ID: 1124973986

View in Genome Browser
Species Human (GRCh38)
Location 15:34516551-34516573
Sequence CTGGGAAAAGAGATCGTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124973983_1124973986 -8 Left 1124973983 15:34516536-34516558 CCCTGATTCCTGAGACTGGGAAA No data
Right 1124973986 15:34516551-34516573 CTGGGAAAAGAGATCGTGCCCGG No data
1124973982_1124973986 -7 Left 1124973982 15:34516535-34516557 CCCCTGATTCCTGAGACTGGGAA No data
Right 1124973986 15:34516551-34516573 CTGGGAAAAGAGATCGTGCCCGG No data
1124973984_1124973986 -9 Left 1124973984 15:34516537-34516559 CCTGATTCCTGAGACTGGGAAAA No data
Right 1124973986 15:34516551-34516573 CTGGGAAAAGAGATCGTGCCCGG No data
1124973979_1124973986 13 Left 1124973979 15:34516515-34516537 CCTGTGTTTACAGATGGAGTCCC No data
Right 1124973986 15:34516551-34516573 CTGGGAAAAGAGATCGTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124973986 Original CRISPR CTGGGAAAAGAGATCGTGCC CGG Intergenic
No off target data available for this crispr