ID: 1124971610

View in Genome Browser
Species Human (GRCh38)
Location 15:34495022-34495044
Sequence CCTGGTGGCGCGCCCCGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124971601_1124971610 11 Left 1124971601 15:34494988-34495010 CCGCGGACCACCGCTTCCTGCGC 0: 1
1: 1
2: 0
3: 10
4: 102
Right 1124971610 15:34495022-34495044 CCTGGTGGCGCGCCCCGAGCCGG No data
1124971602_1124971610 4 Left 1124971602 15:34494995-34495017 CCACCGCTTCCTGCGCCATGACA 0: 1
1: 0
2: 1
3: 12
4: 119
Right 1124971610 15:34495022-34495044 CCTGGTGGCGCGCCCCGAGCCGG No data
1124971605_1124971610 -5 Left 1124971605 15:34495004-34495026 CCTGCGCCATGACAGGCGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 244
Right 1124971610 15:34495022-34495044 CCTGGTGGCGCGCCCCGAGCCGG No data
1124971604_1124971610 1 Left 1124971604 15:34494998-34495020 CCGCTTCCTGCGCCATGACAGGC 0: 1
1: 0
2: 4
3: 19
4: 268
Right 1124971610 15:34495022-34495044 CCTGGTGGCGCGCCCCGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124971610 Original CRISPR CCTGGTGGCGCGCCCCGAGC CGG Intergenic
No off target data available for this crispr