ID: 1124975578

View in Genome Browser
Species Human (GRCh38)
Location 15:34527082-34527104
Sequence TGACACTTAGAGCTGTTTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 25, 3: 17, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124975578_1124975580 25 Left 1124975578 15:34527082-34527104 CCTTTAAACAGCTCTAAGTGTCA 0: 1
1: 1
2: 25
3: 17
4: 142
Right 1124975580 15:34527130-34527152 TAATAAACAGTGCACACTTGAGG 0: 13
1: 4
2: 10
3: 7
4: 159
1124975578_1124975581 26 Left 1124975578 15:34527082-34527104 CCTTTAAACAGCTCTAAGTGTCA 0: 1
1: 1
2: 25
3: 17
4: 142
Right 1124975581 15:34527131-34527153 AATAAACAGTGCACACTTGAGGG 0: 3
1: 11
2: 9
3: 21
4: 183
1124975578_1124975579 -10 Left 1124975578 15:34527082-34527104 CCTTTAAACAGCTCTAAGTGTCA 0: 1
1: 1
2: 25
3: 17
4: 142
Right 1124975579 15:34527095-34527117 CTAAGTGTCAGTACTCATAGTGG 0: 1
1: 14
2: 8
3: 22
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124975578 Original CRISPR TGACACTTAGAGCTGTTTAA AGG (reversed) Exonic
905257203 1:36692476-36692498 TGAGACTTAGAGCTCCTTGAGGG - Intergenic
907063392 1:51454176-51454198 TGGCACTTAGAGATGTATAGAGG - Intronic
908490522 1:64639060-64639082 TGTCATTTAGAGCTGTTTCTAGG - Intronic
908552237 1:65221021-65221043 TTATACTTTGAACTGTTTAAGGG - Intronic
909761258 1:79290152-79290174 TGAAACTTAGAGTTTTTAAAGGG + Intergenic
911447486 1:98016086-98016108 TTTCTCTTAGAACTGTTTAAAGG + Intergenic
912406429 1:109442286-109442308 TGACACTGTGAGCTTCTTAAAGG + Intergenic
913045432 1:115070004-115070026 TGACATCTAGAGCTGTGAAATGG + Intronic
915039894 1:152959915-152959937 TGACACTTAGAGGTCCTTACAGG + Intergenic
916344053 1:163768411-163768433 TGAGCCTCAGAGCTGTTTAGTGG - Intergenic
919097553 1:193056299-193056321 TGAAACTAAGAGCTGTTTTTTGG - Intronic
919857064 1:201713187-201713209 TCACACATTGAGCTGTGTAATGG - Intronic
920288456 1:204898994-204899016 TCACACTTGGAGCTGTCTGAAGG - Intronic
921244919 1:213228039-213228061 TGAGACTTCGAGCTCTTTATGGG - Intronic
1065774045 10:29102875-29102897 GGACAAGGAGAGCTGTTTAAGGG + Intergenic
1065917212 10:30363888-30363910 TGACATTTAGAGTTGTTTAAAGG - Intronic
1066520976 10:36218568-36218590 TAACACTTTGAACTTTTTAATGG + Intergenic
1070207171 10:74275364-74275386 TGGCACTTAGACATGCTTAAAGG - Intronic
1070232558 10:74585096-74585118 TTACATTAAGAGCTATTTAAAGG - Intronic
1079560792 11:21816589-21816611 AGACACTGAGACCTGTTTGAAGG - Intergenic
1079995660 11:27292737-27292759 TCATACTTAGAGCCGTTCAAAGG + Intergenic
1090425874 11:126606764-126606786 TGGCACTTAGGGATGTTTTAAGG - Intronic
1091969036 12:4770862-4770884 TGACATTTGGACATGTTTAAAGG + Intronic
1098522307 12:71446991-71447013 TGACACATAGATCTGGTTATAGG - Intronic
1099783794 12:87235118-87235140 TGAGAATTTGAGCTCTTTAAGGG + Intergenic
1108041279 13:46341319-46341341 TGGCATATATAGCTGTTTAATGG - Intergenic
1109017396 13:57035601-57035623 TGACACTTAAAGATATATAATGG + Intergenic
1110503433 13:76256319-76256341 TGACATTTAGAAAGGTTTAATGG - Intergenic
1112109130 13:96275160-96275182 TGACCCTGAAGGCTGTTTAATGG - Intronic
1112435943 13:99391290-99391312 TAACACTAAGGCCTGTTTAAAGG + Intergenic
1114975339 14:28089683-28089705 TGAGACTTAGATCTGAGTAATGG + Intergenic
1115082681 14:29476229-29476251 TACCACTTAGAGCTTTTGAAGGG - Intergenic
1118522741 14:66604866-66604888 AGACATTTAGAGTTGTCTAAAGG - Intronic
1118848591 14:69567458-69567480 TGAAATTTAAAGCTGATTAAGGG + Intergenic
1122926418 14:104905091-104905113 TGACAATTCTAGCTGTTTCAAGG - Intergenic
1123473826 15:20573266-20573288 TGACATTTAGAGTTGTTTAAAGG + Intergenic
1123644182 15:22427087-22427109 TGACATTTAGAGTTGTTTAAAGG - Intergenic
1123665490 15:22606991-22607013 TGACATTTAGAGTTGTTTAAAGG - Intergenic
1123734126 15:23168277-23168299 TGACATTTAGAGTTGTTTAAAGG + Intergenic
1123752268 15:23365661-23365683 TGACATTTAGAGTTGTTTAAAGG + Intronic
1124284629 15:28389588-28389610 TGACATTTAGAGTTGTTTAAAGG + Intronic
1124298068 15:28522026-28522048 TGACATTTAGAGTTGTTTAAAGG - Intronic
1124319321 15:28701405-28701427 TGACATTTAGAGTTGTTTAAAGG - Intergenic
1124483199 15:30094026-30094048 TGACATTTAGAGTTGTTTAAAGG + Intergenic
1124489649 15:30146093-30146115 TGACATTTAGAGTTGTTTAAAGG + Intergenic
1124520380 15:30403192-30403214 TGACATTTAGAGTTGTTTAAAGG - Intergenic
1124538277 15:30563027-30563049 TGACATTTAGAGTTGTTTAAAGG + Intergenic
1124544740 15:30615088-30615110 TGACATTTAGAGTTGTTTAAAGG + Intergenic
1124753880 15:32392234-32392256 TGACATTTAGAGTTGTTTAAAGG - Intergenic
1124760376 15:32444558-32444580 TGACATTTAGAGTTGTTTAAAGG - Intergenic
1124778258 15:32604504-32604526 TGACATTTAGAGTTGTTTAAAGG + Exonic
1124794242 15:32761494-32761516 TGACACTTAGAGCTGAAGACTGG - Intergenic
1124958951 15:34380861-34380883 TGACATTTAGAGCTGTTTAAAGG - Intronic
1124975578 15:34527082-34527104 TGACACTTAGAGCTGTTTAAAGG - Exonic
1126350020 15:47735461-47735483 TAAAAGTTATAGCTGTTTAATGG + Intronic
1129038800 15:72666938-72666960 TGACATTTAGAGTTGTTTAAAGG + Intergenic
1129211089 15:74070292-74070314 TGACATTTAGAGTTGTTTAAAGG - Exonic
1129399317 15:75270792-75270814 TGACATTTAGAGTTGTTTAAAGG + Intronic
1129402921 15:75295071-75295093 TGACATTTAGAGTTGTTTAAAGG + Intronic
1129476456 15:75787485-75787507 TGACATTTAGAGTTGTTTAAAGG + Intergenic
1129728225 15:77914567-77914589 TGACATTTAGAGTTGTTTAAAGG - Intergenic
1130245263 15:82241793-82241815 TGACAGTAAGAGCTGTTCAAAGG + Intronic
1130259181 15:82342164-82342186 TGACATTTACAGTTGTTTAAAGG - Intronic
1130282088 15:82526985-82527007 TGACATTTACAGTTGTTTAAAGG + Intergenic
1130452214 15:84067092-84067114 TGAACCTTAGAGCTGTATTAGGG - Intergenic
1130455422 15:84101619-84101641 TGACAGTAAAAGCTGTTCAAAGG - Intergenic
1130473454 15:84243180-84243202 TGACATTTACAGTTGTTTAAAGG + Exonic
1130480868 15:84357244-84357266 TGACATTTACAGTTGTTTAAAGG + Intergenic
1130490844 15:84430515-84430537 TGACATTTACAGTTGTTTAAAGG - Intergenic
1130502428 15:84509283-84509305 TGACATTTACAGTTGTTTAAAGG - Intergenic
1130595733 15:85247786-85247808 TGACATTTACAGTTGTTTAAAGG + Intergenic
1130769105 15:86906545-86906567 TGACTCATAGTGCTGTTTATTGG + Intronic
1131188782 15:90296271-90296293 TGACATTTACAGTTGCTTAAAGG + Intronic
1132184754 15:99793431-99793453 TGACATTTAGAGTTGTTTAAAGG + Intergenic
1132432229 15:101771211-101771233 TGACATTTAGAGTTGTTTAAAGG - Intergenic
1135458627 16:22621258-22621280 TGACCCTTAGTGCCATTTAACGG + Intergenic
1143922908 17:10345010-10345032 TGACACTTAAAGAGGTTTACGGG - Intronic
1146419758 17:32672304-32672326 TCACACTTAAAGCAGTCTAATGG + Intronic
1146617943 17:34371602-34371624 TGCCACTTGGAGCTATTTTAGGG - Intergenic
1148178935 17:45589694-45589716 TGACCCTAAGACCTGGTTAATGG - Intergenic
1148270221 17:46256747-46256769 TGACCCTAAGACCTGGTTAATGG + Intergenic
1150766850 17:68009123-68009145 TGACCCTAAGACCTGGTTAATGG - Intergenic
1150997626 17:70337235-70337257 TGACTCATGGAGGTGTTTAAAGG + Intergenic
1151467811 17:74299051-74299073 TGTCACTCAGAGCTGTTTCTAGG - Intronic
1153104907 18:1515033-1515055 TGACATCTACTGCTGTTTAATGG - Intergenic
1154065495 18:11103284-11103306 TGACAGTTAAAACTGTCTAAAGG - Intronic
1154268589 18:12899963-12899985 TTACACTCAGAGCTTTTGAAGGG + Intronic
1157468727 18:47970850-47970872 TGTCATTGAGAGCTGATTAAGGG + Intergenic
1157899610 18:51501841-51501863 TGTTACTTAGAGTTGTTGAAAGG + Intergenic
1158024095 18:52875344-52875366 TTACATTTAGTGCTGTTTGATGG - Intronic
1159001113 18:62975971-62975993 TGAGGCTTAGAGAGGTTTAAAGG - Intronic
1159469910 18:68838947-68838969 TGAAACTTAGACTTGGTTAAGGG - Intronic
1161466564 19:4433922-4433944 TTACTCTTAGAGCAGTTTTAGGG + Intronic
1164924102 19:32113122-32113144 TGACACAGAAAGCTGTTTCAGGG - Intergenic
925242391 2:2343116-2343138 TGTCACTTAGAACTGATTAAAGG - Intergenic
925242400 2:2343217-2343239 TGTCACTTAGATCTGGTTAAAGG - Intergenic
927272837 2:21231911-21231933 TGAATCCTAGAGCTGTTCAATGG + Intergenic
927437060 2:23075808-23075830 TGACTCTCAGAGGTGTTTAATGG + Intergenic
927580545 2:24241616-24241638 TGACATTTAGATTTGTTTAAAGG - Intronic
930545735 2:52765570-52765592 TGACACTTTCAGCTATTTTAGGG - Intergenic
930900810 2:56505719-56505741 TGACATTTAGAGTATTTTAAGGG - Intergenic
931396858 2:61895554-61895576 TGAGACTTAGAGCTGTTGCAGGG - Intronic
933365062 2:81342659-81342681 TGGCACTCAGAGCTGTTTCTTGG + Intergenic
937804683 2:126125348-126125370 TGAAACTTAGAGATGCTTGAGGG - Intergenic
940715296 2:157216068-157216090 TGACATTTGGAATTGTTTAATGG - Intergenic
942397657 2:175568599-175568621 TGAAAATTACAGCTGATTAAAGG + Intergenic
946434984 2:219645399-219645421 TGACACTTGGAGCTCTCAAAGGG + Intergenic
1169979842 20:11372033-11372055 TGCCACTGTGAGCAGTTTAAAGG + Intergenic
1170804421 20:19617332-19617354 TGACACTCAGAGGTGCTTTAGGG - Intronic
1174500103 20:50978054-50978076 AGACACTCTGGGCTGTTTAAGGG + Intergenic
1177225772 21:18253474-18253496 GGACACTTAGAACTATGTAAAGG + Intronic
1177660057 21:24071029-24071051 AGACTCTTTGAGCTCTTTAAAGG - Intergenic
949391473 3:3567077-3567099 TGTCTCTTGGAGCTGTCTAAAGG - Intergenic
951577918 3:24132486-24132508 TACCTCTTAGAGCTGTTGAAAGG - Intronic
951765761 3:26196766-26196788 TTACAGTTGGAGATGTTTAAAGG + Intergenic
952114157 3:30159359-30159381 TGCCACTTGGCGGTGTTTAAGGG + Intergenic
959774078 3:110135361-110135383 AGAAATTTAGAGCTGTTTCAAGG - Intergenic
960798790 3:121516403-121516425 AGCCACTTTGGGCTGTTTAAAGG + Intronic
961224845 3:125234115-125234137 TACAACTTAGAGCTATTTAAGGG - Intronic
962759746 3:138499135-138499157 TGACACTTGGTGCTTTTAAAAGG - Intronic
963493556 3:146031527-146031549 TGACTCTAAGGGCTGTTTTATGG - Intergenic
964203367 3:154143036-154143058 AGACAAGTAGAACTGTTTAAAGG - Intronic
964962292 3:162441814-162441836 TGATAGTTACAGCTGTATAAAGG + Intergenic
965206322 3:165721913-165721935 TGGAACTTACAGCTCTTTAACGG + Intergenic
966215572 3:177498755-177498777 TGCCATTTAGACCTGTTGAAAGG - Intergenic
969509120 4:7607537-7607559 TGACACTCAGGGCTGTTGTAAGG - Intronic
975137249 4:70887055-70887077 GGACACTTAGATCTGTTCATGGG - Intergenic
976948987 4:90805987-90806009 TGAGAGTAAGAGTTGTTTAAAGG + Intronic
978281220 4:107017344-107017366 TAGCAATTATAGCTGTTTAAAGG + Intronic
980163088 4:129190060-129190082 TGGAATTTAGAGCTTTTTAAGGG + Intergenic
984092686 4:175393933-175393955 TGCTTCTAAGAGCTGTTTAATGG + Intergenic
984881124 4:184410783-184410805 TAACACTTAGAGGTCTTCAATGG - Intronic
984937934 4:184905777-184905799 GGACACTGGGAGTTGTTTAATGG - Intergenic
985902724 5:2809170-2809192 TGATACTTAAAGCTGCTTAGAGG + Intergenic
989860509 5:46369942-46369964 GGACATTTAGAGCTCTTTGAGGG + Intergenic
991696057 5:69273586-69273608 TGAAACTAACTGCTGTTTAAAGG + Intronic
993860607 5:93132237-93132259 TGACACTCAGAGAAGTTTAGGGG - Intergenic
994449741 5:99927589-99927611 TGCCACTAAAACCTGTTTAATGG - Intergenic
996259012 5:121442615-121442637 TGTCACTTAGACATGTTGAAAGG + Intergenic
996875966 5:128240773-128240795 TAACACTTTGAGTTGTGTAAGGG + Intergenic
998245074 5:140493432-140493454 TGACACTGTAAGCTGTTTGAAGG + Intronic
998796935 5:145830443-145830465 TCTCACTTAGACCTTTTTAATGG - Intronic
999813065 5:155146422-155146444 TGACATTTGGAGCTGTGTTAAGG - Intergenic
1000738990 5:164941038-164941060 GGACACTTGGAGCTGTGCAATGG - Intergenic
1202773669 5_GL000208v1_random:38695-38717 GGACATTTAGAGCTCTTTGATGG - Intergenic
1202773684 5_GL000208v1_random:39037-39059 GGACATTTAGAGCTCTTTGATGG - Intergenic
1002868463 6:1145277-1145299 TGCCACAAAGAGCTGTTTATTGG - Intergenic
1005707972 6:28475262-28475284 ATACATTTAGAGCTGATTAAAGG + Intergenic
1006915677 6:37592383-37592405 TGAAACCTAGCGCTGTTAAATGG - Intergenic
1010814843 6:80345668-80345690 TCACACTTAGAGCTGGTTAGAGG + Exonic
1012016383 6:93857401-93857423 TGACACTTAGAGATTTATTAGGG - Intergenic
1012368851 6:98478259-98478281 TGATGCTAAGAGCTGTTTTATGG + Intergenic
1015620061 6:135122124-135122146 TGGCACCAAGAGCTGTTTTATGG - Intergenic
1016568205 6:145482447-145482469 TGACAATAAAAGCTGTTAAAAGG + Intergenic
1017249941 6:152269491-152269513 TCACACATAGAACTGTTTGAGGG + Intronic
1018622565 6:165745408-165745430 TAATAATCAGAGCTGTTTAAGGG - Intronic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1023074858 7:36472621-36472643 AGACACTGAGAGCTGTGTCATGG - Intergenic
1024811560 7:53218275-53218297 TGACACTAAGTGCTGTTCAAAGG + Intergenic
1025309837 7:57919202-57919224 GGACATTTTGAGCTGTTTGAAGG + Intergenic
1028846138 7:95482481-95482503 TGAGACTTAAAGCTGATCAATGG - Intronic
1030445167 7:109640051-109640073 TGACATTTAGAATTGATTAAGGG - Intergenic
1033431921 7:141297139-141297161 TGCCCCTTAGAGTTGTTTTAAGG - Intronic
1033728322 7:144145963-144145985 TGACACTTTGACCTTTATAAGGG - Intergenic
1034394114 7:150807190-150807212 TGTCATATAGAGCTGTTCAAAGG - Intergenic
1037960235 8:23092457-23092479 TGTTACTCAGAGCTGTTTCAGGG - Intronic
1037971832 8:23177262-23177284 TGTTACTCAGAGCTGTTTCAGGG + Intergenic
1038513458 8:28162476-28162498 TGCCAGTACGAGCTGTTTAAAGG + Intronic
1047851719 8:128864524-128864546 TGACTCTTAGAGTTGCTGAAAGG + Intergenic
1048400934 8:134069845-134069867 TGACTATTAGTGCTGTTTTAGGG + Intergenic
1048922331 8:139242469-139242491 TCACACACAGAGATGTTTAATGG - Intergenic
1050051735 9:1609115-1609137 AAACACTTAGAACTGTTGAAAGG - Intergenic
1051283614 9:15470283-15470305 TGACACCTATAAATGTTTAATGG + Intronic
1053292735 9:36892388-36892410 TGGCGCTAAGAGCTGTGTAAAGG - Intronic
1058294652 9:103290498-103290520 AGACACAAAGGGCTGTTTAAGGG - Intergenic
1186204745 X:7189728-7189750 TGATCCTTAGAGCTGTGGAAAGG + Intergenic
1187490465 X:19746724-19746746 TGTCACTTAGAGCTGTATGGTGG - Intronic
1189651221 X:43191807-43191829 TCAGAGTTAGAGCTGTTTCAAGG + Intergenic
1192480788 X:71483652-71483674 GGACACTTAGAGGTGGATAAGGG + Intronic
1195585470 X:106560267-106560289 TTACTCTTAGACCTTTTTAAAGG - Intergenic
1196405345 X:115356097-115356119 TGGCCCATAGAGGTGTTTAATGG + Intergenic
1201435242 Y:13951854-13951876 TGACACTGGGAGCTGTAGAACGG - Intergenic
1201577435 Y:15476371-15476393 TGATCCTTAGAGCTGTGGAAAGG + Intergenic
1201922486 Y:19248795-19248817 TTACACTTATAACTGTTTCAAGG - Intergenic
1202367397 Y:24175048-24175070 TGACATTTACAGTTGTTTAAAGG + Intergenic
1202503386 Y:25495075-25495097 TGACATTTACAGTTGTTTAAAGG - Intergenic