ID: 1124966672

View in Genome Browser
Species Human (GRCh38)
Location 15:34437246-34437268
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 162}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124966662_1124966672 1 Left 1124966662 15:34437222-34437244 CCCTAGATCCCAGCGGCGGCCTC 0: 2
1: 0
2: 1
3: 7
4: 68
Right 1124966672 15:34437246-34437268 CCGCAGCCCCGCCGAGTCCGGGG 0: 2
1: 0
2: 1
3: 14
4: 162
1124966664_1124966672 -7 Left 1124966664 15:34437230-34437252 CCCAGCGGCGGCCTCCCCGCAGC 0: 2
1: 2
2: 0
3: 23
4: 232
Right 1124966672 15:34437246-34437268 CCGCAGCCCCGCCGAGTCCGGGG 0: 2
1: 0
2: 1
3: 14
4: 162
1124966658_1124966672 12 Left 1124966658 15:34437211-34437233 CCGGGCTGCACCCCTAGATCCCA 0: 2
1: 0
2: 0
3: 13
4: 196
Right 1124966672 15:34437246-34437268 CCGCAGCCCCGCCGAGTCCGGGG 0: 2
1: 0
2: 1
3: 14
4: 162
1124966665_1124966672 -8 Left 1124966665 15:34437231-34437253 CCAGCGGCGGCCTCCCCGCAGCC 0: 2
1: 1
2: 6
3: 56
4: 463
Right 1124966672 15:34437246-34437268 CCGCAGCCCCGCCGAGTCCGGGG 0: 2
1: 0
2: 1
3: 14
4: 162
1124966661_1124966672 2 Left 1124966661 15:34437221-34437243 CCCCTAGATCCCAGCGGCGGCCT 0: 2
1: 0
2: 0
3: 5
4: 98
Right 1124966672 15:34437246-34437268 CCGCAGCCCCGCCGAGTCCGGGG 0: 2
1: 0
2: 1
3: 14
4: 162
1124966657_1124966672 15 Left 1124966657 15:34437208-34437230 CCGCCGGGCTGCACCCCTAGATC 0: 1
1: 0
2: 0
3: 10
4: 77
Right 1124966672 15:34437246-34437268 CCGCAGCCCCGCCGAGTCCGGGG 0: 2
1: 0
2: 1
3: 14
4: 162
1124966663_1124966672 0 Left 1124966663 15:34437223-34437245 CCTAGATCCCAGCGGCGGCCTCC 0: 2
1: 0
2: 3
3: 9
4: 169
Right 1124966672 15:34437246-34437268 CCGCAGCCCCGCCGAGTCCGGGG 0: 2
1: 0
2: 1
3: 14
4: 162
1124966655_1124966672 30 Left 1124966655 15:34437193-34437215 CCGAGAGGCGTAAGGCCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1124966672 15:34437246-34437268 CCGCAGCCCCGCCGAGTCCGGGG 0: 2
1: 0
2: 1
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900186954 1:1337146-1337168 CTTCAGCCCCGCCCAGCCCGCGG - Intronic
900364806 1:2306781-2306803 CCGCAGCGCCGCCGACAACGCGG + Exonic
900401945 1:2476267-2476289 CCTCAGCCCCGCCCAGCCCCAGG - Intronic
900513373 1:3070439-3070461 CCGCAGCCCCGCCGAAGCCCCGG + Intronic
901827477 1:11871730-11871752 CCTCAGCCCCGCAAAGTCCTGGG + Intergenic
901893714 1:12290605-12290627 CCTCAGCCCCGCCGAGTAGCTGG - Intronic
902400604 1:16155022-16155044 CCGGAGCCGCGCCGAGTGAGGGG - Intronic
903069867 1:20721815-20721837 CCTCAGCCATGCCAAGTCCGAGG - Exonic
903330652 1:22595385-22595407 CCCCAGCCCCACCGAGCCGGTGG + Intronic
903652461 1:24930217-24930239 CCGCGGCCGCCCCGACTCCGCGG + Intronic
905554411 1:38870987-38871009 CCTCAGCCCCGCAGAGTGCTGGG - Intronic
906263161 1:44407919-44407941 CCGCAGCCGCGCGGGGCCCGCGG - Intronic
908132096 1:61083487-61083509 CCGCAGCCTGCCCGCGTCCGAGG - Intronic
910030091 1:82709265-82709287 CCTCAGCCCCGCAGAGTGCTGGG + Intergenic
910843920 1:91587326-91587348 CTTCAGCCCCTCCGAGTCCTGGG + Intergenic
912305244 1:108560277-108560299 CCGCAGGCCGGCCGCGGCCGGGG - Exonic
912915739 1:113812517-113812539 CCGCGCCCCCGCCGCGTCCCCGG + Intergenic
917817649 1:178725992-178726014 ACGCAGCCCCTCCGGGGCCGGGG - Intronic
917869510 1:179229327-179229349 CCTCAGCCCCGCGGGATCCGGGG - Exonic
918015957 1:180632460-180632482 CCGCAGCCCCGCTGCCGCCGGGG + Intronic
919463249 1:197902953-197902975 GCGCAGGCGCGCCGAGCCCGGGG - Intronic
923020945 1:230163315-230163337 CCTCAGCCCCACGGAGTCCATGG - Intronic
1066746094 10:38604908-38604930 CAGCAGCGCAGCCGAGTCCCAGG + Intergenic
1073460115 10:103661306-103661328 CCGCTGCACCGCGGGGTCCGGGG + Intronic
1073623592 10:105073739-105073761 CCACACCCCCACCCAGTCCGAGG - Intronic
1077028086 11:450584-450606 CCGCCGCAGCACCGAGTCCGAGG + Exonic
1077065045 11:637321-637343 CAGCAGCCCGTCCGCGTCCGCGG - Exonic
1082065359 11:47894178-47894200 CCTCAGCCCCGCAAAGTCCTGGG + Intergenic
1083997088 11:66278062-66278084 CCCCAGCCCCGACAAGCCCGCGG - Intergenic
1084516029 11:69638387-69638409 GCGCAGCCGCGCTGAGTCCCGGG + Intergenic
1084968155 11:72755151-72755173 CCGCCGCCCCGCCGGGTCAGGGG + Intronic
1085205820 11:74731336-74731358 CCGCCGCCCCGCCGGGCCCCAGG - Intronic
1085463385 11:76708561-76708583 CAGCAGCCCCCCCGAGGCAGGGG - Intergenic
1087118125 11:94545032-94545054 TCGCAGCCCCGGGGAGTGCGAGG - Exonic
1089592201 11:119549722-119549744 CCTCAGCCCCGCCGAGTAGCTGG + Intergenic
1090194066 11:124800143-124800165 CCGCAGCGCCGCCTCGTCCTCGG - Exonic
1091730385 12:2876655-2876677 CCCCAGCCCTCCCGAGGCCGCGG + Intronic
1092367784 12:7891421-7891443 CCTCAGCCCCGCCGAGTAGCTGG + Intergenic
1093972297 12:25386183-25386205 CCGCCGCCCTGCCGAGCCCGGGG + Intergenic
1103562678 12:121800514-121800536 TCGAAGCCCCGCCGACCCCGTGG + Intronic
1103764720 12:123271857-123271879 CGGCCGCCCCGCCGGCTCCGCGG - Exonic
1107078157 13:36346138-36346160 CAGCCTCCCAGCCGAGTCCGCGG + Intronic
1107359449 13:39603098-39603120 CCCCACTCCCGGCGAGTCCGCGG + Exonic
1111950747 13:94707394-94707416 CCGCGGCCCAGCGGAGGCCGAGG - Intergenic
1112325795 13:98442129-98442151 CAGCAGCCCCGCAGAGGGCGCGG - Intronic
1119259351 14:73228307-73228329 CCCCAGCCCCTCCCAGCCCGGGG - Intergenic
1202849771 14_GL000225v1_random:9289-9311 CCGCATCCCAGGGGAGTCCGTGG + Intergenic
1124068142 15:26365269-26365291 CCGCAACCCCGCAGTGTCAGTGG + Intergenic
1124966672 15:34437246-34437268 CCGCAGCCCCGCCGAGTCCGGGG + Intronic
1124983291 15:34583364-34583386 CCGCAGCCCCGCCGAGTCCGGGG + Intronic
1125542676 15:40479336-40479358 CAGCAGCCCAGCCAAGTCTGGGG - Intergenic
1125647449 15:41284222-41284244 CCCCCGCCCAGCCGAGGCCGAGG - Intergenic
1127922581 15:63504854-63504876 CCGCAGCGCACCCGAGGCCGCGG + Intronic
1128497247 15:68205592-68205614 TGGCATCCCCGCCGAGTCCCAGG - Intronic
1129245894 15:74278474-74278496 CCGCAGCCCCGCCCTGTGCTGGG + Intronic
1132751232 16:1458600-1458622 CCGCAGCCCCGTCCCGTCTGAGG - Intronic
1132779312 16:1614217-1614239 CCGCGGCCCCGCCGGGTAGGTGG + Intronic
1137426428 16:48384949-48384971 CCGCCACCCCGCCGGGCCCGGGG + Intronic
1138342514 16:56299491-56299513 CCCCAGCCCCACCCAGCCCGAGG + Intronic
1139530027 16:67538216-67538238 CCGAGGCCACGCTGAGTCCGAGG + Intronic
1142240048 16:88940920-88940942 CCGCAGCCGCGCCGAGCGCACGG - Intronic
1142286279 16:89172754-89172776 CCCCAGCCCAGCCCAGTCCCTGG - Intronic
1143140445 17:4739349-4739371 CTCCATCCCCGCAGAGTCCGCGG - Exonic
1143545641 17:7593528-7593550 CCGCTGCCCCGCCCACTCCCAGG + Exonic
1143848653 17:9792874-9792896 CCTCAGCCGCGCCGAGTACCTGG + Intronic
1144687725 17:17237156-17237178 CCGCAGCCCCGCCGACACCCAGG + Exonic
1145935336 17:28711718-28711740 CCTCAGCCCGGCCGAGCCCTCGG + Exonic
1148183059 17:45620548-45620570 CCCCAGCCCCGCCGCTTCCAGGG - Intergenic
1148265794 17:46225143-46225165 CCCCAGCCCCGCCGCTTCCAGGG + Intronic
1148332032 17:46818920-46818942 CCGAAGCCCCGCGGCGTCCGGGG - Intronic
1150643590 17:66965065-66965087 CCCCCGCCCCGCCGCGCCCGCGG + Exonic
1151155563 17:72121454-72121476 CCCCAGCCCCACCATGTCCGAGG + Exonic
1151580151 17:74972853-74972875 CCGAAGACCCGCGGAGTCGGCGG + Intronic
1152321325 17:79610138-79610160 CCGCAGCACCGCGGTGTGCGCGG - Intergenic
1152642721 17:81455894-81455916 CACCAGCCCCGCCGAGGCCACGG - Intronic
1152649996 17:81488327-81488349 CCCCGGCCCCGCCGCGCCCGAGG + Intergenic
1152714422 17:81891646-81891668 CAGCAGCCGCTCCGAGGCCGTGG - Intronic
1152781427 17:82228862-82228884 CCGCAACCCCGCCGGGCCCAGGG - Intronic
1152925930 17:83087764-83087786 CGCCAGCCCCGCCGAGCCTGAGG + Intronic
1153382473 18:4454882-4454904 CCGCAGCCCCTCCGCGGGCGAGG + Intronic
1159179337 18:64881259-64881281 CCGCAGCCCCTCAGAGTACTGGG - Intergenic
1160844480 19:1160361-1160383 CCGCAGACCCCCCGAGGCCTGGG - Intronic
1160933514 19:1582150-1582172 CCCCAGCCCCGCCAAGTGCTGGG + Intronic
1161778875 19:6278821-6278843 AGACAGCCCCGCCGGGTCCGAGG + Intronic
1162019565 19:7862545-7862567 CCGCGGCCCCGCCCTGCCCGTGG + Intronic
1162063626 19:8111486-8111508 CCGCAGCACCGCCTGGGCCGAGG + Intronic
1162081122 19:8218499-8218521 CCGCAGCCACCCTGACTCCGAGG - Intronic
1162865179 19:13540559-13540581 CCTCAGCCCCGCCGAGTAGCTGG + Intronic
1163606833 19:18280349-18280371 CCGCACCCTCTCCAAGTCCGGGG + Exonic
1165838507 19:38773377-38773399 CCACAGCCCAGGCCAGTCCGTGG + Intronic
1165841052 19:38789320-38789342 CCACAGCCCAGGCCAGTCCGTGG - Intronic
1166363955 19:42269360-42269382 CCGAAACCCCGCCGAGCCCAAGG + Intronic
1167291231 19:48626166-48626188 CCGCAGCCCCTCAGACTCAGCGG + Exonic
1167696705 19:51019402-51019424 CTGCAGCCACGCCGCGCCCGAGG + Intronic
1167852521 19:52212950-52212972 CAGCAGCCGCACCGAGTCCTAGG - Exonic
925186749 2:1852167-1852189 CCGCAGCCCTGGCCAGTCTGTGG - Intronic
926026572 2:9550392-9550414 CAGCAGCCCTGCCTAGTCCTAGG + Intronic
929452660 2:42047753-42047775 CCGCGGTCCCGCCCAGCCCGCGG - Intergenic
930096643 2:47570904-47570926 TCGGAGCCGAGCCGAGTCCGGGG + Exonic
933908055 2:86914269-86914291 CCGCCGCCCGGCCGAGGCCAAGG - Intronic
934011589 2:87825485-87825507 CCGCCGCCCGGCCGAGGCCGAGG + Intronic
934011600 2:87825514-87825536 CCGCCGCCCGGCCGAGGCCGAGG + Intronic
937093939 2:119223903-119223925 ACGCAGCCCCGCGGAGACCGGGG - Intronic
942299606 2:174548820-174548842 CCGCAGCCGCTCCGAGTGCCGGG + Intergenic
944221680 2:197310286-197310308 CCCCAGCCCCGCCGGGCCCGCGG + Intronic
944715863 2:202376037-202376059 CCGCAGCCCCACCCAGCCCTCGG + Intergenic
947208253 2:227682230-227682252 CCCCACCCCCACCCAGTCCGTGG - Intergenic
948436255 2:237956199-237956221 CCGCAGCGCCGCTGAGTCCAAGG + Intergenic
1169422932 20:5474250-5474272 CCGCAGCACAGCAGAGTCCCAGG - Intergenic
1169426495 20:5501225-5501247 CCGCAGCACAGCAGAGTCCCAGG + Intergenic
1169437994 20:5610752-5610774 CCCCAGGCCCGCCGCGTCCCGGG + Intronic
1172175380 20:32969167-32969189 CCTCAGCCCAGCCGGGCCCGAGG - Intergenic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1178156289 21:29858013-29858035 CCTCAGCCCCGCCGAGTAGCTGG + Intronic
1178673809 21:34614604-34614626 CCCCAGCCCTGACGGGTCCGCGG + Intronic
1178992246 21:37366296-37366318 CCGCAGCCCCGCCCGCGCCGGGG - Intronic
1180093036 21:45542367-45542389 CAGCCGCCCCGCCGAGTCGCAGG - Exonic
1182123482 22:27800983-27801005 CCGCAGCCTCCCGGAGTCCGTGG + Exonic
1183520621 22:38294375-38294397 CCGCAGTGCCGCCGAGCCCGTGG - Exonic
1183661180 22:39222366-39222388 CAGCAGCGCAGCAGAGTCCGTGG - Intergenic
1183785298 22:40025839-40025861 CCTCAGACCAGCCGACTCCGTGG + Intronic
1183860368 22:40665535-40665557 CCACAGCCCTGCCTAGTCGGTGG - Intergenic
1184508060 22:44916330-44916352 CCCCAGCACCGCCGTGTCTGTGG - Exonic
1185055232 22:48575775-48575797 GCGCGGCCCGGCCGAGCCCGCGG - Intronic
950487839 3:13283188-13283210 CTGCCGCCCCGGCGCGTCCGCGG - Intergenic
950940424 3:16885213-16885235 CTGCAGCCTCGGCGTGTCCGGGG + Intronic
952886021 3:38011337-38011359 CCGCACCTTCGCCGAGGCCGCGG - Exonic
954717532 3:52533920-52533942 GCCCCGCCCCGCCGGGTCCGGGG - Intronic
956877553 3:73478632-73478654 CTTCTGCCCCGCCCAGTCCGTGG + Intronic
964118969 3:153162643-153162665 GCGCAGCCCCGACGGGGCCGCGG + Exonic
965629971 3:170722946-170722968 CCTCAGCCCCGCCGAGTAGCTGG - Intronic
967518962 3:190405307-190405329 CCTCAGCCCCGCCGAGTAGCTGG - Intronic
968085985 3:195874082-195874104 CCGCAGCCCAGCCGGTGCCGGGG - Intronic
969330337 4:6470982-6471004 CCGGAGCCCCGCGGAGGCCCGGG - Intronic
969379099 4:6782774-6782796 CCGCAGCCCCTCGGAGCCAGAGG + Exonic
970132862 4:12890390-12890412 CCTCAGCCCCGCCGAGTAGCTGG - Intergenic
975710578 4:77157241-77157263 CCGCACCCCCGCCGCCTCAGCGG - Exonic
983904752 4:173170236-173170258 CTGCAGCCCCGCCGCCTCGGCGG - Intronic
983940193 4:173529326-173529348 GCGCAGCCCCGCCGCGCCCTCGG + Exonic
989379270 5:40797897-40797919 CCGCAGCCCCGCGGCGGCTGGGG + Intronic
997304932 5:132830135-132830157 CCGCAGCCCCGCGCAGTTCTGGG + Intronic
1002601221 5:180354805-180354827 GCGCAGCCCTGCCCAGTCCCAGG - Intergenic
1006535612 6:34696650-34696672 CCGCCGCGCCGCCGGGCCCGGGG + Exonic
1007373725 6:41442936-41442958 CCACAGCCCCGGCGAGTTCCTGG - Intergenic
1008932458 6:56954896-56954918 GCGCAGCCCCGCCGGGGACGCGG + Intergenic
1010428187 6:75749207-75749229 CCGGCGCCCCGCCGAGTCCCCGG - Intronic
1013330389 6:109094838-109094860 CCGCCGCCCCGCCAGCTCCGCGG - Intergenic
1013391499 6:109690511-109690533 CGACAGCCCCGCGGAGTCCCTGG - Intronic
1014246852 6:119078646-119078668 CCGCAGCCTCGCCGAGTCCTCGG - Exonic
1014724841 6:124962211-124962233 CCGCAGCCCCAGCGAGCCCCAGG - Intergenic
1018020986 6:159762155-159762177 CGGGAGCCGCGCAGAGTCCGAGG + Intronic
1019504526 7:1384171-1384193 CCCAAGCCCAGCCAAGTCCGTGG + Intergenic
1019547944 7:1587396-1587418 CCACAGCCCCTCCGCGGCCGGGG - Intergenic
1020046706 7:5046058-5046080 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1024579918 7:50793241-50793263 CCGCAGCCACGCGGAGGCGGCGG - Intronic
1027116569 7:75486080-75486102 CCCCAGCGCCGCCGGCTCCGGGG + Exonic
1027121895 7:75527901-75527923 CCCCAGCGCCGCCGACTCCGGGG + Intergenic
1027275232 7:76549530-76549552 CCCCAGCGCCGCCGGCTCCGGGG - Intergenic
1029262875 7:99315276-99315298 CCTCAGCCCCGCCGAGTAGCTGG + Intergenic
1029720941 7:102364080-102364102 CCCCAGCGCCGCCGGCTCCGGGG - Exonic
1032074572 7:128830342-128830364 CCGCCCCCCCGCCGCGCCCGCGG - Intergenic
1034427854 7:151024001-151024023 CCGCAGCCCAGGAGAGTCCTGGG + Exonic
1035286497 7:157810430-157810452 CAGCAGCCCCGCCGTCCCCGTGG - Intronic
1035410017 7:158632235-158632257 CCCCAGCCCCACCTAGGCCGCGG + Intronic
1039184223 8:34898991-34899013 CCGCAGCCTCCCAAAGTCCGGGG + Intergenic
1039608402 8:38901137-38901159 CCGCACCCCCTCCCAGCCCGCGG + Intergenic
1040915845 8:52565587-52565609 CCTGAGACCCGCTGAGTCCGAGG - Intergenic
1040928963 8:52714378-52714400 CCGCGGCCCTGCCGAGCCCTCGG - Exonic
1042556072 8:70034761-70034783 CCGCACCCCGGCAGAGGCCGAGG - Intergenic
1049411636 8:142476257-142476279 CCGCAGCCCAGCCGATGCCCCGG - Intronic
1049759727 8:144326561-144326583 CCGCAGGCCCGCCGCCGCCGTGG + Exonic
1049803649 8:144529297-144529319 CCCCAGCCCTGCCGAGGCCTGGG - Exonic
1052781212 9:32783386-32783408 CAGCAGCCCCGACGAGACCCCGG + Intergenic
1052938475 9:34113164-34113186 CCTCAGCCTCGCCGAGTACCTGG + Intronic
1060196082 9:121624206-121624228 GGGCAGCCCCGCTGGGTCCGTGG - Intronic
1062490765 9:136803845-136803867 CCCCAGCCCAGCCGCCTCCGTGG - Intronic
1062542739 9:137048777-137048799 GCGCAGCCCCGGCGGGTCGGCGG + Exonic
1062718723 9:138023801-138023823 CACCAGCCCCGGTGAGTCCGCGG + Exonic
1190385349 X:49878902-49878924 CCCCAGCCCCGCAGTGGCCGAGG + Intergenic