ID: 1124962585

View in Genome Browser
Species Human (GRCh38)
Location 15:34409797-34409819
Sequence GCGTGGGGCTCTCTGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 2, 1: 1, 2: 0, 3: 15, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124962585_1124962594 15 Left 1124962585 15:34409797-34409819 CCTGCGGCCAGAGAGCCCCACGC 0: 2
1: 1
2: 0
3: 15
4: 168
Right 1124962594 15:34409835-34409857 GCCACAACCACAGCCCCGATGGG 0: 3
1: 0
2: 3
3: 7
4: 87
1124962585_1124962593 14 Left 1124962585 15:34409797-34409819 CCTGCGGCCAGAGAGCCCCACGC 0: 2
1: 1
2: 0
3: 15
4: 168
Right 1124962593 15:34409834-34409856 TGCCACAACCACAGCCCCGATGG 0: 3
1: 0
2: 1
3: 10
4: 150
1124962585_1124962596 16 Left 1124962585 15:34409797-34409819 CCTGCGGCCAGAGAGCCCCACGC 0: 2
1: 1
2: 0
3: 15
4: 168
Right 1124962596 15:34409836-34409858 CCACAACCACAGCCCCGATGGGG 0: 3
1: 0
2: 0
3: 6
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124962585 Original CRISPR GCGTGGGGCTCTCTGGCCGC AGG (reversed) Intronic
900121418 1:1050045-1050067 GCGTGGGGCTCTCGGGGCAGGGG + Intronic
900237892 1:1601121-1601143 GTGGGGGGCTCTCTGGCAACTGG + Intergenic
900400458 1:2470903-2470925 GCCTGGGGCTCTCTGAAGGCAGG - Intronic
900891028 1:5449785-5449807 GGGTGGGACTCTCTGGACTCAGG - Intergenic
900900023 1:5509861-5509883 GCCTGGGGCTCCCTGGGCACGGG + Intergenic
901678525 1:10900416-10900438 GGGTGGGGCTCTGGGGCCCCGGG - Intergenic
902179676 1:14678385-14678407 GCGAGGGGCTCTCGGGCCTTTGG + Intronic
903658980 1:24965535-24965557 GCAGGGAGCTCTCCGGCCGCTGG - Intergenic
904799205 1:33081153-33081175 GCGTGGGGGTCTGTGGCTGCTGG + Exonic
907909940 1:58816558-58816580 GCCTGGGGCTCTGGGGCCGCCGG - Intergenic
908930714 1:69313316-69313338 CCATGTGGCTCTCAGGCCGCAGG + Intergenic
913323221 1:117605423-117605445 GCCGGCGGCTCTCTGGCCCCGGG - Intergenic
913477761 1:119255235-119255257 GCTTGGAGCTCTCAGGCCTCAGG + Intergenic
915914536 1:159932926-159932948 GCGTGGGGCTTCCTGCCTGCTGG + Intronic
916694457 1:167221510-167221532 GCGTGCGGGTGTCCGGCCGCCGG - Intronic
921944851 1:220879568-220879590 GCGAGGGGCGCTGGGGCCGCAGG - Exonic
923461748 1:234214637-234214659 GAGGGGGGCTGTCTGGCTGCGGG + Intronic
923946978 1:238899077-238899099 GCCTGGGGCTTTCTGGCCTTTGG - Intergenic
924637476 1:245802338-245802360 GCGTTTGGCTCTCTGGCCCTAGG - Intronic
1071281277 10:84106297-84106319 GCCAGGGGCTCTCTGGCCTTTGG - Intergenic
1073057222 10:100710387-100710409 GCCTGGGGCGCCCTAGCCGCTGG + Intergenic
1073124421 10:101140750-101140772 GGGCAGGGCTCGCTGGCCGCAGG - Intergenic
1073441440 10:103555165-103555187 GCGTGTGGCCGGCTGGCCGCGGG + Intronic
1074618300 10:115092927-115092949 TCGTGGGGCTCCCGGGGCGCGGG + Intergenic
1075495842 10:122917734-122917756 TCGTGGGGATCTCTAGCAGCTGG - Intergenic
1076777865 10:132708033-132708055 GCATGGGGCTCACAGGCGGCAGG + Intronic
1077440904 11:2568591-2568613 GCCTAGGGCTCTCTGGTAGCAGG - Intronic
1079343447 11:19631930-19631952 GCGTGGGTCTCTCTTGCTGATGG - Intronic
1083611752 11:64007721-64007743 GCGTGGGGCTGTCTGGCAAAGGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1083929544 11:65833356-65833378 GCTTGGGGCGCCCTGGCCGCGGG + Intronic
1084182205 11:67452427-67452449 GCATGGGGGACACTGGCCGCTGG - Exonic
1085739970 11:79070094-79070116 GCCTGGGGTTCTCTGTCCACAGG - Intronic
1088577749 11:111287967-111287989 GCGTGGGGCTCTCTGCTCCTGGG + Intergenic
1089315984 11:117591825-117591847 GCTTGGGACTCTCTGTCCCCAGG + Intronic
1096457113 12:51796750-51796772 GCCAGGGGCTCTCTGGCCTTTGG - Intronic
1097003976 12:55901813-55901835 CCGTGGGGCTCTCTGGGGTCTGG - Exonic
1097614980 12:61872833-61872855 GGGTGGGTCTCTCTGGACTCTGG - Intronic
1100652950 12:96610763-96610785 GAGTGAGGCTCTGTGGCCGTGGG - Intronic
1102246922 12:111361955-111361977 GGCAGTGGCTCTCTGGCCGCGGG - Exonic
1103704092 12:122862128-122862150 GCGTGGGGCTCCCTGCCTTCTGG + Exonic
1103905504 12:124325481-124325503 GCGAGGGGCCCGCTGCCCGCGGG + Exonic
1104590699 12:130082256-130082278 ACTTGAGGCTCTGTGGCCGCCGG - Intergenic
1113025750 13:105939021-105939043 GCCTGGGGCTCTCTGGGCACTGG + Intergenic
1113950574 13:114069292-114069314 CCAGGGTGCTCTCTGGCCGCTGG - Intronic
1118766746 14:68915190-68915212 ACGAGGGCCTCTCTGGCCACTGG - Intronic
1119808485 14:77498170-77498192 CAGTGGGGCTCTCCAGCCGCCGG - Intronic
1120055613 14:79920408-79920430 GTGTCGGGCTTTCTGGCCCCTGG + Intergenic
1122143351 14:99675191-99675213 GGGTGGGCCGCGCTGGCCGCGGG - Exonic
1122904328 14:104795127-104795149 CCGTGGGGCTCCCCGGGCGCTGG - Intronic
1123184610 14:106504935-106504957 GCCAGGGGCTCTCTGGCCTTTGG + Intergenic
1124363232 15:29054034-29054056 GCGCGGGGCTCTCTGGCCGCAGG - Exonic
1124962585 15:34409797-34409819 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1124979210 15:34556019-34556041 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1128555729 15:68630463-68630485 GGGTGGGGCTCTGTGGTCTCTGG + Intronic
1130253979 15:82317287-82317309 GCATGGGGCTCTCTGTGAGCCGG - Intergenic
1132544555 16:527376-527398 GCGTGGGGCTCGCGGGGAGCCGG - Intergenic
1132799507 16:1744682-1744704 GCTTGACGCTCTCTGGCCTCCGG + Intronic
1132821276 16:1872382-1872404 GCGTGTGGCTCTGTGGTCGCTGG + Intronic
1132888021 16:2190979-2191001 GCGTGGGCCCCTCTGGCCTCAGG - Intronic
1134325056 16:13199919-13199941 GCGAGGGTATCTCTGGCCACTGG + Intronic
1136279545 16:29199928-29199950 GCGTGGGCCTCAGTGGCCCCTGG - Intergenic
1140888355 16:79263990-79264012 TCTTGGGGCTCTCTTGCCACAGG - Intergenic
1141616680 16:85213856-85213878 GCCTGGGGCCCTCTGTCCTCAGG - Intergenic
1141697881 16:85628624-85628646 GCGTGGGGCTGTCCAGCCACAGG - Intronic
1142083938 16:88166029-88166051 GCGTGGGCCTCAGTGGCCCCTGG - Intergenic
1142671176 17:1488068-1488090 GCGTGGGGGACTCGGGCCGGGGG + Intronic
1143103865 17:4518901-4518923 GTGTTGGGCTCTCAGGCCTCAGG - Intronic
1147165698 17:38592073-38592095 GCCTGGGGCCCTCTGGCAGCAGG - Intronic
1148693514 17:49546046-49546068 GCTCGGGGCTGTCTGGCCACAGG + Intergenic
1148805210 17:50260502-50260524 TCGTGGGGCTCTCTGCAGGCGGG + Intergenic
1149656263 17:58310987-58311009 GCAAGGGGCGCTCTGGCCTCTGG + Exonic
1152563199 17:81088924-81088946 GCGTGGGGGCCTCAGGCCTCTGG - Intronic
1152860948 17:82697066-82697088 GCGGGGGAGTCTCTGGCAGCTGG - Intronic
1153219137 18:2847093-2847115 GCGGGCGGCGCCCTGGCCGCCGG + Exonic
1153515271 18:5895725-5895747 GCACGGGGCGCTCGGGCCGCGGG + Intronic
1154241326 18:12657159-12657181 GCGTGAGGCGCACAGGCCGCTGG + Intronic
1157311929 18:46559422-46559444 GGGTGAGGGTCTCTGGCCCCTGG - Intronic
1157384808 18:47251610-47251632 ACTTGGGGCTCTCCTGCCGCGGG - Intergenic
1160607158 18:80059722-80059744 GCTTGGGGCCCCCTGGCTGCAGG + Intronic
1160789894 19:918495-918517 GCGTGGGCGCCACTGGCCGCGGG - Intronic
1161232092 19:3179487-3179509 GCGTGGGGCCTTCTGCCCGCTGG - Exonic
1163575695 19:18109871-18109893 CCCTGGGGCTCTCTGGGAGCCGG - Intronic
1165027389 19:32971790-32971812 GCGTGGGGCTCTGTGGGGCCGGG - Intronic
1165163373 19:33831981-33832003 GTGTGGTGCTCTCTGCCCCCAGG + Intergenic
1167350441 19:48970798-48970820 TGGGGGGGCTCTCGGGCCGCTGG - Intronic
1167693058 19:50999115-50999137 GCGAGGGGCTCTCTGGATTCTGG + Intronic
926577781 2:14601231-14601253 GCCAGGGGCTCTCTGGCCTTCGG + Intergenic
927485278 2:23484600-23484622 GGGTGTGGCTCTCTGGCTGGCGG - Intronic
928084400 2:28336816-28336838 GCGTGGGGCTCTTTGCCCTATGG + Intronic
928299514 2:30112945-30112967 GCCTGGGGCTCTCAGGCCTTCGG + Intergenic
929555000 2:42920634-42920656 GAGTGGGGAGCTCTGGCCGTTGG + Intergenic
935116592 2:100142551-100142573 GCGTGGAGCTCTCTTCTCGCTGG + Intronic
935301605 2:101697886-101697908 GCTCGGGGCTCTCTGCCGGCCGG - Intronic
937304049 2:120860364-120860386 GGGTGGGGCTCACTGTCCTCAGG + Intronic
937865826 2:126751393-126751415 GAGTGGGGCTGTCTGGCCTCTGG + Intergenic
937985926 2:127638054-127638076 AGGTGCGGCTCTCTGGCTGCTGG + Intergenic
939959786 2:148556312-148556334 GCATGGGACTCTCTGGCTGGTGG + Intergenic
942947294 2:181684175-181684197 CCGTGGGGCTCAGGGGCCGCAGG + Intergenic
943562899 2:189484286-189484308 GTGTGAGGCTATCTGGCCCCTGG - Intergenic
946790488 2:223296248-223296270 GCCTGGGGCTCTCGGGCCTTCGG + Intergenic
947614599 2:231547380-231547402 GCGTGAGCCTCTGTGGCTGCCGG + Intergenic
948456071 2:238105217-238105239 GCCTGGGGATCTCAGGCGGCAGG - Intronic
948922449 2:241072026-241072048 GCGCGGGGCTCGTGGGCCGCCGG + Intronic
1172383660 20:34517009-34517031 GCGTGGTTCTTTCTAGCCGCTGG + Intronic
1172794672 20:37528391-37528413 GCGAGGGGCTCGCTGGCCCAAGG - Intergenic
1175895697 20:62334704-62334726 GCCTGGGGCTCTCTGGATGATGG + Intronic
1176070716 20:63224870-63224892 GCCTGTGGCTCTCTAGGCGCTGG + Intergenic
1177894554 21:26844449-26844471 GCGAGGCGCTCGCTGGCGGCGGG + Exonic
1179543272 21:42098211-42098233 TCGTGGGGCTCTCTGGGATCCGG - Intronic
1179886959 21:44318364-44318386 GCGTGGGGGGCTCTGGAAGCTGG + Intronic
1180957870 22:19749311-19749333 GCTTGGGGGTCTCTGGACACAGG - Intergenic
1181632199 22:24157125-24157147 GGGCGGGCCTCTCTGGCCGCAGG - Intronic
1182023200 22:27098267-27098289 GAATGGGGCTCACTGGCCCCTGG - Intergenic
1182604947 22:31496108-31496130 GCGTGGGCCTCTCTGGCTTTTGG - Intronic
1182715905 22:32356150-32356172 GCCTGGAGCTCCCTGGCCCCTGG - Intronic
1183093918 22:35541127-35541149 GCCTGGGGCTCTCGGGCTGGGGG - Exonic
1183162029 22:36120905-36120927 GCCAGGGGCTCTCAGGCCTCCGG - Intergenic
1183980085 22:41534227-41534249 GCCTGGGGCTCCCTGGGCGCAGG - Intronic
1184362033 22:44024505-44024527 TCGTGGGGCTCTAGGGCCGAGGG - Intronic
1184372298 22:44090236-44090258 GACTGGGGCTCTGTGGCCACAGG + Intronic
1185069193 22:48646999-48647021 GTTTGGGGCTCTCTGGCCCAAGG + Intronic
1185247683 22:49781710-49781732 GCGTGGGGCCCTCAGGGCTCTGG - Intronic
1185414586 22:50702975-50702997 GGGTGGGGCTCGCAGGCAGCTGG + Intergenic
949105401 3:196850-196872 GCCGCTGGCTCTCTGGCCGCGGG - Exonic
953199900 3:40769343-40769365 GGGTGGGGCTCTCAGCCCACTGG - Intergenic
953407633 3:42667298-42667320 CCTTGGGGCTCTCTGGTCTCAGG + Intergenic
958586919 3:96098993-96099015 GCTTGGGGCTCTCGGGCCTTTGG + Intergenic
959546134 3:107598952-107598974 GCCTGGGGCCCTCTGGCCCCAGG + Intronic
961381508 3:126498940-126498962 TCGTGGGCCTCTCTGGCCATGGG - Intronic
961746392 3:129066097-129066119 GCCAGGGGCTCTCGGGCCTCTGG + Intergenic
963349379 3:144134141-144134163 CCTTGGGCCTCTCTGGCTGCAGG - Intergenic
966872310 3:184299085-184299107 GGGCGGGGCTCTCAGGCCGAGGG + Exonic
967807761 3:193730607-193730629 GCATGGGGCTCCCTGGCCCTGGG + Intergenic
968737363 4:2304337-2304359 GCATGCAGCTCTCTGGCCTCTGG + Exonic
972022399 4:34332367-34332389 GCTAGGGGCTCTCAGGCCGTTGG - Intergenic
972116820 4:35646496-35646518 GCCAGGGGCTCTCAGGCCTCTGG - Intergenic
973685581 4:53366164-53366186 GGGTGGGGCTCTGTGGCTCCGGG + Intergenic
976765392 4:88592824-88592846 GCGCGGGGCTCTCTGACCGGAGG - Intronic
981104758 4:140867600-140867622 GTGTTGGGGTCTCTGGCAGCTGG + Exonic
981220359 4:142225280-142225302 GCCAGGGGCTCTCTGGCCTTTGG + Intronic
981920308 4:150078758-150078780 GCGTGGGGCTCCCCGGCAGGCGG + Intronic
983228415 4:165106703-165106725 GCCTGGGGCTCTCAGGCCTTCGG + Intronic
984158246 4:176220114-176220136 GCATGGGGCCCACAGGCCGCAGG + Intronic
984758146 4:183342808-183342830 GCGTGGGGTTCTCCGTCCTCCGG - Intergenic
984877725 4:184384611-184384633 TCGTGAGGCTGTCTGGCCTCTGG - Intergenic
992627209 5:78647354-78647376 GAGTGGAGCTCTCTGGCCAAGGG + Intronic
992690662 5:79237158-79237180 ACCTGGGCCTCTCTGGGCGCCGG - Exonic
1001906683 5:175478845-175478867 GCGTGGTGTTGTCCGGCCGCAGG - Intronic
1002657511 5:180762435-180762457 GAGTGAGGCTCTGTGGCCGTAGG + Intergenic
1005265674 6:24109778-24109800 GCCAGGGGCTCTCTGGCCTTTGG - Intergenic
1006453710 6:34120287-34120309 GCCTGGGGCTCCCTGGCCCAGGG + Intronic
1006637007 6:35468276-35468298 GCGCGGCCTTCTCTGGCCGCTGG - Intergenic
1007634844 6:43293150-43293172 GCGAGGGCCTCTCTGGTCCCTGG + Intergenic
1012736890 6:102959209-102959231 GCCAGGGGCTCTCTGGCCTTAGG + Intergenic
1013383800 6:109603837-109603859 GAGTGAGGCTCTCTGGGCGTGGG + Intronic
1017043685 6:150327667-150327689 TCCTGGGCCTCTCTGGCCGGTGG - Intergenic
1017182385 6:151565368-151565390 GTGAGGGGCTCTCTGGTGGCTGG + Intronic
1019562198 7:1664698-1664720 GTGTGGGGCTCCCCGGCCGGAGG + Intergenic
1019563123 7:1667658-1667680 GCGTGGGGATCTTTGTCCCCAGG + Intergenic
1020007945 7:4792261-4792283 GCGTGAGGCTCTCGGGGCGGCGG - Intronic
1023615811 7:42018063-42018085 GCCTGGGGGGCTCTGGCCGGTGG + Intronic
1023939464 7:44760457-44760479 GCGTGGGGTTCCCTGGCAGTGGG - Exonic
1024556003 7:50604201-50604223 GTGTGGTGCACTCTGGCCACAGG + Intronic
1027678969 7:81195110-81195132 GCCTGGGGCTCTCAGGCCTTCGG + Intronic
1037768763 8:21787212-21787234 GCGTGGGGCTCAGTGGCGCCAGG + Intronic
1039799671 8:40943241-40943263 GCTTGGGTCTCACTGGCCCCAGG - Intergenic
1039984345 8:42435562-42435584 ACTTGGGGCTCTCAGGCCCCAGG + Intronic
1040337825 8:46425079-46425101 GAGTGGTGTTGTCTGGCCGCAGG + Intergenic
1041381753 8:57259525-57259547 GCGCGTGGCTGCCTGGCCGCGGG - Intergenic
1043525078 8:81087738-81087760 GCATGTGGCTCTGTGGCTGCAGG + Intronic
1044820928 8:96155166-96155188 GCGGGAGGCTCTCGGGCCTCTGG - Intronic
1048539831 8:135332756-135332778 GGGTGGGACTCTCTGGCTGAGGG + Intergenic
1049788670 8:144463067-144463089 GCGTGGGCCTCCCTGCCCCCAGG - Intronic
1050436032 9:5611835-5611857 GCGTGGGGCTCTATGGAACCCGG - Intergenic
1051710889 9:19929258-19929280 CCGTGCAGCTCTCTGGCAGCCGG + Intergenic
1056591685 9:87969919-87969941 GCTTGGGGCTCTGTGTCCACAGG - Exonic
1057470057 9:95349404-95349426 GCGTGGGCCTCCCTGGAGGCGGG + Intergenic
1061002860 9:127912226-127912248 GCTGGGGTCTCTCTGGCAGCTGG - Intronic
1061037108 9:128120101-128120123 GAGTTGGGCTCACTGGCCTCTGG + Intergenic
1061489801 9:130938690-130938712 GCGGGGCGCGCTCTGTCCGCCGG + Exonic
1062310017 9:135930429-135930451 GGGTGGGGCTCACTGTCAGCTGG - Intergenic
1186267797 X:7850649-7850671 GCCAGGGGCTCTCTGGCCTTTGG + Intergenic
1192337705 X:70235865-70235887 GAGTGGGACTCTCTGGCTGCAGG - Intronic
1193473916 X:81940593-81940615 GAGTGAGGCTCTGTGGGCGCAGG - Intergenic
1196782919 X:119399343-119399365 GCCTGGGGCTCTCCGGCCACGGG - Exonic