1124955264_1124955272 10 Left 1124955264 15:34356118-34356140 CCTTTAGCAGTGCCCTGGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 202
Right 1124955272 15:34356151-34356173 GCCATGTGGGGAGATGACAGAGG 0: 1
1: 1
2: 3
3: 23
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124955264 Original CRISPR CCTTCCCAGGGCACTGCTAA AGG (reversed) Exonic
900604480 1:3517672-3517694 CCTACCCAGGCCACAGCCAAAGG + Intronic
900616847 1:3569308-3569330 CCTGCCCAGGGCAAGGCTGAGGG - Intronic
904344611 1:29859741-29859763 ACTGCCTAGGGCACTGCTTATGG + Intergenic
906149767 1:43580903-43580925 ATTTCCCAGGGCACAGCTACAGG + Intronic
906505991 1:46380032-46380054 CTTTCCCAGGGGCCTACTAAAGG - Intergenic
909265803 1:73557283-73557305 CCTTCCCACAGTAATGCTAAAGG + Intergenic
909855812 1:80529641-80529663 CATTCACAGAGCACTGCTGAGGG - Intergenic
910301785 1:85714212-85714234 GCTTCCCATGACACTGCTATCGG + Intergenic
912518623 1:110230803-110230825 CCTGCCCAGGGCCCTGGGAAAGG + Intronic
915234275 1:154469016-154469038 CCTTCACAGGGCACTGAGGAGGG - Exonic
918067164 1:181109205-181109227 TCTTCCCAGGGGGCTGCTGATGG - Intergenic
918197093 1:182232879-182232901 CATGCCCAGGGCTCTGCTAAGGG + Intergenic
918395486 1:184110019-184110041 CCTCCCGAGGGAACTGCAAATGG + Intergenic
922620189 1:226984085-226984107 CCTACCCAGGGACCTGCTGAAGG + Exonic
1063096368 10:2912662-2912684 CCTTCCCAGCGTACTTCTGATGG + Intergenic
1063609540 10:7551570-7551592 CAATCCCAGGGCTCTGCTCATGG + Intergenic
1064281656 10:13956858-13956880 CCTTCCCAGGATTTTGCTAAGGG - Intronic
1064655561 10:17552057-17552079 CCTTCCCAGGAGACTGCACATGG + Intergenic
1064964030 10:20997357-20997379 TCTCCCCATGGCACTGCCAAGGG + Intronic
1067879720 10:50032889-50032911 CCTTCCAAGGTCACTGCCCAGGG + Intergenic
1069774282 10:70917783-70917805 CCTTCCCAGAGCACTGGGCAGGG - Intergenic
1070470780 10:76777219-76777241 TCTTCCCTAGGCTCTGCTAAAGG - Intergenic
1074689391 10:115990773-115990795 CCTACCCAGGGCTTTGCTCATGG + Intergenic
1075808930 10:125210260-125210282 ACTTCCCAGGGCACTTCCCAGGG - Intergenic
1075850468 10:125582092-125582114 CCTTCCCATGGCAAGGCCAAGGG + Intronic
1076491778 10:130866665-130866687 CCCTCCCAGGGCACGGCTGTAGG + Intergenic
1076493441 10:130879839-130879861 CCTTCCCTGGGCACTGCTGCAGG + Intergenic
1077480280 11:2811354-2811376 CCTTCACAAAGCACTGATAAGGG - Intronic
1078578834 11:12523427-12523449 TCATCCCAAGGCACTGCTGAAGG - Intronic
1080451510 11:32382162-32382184 CCTTCCCAGGACGCTGCTAGGGG + Intergenic
1080512576 11:32989610-32989632 CCTTCCCATGGCCATCCTAATGG - Intronic
1082092361 11:48100358-48100380 CCTTCCCAAGGCTGTGCTAGTGG + Intronic
1083617164 11:64032026-64032048 CCATCCCAGGGCAGTGGTCAGGG - Intronic
1084273700 11:68041511-68041533 CCTGCCATGGGCACTGCTCATGG + Intronic
1085301589 11:75462068-75462090 CCTGCCCAGGGCCTAGCTAAGGG + Intronic
1089104396 11:115990133-115990155 CCATTCCAGGGCACTGCTGTGGG + Intergenic
1089228344 11:116946426-116946448 TTTTCACAGGGCACTGCAAAGGG + Intronic
1091698166 12:2641923-2641945 TCCTCCCAGGGGACTGCTGATGG - Intronic
1092592103 12:9961854-9961876 CCATCCTAGGGCACTGCAAAGGG - Intronic
1092719357 12:11425414-11425436 CCTGCACTGGGCACTGCAAATGG + Intronic
1092944901 12:13443641-13443663 CCCTCCCAGGCCACTGTGAAGGG - Intergenic
1095389662 12:41690291-41690313 CCTTACCACGGCACCACTAAAGG + Intergenic
1095415124 12:41968239-41968261 CCCTCCCAGTGCGCTGCTAATGG + Intergenic
1096038363 12:48492664-48492686 CCATCCCAGGGCGCTGCCACTGG - Intronic
1099873281 12:88374211-88374233 ATTTCCCAGGACACTGCCAAGGG + Intergenic
1100308246 12:93370992-93371014 CCTTCCCTGGGCACTGCTCCCGG - Intergenic
1100325215 12:93533804-93533826 CCGTCCCAGGGGTCTGCAAAGGG + Intergenic
1102866303 12:116377619-116377641 CCTTCCCAGGGAACTCTTGATGG + Intergenic
1103846253 12:123903715-123903737 CCTCCCCAGGGCACTGTTCCTGG + Intronic
1105004773 12:132714716-132714738 CCTCCCCAGGGCTGTGCCAAGGG + Intronic
1105642953 13:22285075-22285097 CCTGCCCTGGGCACTGCTCATGG - Intergenic
1105985580 13:25562955-25562977 CCTTCCCAGCACACTGTTGAGGG + Intronic
1106200816 13:27535736-27535758 CCTTCCCTGCCCACTGCAAAAGG - Intergenic
1108004651 13:45934546-45934568 CCTTGGCAGGGCAATGCTGATGG + Intergenic
1109121209 13:58460477-58460499 CCTTCCCAGGGCACTCAAAATGG + Intergenic
1112332375 13:98486298-98486320 CCTTCCCAGTGCAGTGCTGCAGG - Intronic
1113504907 13:110809201-110809223 CCTTCCCAGGGAGCAGCCAATGG - Intergenic
1113589893 13:111491139-111491161 CCTTCCCAGGGGACAGAGAAGGG - Intergenic
1114529262 14:23385475-23385497 ACTCCACAGGGCACTGCAAAAGG + Intronic
1114535336 14:23418897-23418919 CCTTGCCCGGGCACGGCTAGGGG - Intronic
1121263432 14:92583067-92583089 CCATCACAGGGCACTGGAAAGGG + Intronic
1121405948 14:93719537-93719559 CCTGCCCAGGGGTCTGCTTAGGG + Exonic
1121424907 14:93843459-93843481 CCTTCCCAGGGCTGTCCTCAGGG - Intergenic
1122227187 14:100286656-100286678 ACTTCCCAGGGAACTGGGAAAGG - Intergenic
1122366741 14:101198840-101198862 CCTTCCAAGCCCACTGCTCATGG + Intergenic
1122663071 14:103310817-103310839 CCTTCCCAGGGCTCAGCTTGGGG + Intergenic
1122781739 14:104146666-104146688 CCTTCCCAGGGCCCTCCCCATGG - Intronic
1122859872 14:104577727-104577749 TGTTCCCGGGGCACTGCTCAGGG + Intronic
1122909427 14:104819811-104819833 CCCTCCCAGGGCCCTGAGAAAGG - Intergenic
1122955087 14:105066775-105066797 CCTCCACAGGCCACTGCTCATGG + Intergenic
1123000909 14:105293624-105293646 CCTCCTCAGGGCACTGCCAACGG + Intronic
1124955264 15:34356118-34356140 CCTTCCCAGGGCACTGCTAAAGG - Exonic
1125484524 15:40103067-40103089 TCTTCCCCTGGCACTGGTAATGG + Intronic
1127662763 15:61115614-61115636 CCTTCCCAGGGTACTTCTCCGGG - Intronic
1131724573 15:95207449-95207471 CTTTCCTAGGGCAGTGCAAAAGG + Intergenic
1132234493 15:100208972-100208994 CCTTCCAAGGGCTCTTCCAATGG + Intronic
1135983194 16:27164589-27164611 CCTTCCCTGGAAACTGCCAATGG + Intergenic
1136376940 16:29871382-29871404 CCTGCCCAGGGCACCCCTCAAGG - Exonic
1138430183 16:56963368-56963390 TCTTCCCAGGGCAGTGGGAAAGG - Intronic
1142486104 17:248479-248501 CTTCCCCAGGGCAGTGATAAAGG - Intronic
1146720666 17:35121303-35121325 CCTTCCCAGGGCAGTGCGGAAGG + Exonic
1147492093 17:40879169-40879191 CTTTCCAAGGGCAAGGCTAAAGG - Intronic
1147969467 17:44211852-44211874 CCATCCCAGGGCAGCGCTCACGG + Exonic
1148441744 17:47715067-47715089 CCTGCCCAGGGCCCTGCTGTGGG - Intergenic
1151058913 17:71068051-71068073 GGCTCCAAGGGCACTGCTAACGG - Intergenic
1151516822 17:74601784-74601806 CCCTCCCTGGGCACTGCCCAGGG - Intergenic
1152644458 17:81462393-81462415 CCTCACCAGGGCACTGCTCGGGG + Intronic
1152659942 17:81537464-81537486 CCTTCCTTGTGCACTGCTCAAGG + Intergenic
1152718080 17:81909403-81909425 CCTTGCCAGGGCACAGCTGTAGG - Intronic
1154311315 18:13268506-13268528 CATTCCAAGGGAACAGCTAAAGG - Intronic
1156191578 18:34726891-34726913 CTTTCCTAGGGCAGTGCTAAGGG - Intronic
1156379715 18:36547049-36547071 CCTTCCCAGGGGGCAGCTTAGGG - Intronic
1156859434 18:41818749-41818771 CCTGTCCAGGGCTCTGCTCAGGG - Intergenic
1158681469 18:59570905-59570927 CAGGCCCAGGGCACTGCTAGGGG - Intronic
1160173367 18:76572746-76572768 CATACACAGGGCCCTGCTAAAGG + Intergenic
1160463807 18:79059121-79059143 CCTTCTCAGGAAACTGCTAGGGG + Intergenic
1160808051 19:1001136-1001158 CCTTCCCAGCGCCCTGGTGATGG + Intronic
1161586676 19:5109454-5109476 CCTTCCCAGGTCACTGTTCTTGG - Intronic
1162725815 19:12689277-12689299 CCTTCCCAGGTCTGTGCTGAGGG - Exonic
1163012411 19:14433959-14433981 CCCTCCCAGGGCACTGCGCCAGG - Intronic
1164818162 19:31222763-31222785 GATTCCCAGGGCAAAGCTAATGG - Intergenic
1166432963 19:42741971-42741993 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166436069 19:42767197-42767219 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166445951 19:42857225-42857247 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166448931 19:42881185-42881207 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166453330 19:42919376-42919398 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166455815 19:42938684-42938706 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166465608 19:43027960-43027982 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166471750 19:43084164-43084186 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166482886 19:43187980-43188002 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166485369 19:43207113-43207135 CCTTCCCTGGGCCCAGCTAAAGG - Intronic
1166492515 19:43271032-43271054 CCTTCCCTGGGCCCAGCTAAAGG - Intergenic
1166983730 19:46647939-46647961 CCTTCCCAGGGCACTCTGCAGGG + Exonic
1167577760 19:50325904-50325926 CCCTCCCAGGGCACAGGGAAAGG + Intronic
1167957357 19:53076964-53076986 ACTTTTCAGGGCACTGCTAAGGG + Intronic
927007162 2:18862788-18862810 ACTTCCCAGTCCACTGCTGATGG + Intergenic
927246865 2:20963768-20963790 CAATCCCAGGACAATGCTAAGGG - Intergenic
929667106 2:43841641-43841663 CCTTCCCAGGCCACAGTGAAGGG + Intronic
929914899 2:46126752-46126774 CCCTCCCATGGGACTGCTCAAGG - Intronic
930247974 2:49004130-49004152 CCTTCCCAGGCCAGCTCTAATGG + Intronic
930618961 2:53624750-53624772 CCATCCCAGGGCCTTGCAAAAGG + Intronic
932162260 2:69471783-69471805 CATTCCCACAGCACTGCTGAAGG + Exonic
933265625 2:80177957-80177979 CCTTTCTAGGGCATTGCTGAAGG - Intronic
933785873 2:85841124-85841146 CCTTCCCAGGGCACAGTTTCTGG + Intronic
935157648 2:100497376-100497398 CCTTCCCAGGGAAGTTCTCAGGG - Intergenic
935420685 2:102865872-102865894 CCTTCCCAGGGAAATTCAAAGGG + Intergenic
936191055 2:110336377-110336399 CCTTCCCAGGGCAGGGGTCAGGG + Intergenic
937337790 2:121072423-121072445 CCTTCCCCTGGCACTGCTGCTGG + Intergenic
939978967 2:148755961-148755983 CCTTCAAAAGGCATTGCTAATGG - Intronic
941003469 2:160224131-160224153 CCTTCACAGGGCTCAGCTCAGGG + Intronic
947369405 2:229429083-229429105 CCCTCCAAGGGCAGTGCTCAAGG - Intronic
948599770 2:239101570-239101592 CCTTCCTAGGGTCCTGCTCAGGG + Intronic
1171113354 20:22503572-22503594 GCTTCCCAGGCCACTTCCAATGG - Intergenic
1172199143 20:33113079-33113101 CCTGCCCAGGGAAGGGCTAAAGG + Intergenic
1172895379 20:38296268-38296290 CCTGCCCAGGGCTCTGCCTAAGG + Intronic
1174357749 20:50009816-50009838 CCTGCGCTGGGCCCTGCTAAGGG - Intergenic
1174757211 20:53171401-53171423 CCCTCCCAGGGGACTCATAAGGG - Intronic
1175019234 20:55826646-55826668 CCTTTCCACTGCACTGTTAATGG + Intergenic
1175416455 20:58804453-58804475 CCTTCACACTGCCCTGCTAATGG - Intergenic
1176083951 20:63287444-63287466 CCTTCCCAGGCCAGCGCTCAGGG - Intronic
1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG + Intronic
1179595073 21:42437948-42437970 CCTTCCCAGGGCAATGCACTGGG + Intronic
1179853611 21:44151084-44151106 CCTTCCCAGGGAGCTGCTGTTGG - Intergenic
1181003196 22:19997652-19997674 CCTGCCCAGGGCACCACCAAGGG + Intronic
1181035034 22:20165741-20165763 CCTGCCCAGAGCCCTGCTCAGGG + Intergenic
1181423018 22:22814886-22814908 CCTGGCCTGGGCACTGCTGATGG - Intronic
1181747566 22:24966434-24966456 CCTGCCCAGGGCACTGGGCAAGG - Intronic
1182066326 22:27434111-27434133 CCTGCCCAGGGCTCTGGGAAAGG - Intergenic
1184809767 22:46823438-46823460 CCTTCCCAGGGGACCTCAAATGG - Intronic
1185048651 22:48541813-48541835 CCTTCCCAGGGCACGGGTGGTGG - Intronic
1185139132 22:49090510-49090532 GCTTCCAAGGGAAATGCTAATGG - Intergenic
1185230464 22:49677547-49677569 CCCTCCCAGGGTCCTGCTCAGGG - Intergenic
949626591 3:5874225-5874247 CCTTCCCAGCCCACTGCCACTGG + Intergenic
949788180 3:7764367-7764389 ACTGCCCAGGGCACTGCCACAGG - Intergenic
950629976 3:14275855-14275877 CTCTCCCAGGGCACTGTGAATGG + Intergenic
950684050 3:14603735-14603757 CCTTCCCAGGACAGAGCTGAGGG - Intergenic
952356564 3:32590409-32590431 CCTACCCAAGGCACTTCTCAAGG - Intergenic
953040863 3:39253714-39253736 CCTTCCCAGGACTCTGCCCAGGG - Intergenic
953969122 3:47333333-47333355 CCTGCACAGGACACTGCCAAAGG + Intronic
955647437 3:61154972-61154994 CCCTGCCAAGGCACTGCCAAAGG + Intronic
956696986 3:71926856-71926878 CCACCCCAGGGCACAGCTGAAGG - Intergenic
958259525 3:91364363-91364385 CCTTCCCTAGGGACTGCTCAGGG - Intergenic
960905999 3:122602216-122602238 CTTTCCCAGGGCACTGCCTTTGG + Intronic
962198206 3:133380822-133380844 CCTTCCCAGGGGATTCCTCAGGG + Exonic
962860797 3:139399080-139399102 CCTTCCCAGTGCCCTGAAAATGG + Intergenic
967977923 3:195045741-195045763 CCCACCCAGGGCAGTGCTGAAGG + Intergenic
977380239 4:96263817-96263839 CATTCCCATAGCTCTGCTAAAGG - Intergenic
977522819 4:98107030-98107052 CCATCCCCGCTCACTGCTAAAGG + Intronic
977869878 4:102078602-102078624 CCTTTCCATGTCACTGTTAATGG - Intergenic
978408630 4:108405607-108405629 CTCTACCAGGGCAGTGCTAAGGG - Intergenic
984885302 4:184444356-184444378 ACTTCCCAGGGCACTGCTTCAGG + Intronic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
985846951 5:2356930-2356952 ACTTCCCAGGGCTGTGCCAAGGG + Intergenic
986449936 5:7853603-7853625 ACTACCCAGGTCACTGCTGAAGG + Intronic
990804642 5:59645286-59645308 CCTTCCTAAGGCACTGGAAAAGG + Intronic
990851638 5:60211357-60211379 CCTTCACAGGGCACTGGGGACGG + Intronic
991602828 5:68370652-68370674 CCTTCCCAGGGCATAACTCAAGG - Intergenic
993429400 5:87813648-87813670 CCTTCCCTAGGCACTGGTCAGGG - Intergenic
997796192 5:136813865-136813887 TCTTCCCAGGGCAATGCCTAAGG + Intergenic
998319623 5:141216445-141216467 CTTTCCCAGGGCACTGGGGAGGG - Exonic
999242504 5:150136115-150136137 CCTACACATGGCACTGCTGAAGG - Intronic
1000205335 5:159052686-159052708 CCTCCCCAGGGCTCTGCCGAAGG - Intronic
1001087184 5:168708720-168708742 CCTTCCCAGAGCTTTGCAAAGGG + Intronic
1002297930 5:178241644-178241666 CCCTCCCAGGGCACCGCTGATGG + Intronic
1006030522 6:31173779-31173801 CCTTCACAGAGCACTGCCAGGGG + Intronic
1006301381 6:33195158-33195180 CCTTGCCAGGCCTCTGGTAAAGG - Intronic
1008032455 6:46712432-46712454 CCACCCCAGGGCACTACTACAGG - Intronic
1008995709 6:57656003-57656025 CCTTCCCTAGGGACTGCTCAGGG + Intergenic
1010825245 6:80465103-80465125 GCTTCCCAGGAGGCTGCTAAAGG - Intergenic
1011453080 6:87516376-87516398 CCCTCCCAGGACAATGCTTATGG + Intronic
1011793253 6:90923273-90923295 CCTACCAAAGACACTGCTAAGGG - Intergenic
1012438227 6:99237562-99237584 GTGTTCCAGGGCACTGCTAATGG - Intergenic
1012683648 6:102215202-102215224 CCTTCACAGTGAACTGCTCAAGG - Intergenic
1014202657 6:118622888-118622910 CCTTCCATGGGCACTTCTAAAGG - Intronic
1015557189 6:134475210-134475232 GCTTCTCAGGTCACTGCTAGAGG + Intergenic
1016017190 6:139198578-139198600 CCTTCCTAGGGCACAGATTATGG - Intergenic
1017788256 6:157774078-157774100 CCTGCCCAGGGGACCGCAAAGGG + Intronic
1019710499 7:2516203-2516225 CCATCTCTGGGCACTGCTACTGG + Intronic
1020313557 7:6887865-6887887 CGTTCCCAGGGACCTGCCAAGGG - Intergenic
1020365908 7:7380259-7380281 TCTTCTCAGAGCACTTCTAAAGG + Intronic
1024351662 7:48372023-48372045 CCTTCCCAGGGCCCTTCACAGGG + Intronic
1026408538 7:70094309-70094331 CTGTCCCAGGACACTACTAATGG - Intronic
1035682955 8:1501870-1501892 CCTTCCAAGGGCCCTGCGAGAGG + Intronic
1036282043 8:7408706-7408728 CTCTACCAGGGCAGTGCTAAGGG + Intergenic
1036339426 8:7902865-7902887 CTCTACCAGGGCAGTGCTAAGGG - Intergenic
1036680813 8:10871995-10872017 GCTCCCCAGGGCACAGATAACGG - Intergenic
1037313928 8:17583221-17583243 CCCTACCAGGGCACTGCCTAGGG + Intronic
1037981555 8:23258104-23258126 CCTGCCTGGGGCACTGCTATGGG - Intronic
1040609873 8:48973356-48973378 ACATCCCAGGGTGCTGCTAAAGG + Intergenic
1041793547 8:61722724-61722746 CCTGCCCAGGGCACTGCCAGTGG + Intergenic
1043388087 8:79767825-79767847 CCTCCCCAGGGCCCTGGGAAGGG - Exonic
1043388090 8:79767826-79767848 CCTTCCCAGGGCCCTGGGGAGGG + Exonic
1044659180 8:94578701-94578723 CCCTCCCAGGTCACTGCCATTGG - Intergenic
1047246533 8:123150228-123150250 TTTTCCCAGGGCACTGATAATGG + Intronic
1048321013 8:133400156-133400178 CCTCTGCAGGGCCCTGCTAATGG + Intergenic
1049477766 8:142804739-142804761 CCTGTACAGGGCACTGCTACGGG - Intergenic
1051049071 9:12909949-12909971 CCTTGCCAGGGCACTGTTCCTGG - Intergenic
1052689223 9:31794671-31794693 CCTTCCCTGGGCATTGCCATTGG - Intergenic
1053383544 9:37668498-37668520 CCATCCCAGGACACTGCTCCCGG - Exonic
1057216246 9:93230425-93230447 TCCTCCCAGGGCACAGCTCAGGG + Intronic
1058391333 9:104498596-104498618 CCTTCCCAGACCACAGCAAAGGG + Intergenic
1058816252 9:108685096-108685118 GCTTCCCAGGGCATTGCTGTGGG - Intergenic
1060588480 9:124801405-124801427 CCCTCCCAGGACACAGCTAGAGG + Exonic
1186703923 X:12122221-12122243 CCTTCCTAGTACATTGCTAAGGG - Intergenic
1187280491 X:17854980-17855002 CCTTCCCTAGGCACTGGTCATGG - Intronic
1189192873 X:39126012-39126034 CCTTCCCAAGACACTGCCAGAGG + Intergenic
1192338192 X:70239344-70239366 TCTACCCAGGGCACTGTTCAGGG + Intronic
1192359804 X:70432298-70432320 CCTTCACAGGGCATTGCATAAGG + Exonic
1193356019 X:80521186-80521208 CCTTTCCAGGGCAGTGCCACTGG + Intergenic
1199265227 X:145820383-145820405 CCTTTCCAGAGCATTGCTAATGG - Exonic
1200098439 X:153674995-153675017 CCCTCCCAGGACACTGCAGAAGG + Intronic
1201667207 Y:16471886-16471908 CATTCCCAGGGAACTCCTGATGG - Intergenic