ID: 1124971803

View in Genome Browser
Species Human (GRCh38)
Location 15:34495973-34495995
Sequence CCCGCCCGGGGGAGCCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124971803_1124971810 5 Left 1124971803 15:34495973-34495995 CCAGGTGGGCTCCCCCGGGCGGG No data
Right 1124971810 15:34496001-34496023 AGCCCCCTTGCCTTTCAAACTGG No data
1124971803_1124971816 23 Left 1124971803 15:34495973-34495995 CCAGGTGGGCTCCCCCGGGCGGG No data
Right 1124971816 15:34496019-34496041 ACTGGAAACCCCAGAGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124971803 Original CRISPR CCCGCCCGGGGGAGCCCACC TGG (reversed) Intergenic