ID: 1124962396

View in Genome Browser
Species Human (GRCh38)
Location 15:34408770-34408792
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124962396_1124962405 19 Left 1124962396 15:34408770-34408792 CCTTCCTAGAGGAGACCAGCTTG 0: 2
1: 0
2: 0
3: 8
4: 116
Right 1124962405 15:34408812-34408834 CCCAGAGCAGCAGCCCACGGGGG 0: 2
1: 0
2: 6
3: 35
4: 351
1124962396_1124962402 17 Left 1124962396 15:34408770-34408792 CCTTCCTAGAGGAGACCAGCTTG 0: 2
1: 0
2: 0
3: 8
4: 116
Right 1124962402 15:34408810-34408832 TGCCCAGAGCAGCAGCCCACGGG 0: 2
1: 0
2: 26
3: 150
4: 556
1124962396_1124962403 18 Left 1124962396 15:34408770-34408792 CCTTCCTAGAGGAGACCAGCTTG 0: 2
1: 0
2: 0
3: 8
4: 116
Right 1124962403 15:34408811-34408833 GCCCAGAGCAGCAGCCCACGGGG 0: 2
1: 0
2: 4
3: 28
4: 299
1124962396_1124962401 16 Left 1124962396 15:34408770-34408792 CCTTCCTAGAGGAGACCAGCTTG 0: 2
1: 0
2: 0
3: 8
4: 116
Right 1124962401 15:34408809-34408831 ATGCCCAGAGCAGCAGCCCACGG 0: 2
1: 0
2: 7
3: 53
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124962396 Original CRISPR CAAGCTGGTCTCCTCTAGGA AGG (reversed) Intronic
900593473 1:3469937-3469959 CAAGCTGCTCACCTGTAGGCAGG + Intronic
900884971 1:5408647-5408669 CAAGCTTGTGTCCTAGAGGAAGG - Intergenic
902214647 1:14926681-14926703 CAAGGGGCTTTCCTCTAGGAGGG + Intronic
902643599 1:17782192-17782214 CAAACTCTTCTCCTCTAGCAAGG - Intronic
903357719 1:22758357-22758379 GAAGCTGTTCTCTCCTAGGAGGG - Intronic
908559665 1:65292966-65292988 CAAGCTAGTCTGCTGTAGGATGG - Intronic
915981752 1:160424747-160424769 CAAGCAGGTCTGCACCAGGAGGG - Intronic
916556305 1:165896926-165896948 CAGGCTGGGCTCCTCTACCAAGG - Intronic
917071120 1:171152089-171152111 CATGATGGTCTCATCAAGGAAGG - Exonic
918085202 1:181239135-181239157 CAGGCTGCTGTCCTCTTGGATGG + Intergenic
919009685 1:191944489-191944511 CAATGTGGTCTCCAATAGGAAGG - Intergenic
920449672 1:206050426-206050448 CATGCTGGTTTCCTCCAGGGAGG + Intronic
1064249643 10:13697094-13697116 GAATCTAGTCTCCTTTAGGAAGG - Intronic
1064384772 10:14879707-14879729 CAAGCTCGTCTCCTCTCCGCTGG + Intronic
1065266163 10:23978295-23978317 CAACCTGACCTCCTCGAGGAAGG + Intronic
1073589919 10:104747175-104747197 CTGGCTGGTCACCTCCAGGATGG + Intronic
1075633348 10:124014662-124014684 CAGACTGGTCTCCCCTACGAGGG - Intronic
1082828767 11:57600000-57600022 CAAGCTGGAAACCTCCAGGATGG - Exonic
1085450129 11:76626926-76626948 CAAGCAGGTCCTGTCTAGGAAGG - Intergenic
1086411439 11:86548487-86548509 CCAGCTGGTCTTGTCTGGGAAGG + Intronic
1094548173 12:31424595-31424617 CAAGGTGTTCTCCTCCAGGCCGG + Exonic
1097393199 12:59040753-59040775 CAACCTTCTCTCCTCTGGGAAGG - Intergenic
1110720309 13:78753934-78753956 CAAGCTGCTCAACTCAAGGAGGG - Intergenic
1114946860 14:27693214-27693236 CCAGCTGGTCTCCTCCAGCAGGG - Intergenic
1115936777 14:38561208-38561230 CAAGGTGCTCTCCTATAGGCTGG - Intergenic
1118482637 14:66182327-66182349 CAAGCAGGGCTCCTGGAGGAGGG + Intergenic
1121505527 14:94474078-94474100 CAACCTGGTCTCCTCTCCCATGG - Intronic
1122127458 14:99586958-99586980 CAAGCAGGTCCCCGGTAGGAGGG - Intronic
1122975972 14:105170906-105170928 CTACCTGGTCTCTTCTAGTAAGG + Intergenic
1124241780 15:28034260-28034282 CAAGAGGGTCTCCTCCAGGCTGG - Intronic
1124344981 15:28916228-28916250 CAGGCTGGTCTCCCCCAGGAAGG - Intronic
1124962396 15:34408770-34408792 CAAGCTGGTCTCCTCTAGGAAGG - Intronic
1124979020 15:34554992-34555014 CAAGCTGGTCTCCTCTAGGAAGG - Intronic
1127488442 15:59440102-59440124 CAACCAAGTCTCCTCTCGGAAGG + Intronic
1131038521 15:89241857-89241879 CTAGCAGGTCCACTCTAGGAAGG - Intergenic
1133569403 16:7026199-7026221 CAAGACCGTCTCTTCTAGGAAGG + Intronic
1135499206 16:22979140-22979162 CCAGCTGGTCTTCCCTAGCATGG + Intergenic
1135765935 16:25178066-25178088 CTTGCAGGTCTCCTCCAGGAGGG - Exonic
1135837064 16:25836039-25836061 CAAGCTGGTCTCTTCTGAGTTGG + Intronic
1137546678 16:49409452-49409474 AAAGCTACTCTCCTCTGGGAAGG + Intergenic
1139180974 16:64748057-64748079 AAAGCTGGTCTCCCCAAGGATGG - Intergenic
1142277752 16:89131941-89131963 CAGCCTGGGCTCCTCCAGGAGGG - Intronic
1142277779 16:89132025-89132047 CAGCCTGGGCTCCTCCAGGAGGG - Intronic
1142932441 17:3298510-3298532 AAAGCAGGCCTCATCTAGGAAGG + Intergenic
1143713653 17:8752108-8752130 GAAGCTGGACTCTTCTAGAAGGG - Intergenic
1147148300 17:38498667-38498689 CAAGCTGGACTTCCCTAGGGAGG - Intronic
1148153487 17:45410064-45410086 CAAGCTGACCACCTCTTGGATGG + Intronic
1152602397 17:81271011-81271033 CAGGATGGTCTCCACTAGGATGG + Exonic
1153072429 18:1120731-1120753 AAAGCTGGTCTCCCCAAAGAGGG + Intergenic
1153127170 18:1808504-1808526 CAGGCTTGTCTCCTCTACAAAGG - Intergenic
1157202287 18:45669200-45669222 CAGGCTGCTTTTCTCTAGGAAGG + Intronic
1159894682 18:73985118-73985140 CAAGATGGGATCCTATAGGAAGG - Intergenic
1161453688 19:4360085-4360107 CACGCTGGTCTCCCCAAGGCTGG + Exonic
1162820502 19:13220540-13220562 CAAGCTGGGCTCCTCTCTGGAGG - Intronic
1164756013 19:30690223-30690245 AAATGTGGCCTCCTCTAGGATGG - Intronic
1165337258 19:35179915-35179937 CAAGCTGGAGTCCACAAGGATGG - Intergenic
925107605 2:1306347-1306369 CCATCTGCTCTCCTCTAAGAGGG + Intronic
943000611 2:182323843-182323865 CACGCTGGTCTGCTCTACCAGGG - Intronic
943682582 2:190783783-190783805 AAAGCTGGCTTGCTCTAGGAGGG - Intergenic
944222249 2:197314088-197314110 GAAGCTGGTCCCCTTCAGGAGGG + Intergenic
945821725 2:214673298-214673320 CAATCTGGTCTCCTCTTATATGG + Intergenic
1169016003 20:2293293-2293315 CCACCTGGTCTTCTCTAGGAGGG - Intergenic
1173952803 20:47006521-47006543 CAAGCAGGACCCCTCTAGGTGGG - Intronic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1176234506 20:64048226-64048248 CAGGCTGCTCTCCTCTGGGCAGG + Exonic
1177009108 21:15709871-15709893 AAAGCAGGTCTCTTCTAGGCGGG + Intergenic
1178158987 21:29888798-29888820 CCATCTGGTCTCCACTATGATGG + Intronic
1179366011 21:40759189-40759211 CAACCTGGAATCCTCTTGGATGG - Intronic
1179488488 21:41726043-41726065 CACGCTGGTGTCCTTTAGAAGGG + Intergenic
1179595093 21:42438066-42438088 CAAGCTGCTCTCCTATGGGCAGG - Intronic
1180983761 22:19892075-19892097 CAAGCTGGGCTCCGACAGGAAGG - Intronic
1183861421 22:40673122-40673144 CAGGCTGCTCTCCTCTAGCAAGG - Intergenic
1185367174 22:50442011-50442033 CGGGCTGGATTCCTCTAGGAGGG + Intronic
952257408 3:31707235-31707257 CAAGAGGGTCTACTCTAGCACGG + Intronic
953389831 3:42527684-42527706 CAGCCTAGTCTCCCCTAGGATGG + Intronic
962326961 3:134442405-134442427 CCAGGTGGTCACCTCCAGGAAGG + Intergenic
962507463 3:136062363-136062385 CAAGCAGGTCTTCTCCATGATGG + Intronic
965492827 3:169360945-169360967 CTAGCTGGTTTTCTCTAGCATGG - Intronic
966716181 3:183015169-183015191 CAAGGTAGTCTCTTTTAGGAAGG - Intergenic
967729581 3:192894957-192894979 CGAGCTCGTCTCATCTAAGAGGG + Intronic
968131269 3:196194194-196194216 CAAGCCTGTCTCCTCTGGAATGG + Intergenic
969468503 4:7371899-7371921 CATGCTGGTGGCCTCTAGAAGGG + Intronic
969921213 4:10541385-10541407 CAAGCTGCTTCCCTCTAGCAGGG + Intronic
979707679 4:123739751-123739773 AGAGCTTGTCTCCTCTGGGAAGG + Intergenic
982279456 4:153668464-153668486 GTACCTGGTCTCCTCTAAGAAGG + Intergenic
985013413 4:185607107-185607129 CAGGATGGCGTCCTCTAGGATGG + Intronic
987042274 5:14074228-14074250 GAAGTTGGTTTCCTTTAGGAAGG - Intergenic
994301654 5:98155190-98155212 AAAGCTGGTCCCCTATAAGATGG - Intergenic
995534508 5:113121551-113121573 CAAGAAGGCTTCCTCTAGGAAGG - Intronic
999655841 5:153809839-153809861 CAGGCTGGTGTAGTCTAGGAAGG + Intronic
1000855997 5:166399012-166399034 CATGCTTCTCTCCTTTAGGATGG - Intergenic
1001243164 5:170085611-170085633 CAAGCTAGTCATCTCAAGGAAGG + Intergenic
1002322802 5:178385512-178385534 CTGGCCGGTCTCCTCCAGGAGGG + Intronic
1003495973 6:6663524-6663546 CCAGCTGGTCTCCACCACGATGG - Intergenic
1006782688 6:36642961-36642983 CAAGTCTGTCTGCTCTAGGAGGG + Intergenic
1011017141 6:82769289-82769311 CAGGCTGGTCAGGTCTAGGAGGG + Intergenic
1011827542 6:91328102-91328124 CAATTCTGTCTCCTCTAGGAAGG - Intergenic
1015890548 6:137965865-137965887 CAAGCAGATCAACTCTAGGAAGG - Intergenic
1016355091 6:143209874-143209896 CAAGAACGTCTCTTCTAGGAGGG + Intronic
1017589751 6:155965994-155966016 CACGCAGGTCTCCTGTGGGAGGG + Intergenic
1020769673 7:12373428-12373450 CAAGCTGCTCTCCTTGAGCAGGG + Intronic
1023565605 7:41521330-41521352 CAAGTTGGTGTCCTCTAGCCAGG - Intergenic
1024004084 7:45212560-45212582 CCAGCAGGTCTCCTGTAGGGTGG - Intergenic
1024588270 7:50859519-50859541 CAAGCCTGTCTCCTCTCTGATGG - Intergenic
1026446828 7:70492088-70492110 CAGGCAGGTCTCCACTGGGAGGG - Intronic
1029634381 7:101774171-101774193 CAAGAGGGTCTCCTCTAGGTTGG + Intergenic
1034882491 7:154773175-154773197 AGAGCTGGGCTCCTCTGGGAGGG + Intronic
1035480398 7:159177864-159177886 CAAGTTGCTCTCCTCTAAAAAGG + Intergenic
1036417158 8:8561528-8561550 CAAGCTGGTGAGTTCTAGGAGGG + Intergenic
1042939540 8:74093303-74093325 CATGATGATCTCCTTTAGGAGGG + Intergenic
1043266755 8:78276170-78276192 CAAGTTGGTGTCCTATAGGTGGG - Intergenic
1044130487 8:88517650-88517672 CATTCTGGTCTCATCAAGGAAGG - Intergenic
1047599304 8:126410397-126410419 CTCACTGGTCTCCTCCAGGAAGG - Intergenic
1049273670 8:141709133-141709155 CAAGGTGGTCTCCTCCAGCGGGG - Intergenic
1049918710 9:343673-343695 AATGCTTATCTCCTCTAGGAGGG - Intronic
1057842270 9:98495665-98495687 CGTGCTGGGCTCCTGTAGGAGGG + Intronic
1059391716 9:114003295-114003317 CAAGCTGGTGTAGACTAGGATGG + Intronic
1060632707 9:125174094-125174116 CAAACTGGTCTCAGGTAGGAAGG - Intronic
1061193178 9:129093983-129094005 CACACTTGTCTCCTCTAGGCCGG - Intergenic
1061785256 9:133023973-133023995 CACTCTTGTCTCCTCTATGAGGG + Intergenic
1203775509 EBV:70956-70978 AAAGATGGTCTCTTCTAGCATGG + Intergenic
1190262894 X:48809251-48809273 TAAGCTGGTCCCCTCCTGGAGGG - Intronic
1190291197 X:48993481-48993503 CAAGCTGGGCCCCTCGTGGATGG - Exonic
1196176488 X:112644308-112644330 AAAGCTCCTCTCCTCTAGAAGGG + Intronic
1196903179 X:120406703-120406725 CAAGCTGGCACCCTCAAGGATGG + Intergenic
1199005047 X:142686057-142686079 CTTTCTGATCTCCTCTAGGAAGG + Intergenic