ID: 1124969203

View in Genome Browser
Species Human (GRCh38)
Location 15:34468306-34468328
Sequence CTCCCAAAGTGGCAATTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124969203_1124969210 26 Left 1124969203 15:34468306-34468328 CCAGCCAATTGCCACTTTGGGAG No data
Right 1124969210 15:34468355-34468377 GTATTTCTATCTGCCCGTTTGGG No data
1124969203_1124969209 25 Left 1124969203 15:34468306-34468328 CCAGCCAATTGCCACTTTGGGAG No data
Right 1124969209 15:34468354-34468376 AGTATTTCTATCTGCCCGTTTGG No data
1124969203_1124969206 -10 Left 1124969203 15:34468306-34468328 CCAGCCAATTGCCACTTTGGGAG No data
Right 1124969206 15:34468319-34468341 ACTTTGGGAGTATCAAGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124969203 Original CRISPR CTCCCAAAGTGGCAATTGGC TGG (reversed) Intergenic
No off target data available for this crispr