ID: 1124975803

View in Genome Browser
Species Human (GRCh38)
Location 15:34528448-34528470
Sequence CGGCCTTATGGACCTCCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 2, 1: 2, 2: 5, 3: 13, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124975803_1124975808 -3 Left 1124975803 15:34528448-34528470 CCTCCAGGAGGTCCATAAGGCCG 0: 2
1: 2
2: 5
3: 13
4: 83
Right 1124975808 15:34528468-34528490 CCGCTCTGGAGCCAAAATAATGG 0: 8
1: 9
2: 9
3: 6
4: 73
1124975803_1124975810 -1 Left 1124975803 15:34528448-34528470 CCTCCAGGAGGTCCATAAGGCCG 0: 2
1: 2
2: 5
3: 13
4: 83
Right 1124975810 15:34528470-34528492 GCTCTGGAGCCAAAATAATGGGG 0: 14
1: 10
2: 6
3: 23
4: 190
1124975803_1124975809 -2 Left 1124975803 15:34528448-34528470 CCTCCAGGAGGTCCATAAGGCCG 0: 2
1: 2
2: 5
3: 13
4: 83
Right 1124975809 15:34528469-34528491 CGCTCTGGAGCCAAAATAATGGG 0: 9
1: 13
2: 5
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124975803 Original CRISPR CGGCCTTATGGACCTCCTGG AGG (reversed) Exonic
903044199 1:20553465-20553487 CGGCCTTGTGGCGCGCCTGGTGG - Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
906002122 1:42435471-42435493 CGGGCTTCTGGACAACCTGGAGG + Intronic
906514793 1:46432509-46432531 CTGCCTGATGGATTTCCTGGGGG + Intergenic
910990392 1:93049787-93049809 AGGCCTTAGGGACCCCCCGGGGG + Intergenic
913551970 1:119925051-119925073 CTGCCTTCGTGACCTCCTGGGGG - Intronic
915316853 1:155033560-155033582 CGGGCTTCTGGAGCTACTGGTGG - Exonic
917001840 1:170369231-170369253 AGGCCTTGTTGAACTCCTGGAGG + Intergenic
918170254 1:181989542-181989564 CAGCTTTATGGACCTCCTTGAGG - Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
922403162 1:225282230-225282252 CTGGCTCATGGACCTCCTGCAGG - Intronic
1064933292 10:20651465-20651487 CGGCCTTCTGGCACTCCTTGTGG - Intergenic
1065917428 10:30365227-30365249 TGGCTTTATGGACCTCCTGAAGG - Intronic
1067567503 10:47349480-47349502 AGTCCTTCAGGACCTCCTGGAGG - Exonic
1070156604 10:73839467-73839489 CGGCATGCTGGCCCTCCTGGTGG + Intronic
1074118570 10:110476330-110476352 TGGCCTTACGGACGTCCAGGTGG - Intergenic
1077148894 11:1059682-1059704 CTGTCTTCTGGACCTTCTGGTGG - Intergenic
1081789711 11:45774314-45774336 CGGCCTGATGGGGCACCTGGAGG - Intergenic
1083074286 11:60020402-60020424 AGGCCTTATCTGCCTCCTGGCGG - Intergenic
1083433252 11:62625909-62625931 CGGCTTTCTGGAGATCCTGGAGG + Exonic
1084961799 11:72720815-72720837 CGGTTTGATGGACTTCCTGGAGG - Intronic
1089734409 11:120539792-120539814 TGGCTTAATGGAGCTCCTGGAGG + Intronic
1091263647 11:134253705-134253727 CGACCGTAAGGATCTCCTGGCGG + Exonic
1096044011 12:48545915-48545937 GAGCCTCATGGAGCTCCTGGAGG - Intergenic
1096597120 12:52703031-52703053 GGTCCTTATTGTCCTCCTGGGGG - Exonic
1104636825 12:130442736-130442758 CTGCCTTATGGTCCTGGTGGGGG - Intronic
1106218476 13:27724150-27724172 CCTCCTTATGGCCCTCCAGGAGG + Intergenic
1121493854 14:94378625-94378647 CAGCCTTATGCACGGCCTGGAGG + Exonic
1121526586 14:94623604-94623626 CAGCCTTATGGACCACCTGTGGG - Exonic
1121720324 14:96104647-96104669 CGGCCCCAGGAACCTCCTGGGGG + Intergenic
1122838627 14:104443591-104443613 CAGCCGAATGCACCTCCTGGAGG + Intergenic
1123473634 15:20571948-20571970 CGGCTTTATGGACCACCTGGAGG + Intergenic
1123644375 15:22428405-22428427 CGGCTTTATGGACCACCTGGAGG - Intergenic
1123665694 15:22608307-22608329 CAGCTTTATGGACCACCTGGAGG - Intergenic
1123702749 15:22927989-22928011 CCGTCTTCTGGGCCTCCTGGCGG + Exonic
1123733932 15:23166959-23166981 CGGCTTTATGGACCACCTGGAGG + Intergenic
1123752066 15:23364345-23364367 CAGCTTTATGGACCACCTGGAGG + Exonic
1124284437 15:28388270-28388292 CGGCTTTATGGACCACCTGGAGG + Exonic
1124298260 15:28523344-28523366 CGGCTTTATGGACCACCTGGAGG - Exonic
1124319516 15:28702721-28702743 CAGCTTTATGGACCACCTGGAGG - Exonic
1124482996 15:30092710-30092732 CAGCTTTATGGACCACCTGGAGG + Exonic
1124489446 15:30144781-30144803 CAGCTTTATGGACCACCTGAAGG + Exonic
1124520581 15:30404508-30404530 CAGCTTTATGGACCACCTGAAGG - Exonic
1124538075 15:30561711-30561733 CAGCTTTATGGACCACCTGAAGG + Exonic
1124544536 15:30613772-30613794 CAGCTTTATGGACCACCTGGAGG + Exonic
1124564499 15:30801207-30801229 CAGCTTTATGGACCAACTGGAGG + Intergenic
1124754081 15:32393546-32393568 CAGCTTTATGGACCACCTGAAGG - Exonic
1124760576 15:32445874-32445896 CAGCTTTATGGACCACCTGAAGG - Exonic
1124778058 15:32603188-32603210 CAGCTTTATGGACCACCTGAAGG + Exonic
1124959177 15:34382227-34382249 CGGCCTTATGGACCTCCTGGAGG - Exonic
1124975803 15:34528448-34528470 CGGCCTTATGGACCTCCTGGAGG - Exonic
1128334893 15:66779500-66779522 CTGCCTCAGGGGCCTCCTGGAGG - Intronic
1129038585 15:72665598-72665620 CAGCTTTATGGACCTCCCGAAGG + Exonic
1129211305 15:74071632-74071654 CAGCTTTATGGACCTCCCGAAGG - Exonic
1129399098 15:75269455-75269477 CAGCTTTATGGACCTCCCGAAGG + Exonic
1129402705 15:75293731-75293753 CAGCTTTATGGACCTCCCGAAGG + Exonic
1129476237 15:75786153-75786175 CGGCTTTATGGACCTCCCGAAGG + Intergenic
1130459892 15:84152980-84153002 CGGCATGATGGGCCTCCTGTTGG + Intergenic
1131188568 15:90294940-90294962 CGACTTTATGGACCTCCTGAAGG + Intronic
1132184577 15:99792198-99792220 TGGCCTTATGGACCTCCTGGAGG + Intergenic
1132432402 15:101772458-101772480 TGGCCTTATGGACCTCCTGGAGG - Intergenic
1146184749 17:30717499-30717521 GGGCCTTGTGGACCTCAAGGAGG - Intergenic
1146427675 17:32758015-32758037 AGACATTATGAACCTCCTGGTGG + Intronic
1146686477 17:34844685-34844707 GGGCCATAGGGACTTCCTGGAGG - Intergenic
1147808649 17:43150679-43150701 GGGACTTATGGACCTCCCAGAGG - Intergenic
1151906048 17:77050173-77050195 CTGCCTTTGGGACCTCCTGCTGG - Intergenic
1152126016 17:78447383-78447405 CGGCCCTCTGGACCTCCTGTGGG + Intronic
1162974034 19:14198197-14198219 GGGCCTTGTGGACCTCAGGGAGG + Intronic
1166979347 19:46623637-46623659 CGGCCTGGTGGCCCTGCTGGTGG - Exonic
1167125278 19:47544947-47544969 CTGCCTTCTGGGCCTCCTGGAGG + Exonic
1167169990 19:47824572-47824594 TGACCTTAAGGACCTCCAGGGGG - Intronic
1167326123 19:48826914-48826936 CTGCCTGGTGGACGTCCTGGTGG - Intronic
1168685571 19:58347356-58347378 CGACCCTGTGGAGCTCCTGGTGG - Exonic
937955349 2:127418934-127418956 TGGCCTTTTGGAGCACCTGGTGG + Intronic
944482616 2:200173282-200173304 CGGCCCTATGGCCCTGCTTGCGG + Intergenic
1173116037 20:40243994-40244016 GGGCCTCATTGACCTCTTGGAGG + Intergenic
1175891675 20:62318534-62318556 CGGCCTCATGGACCTGCGAGAGG - Exonic
1177154952 21:17492177-17492199 CGGCCTTAGGGACTTGGTGGTGG + Intergenic
1177354750 21:19994414-19994436 AGACCTTATGGAGTTCCTGGAGG + Intergenic
1180953714 22:19731939-19731961 CTGATTTATGGTCCTCCTGGGGG - Intergenic
1182057947 22:27374997-27375019 CTGCCTTATAGAGCTCCTGAAGG + Intergenic
949514539 3:4795132-4795154 CGTCCTGATGAACCTGCTGGTGG + Exonic
968772958 4:2520030-2520052 CGGCCCTACAGACCTTCTGGTGG - Intronic
984143204 4:176028824-176028846 CGACATTATGCACCTCCTGATGG + Intergenic
989327358 5:40214549-40214571 CCTCCTTATTGACCTCCTGGTGG - Intergenic
996413224 5:123181634-123181656 CCGCCTTATGTACCTTCTGTAGG + Intronic
997531128 5:134581842-134581864 CAGCCTGCTGGACATCCTGGAGG - Exonic
998967840 5:147559916-147559938 CGTGCTTATGAACCACCTGGGGG + Intergenic
1007917813 6:45577281-45577303 CGGCTTTATCCACTTCCTGGTGG + Intronic
1017093634 6:150784095-150784117 CAACCTTGTGGACCTCCTGAAGG + Intronic
1019315264 7:381211-381233 GGCCCTCATGAACCTCCTGGTGG + Intergenic
1019721058 7:2571559-2571581 CGTCCTGAGGGACCTCCAGGAGG - Exonic
1021493396 7:21245510-21245532 CAACCTTATGACCCTCCTGGAGG - Intergenic
1024220620 7:47283794-47283816 GGGCCTTCTGGATCGCCTGGTGG + Exonic
1024292020 7:47811784-47811806 CTGCCTCTTGGGCCTCCTGGAGG - Intronic
1030274988 7:107710832-107710854 TGGCCTAATGGTGCTCCTGGTGG + Intronic
1049664523 8:143837080-143837102 TGGCCTTTTGGACCTCCTCCGGG + Exonic
1050151950 9:2625611-2625633 CTGCCTTAGGGAGCTCCTTGTGG + Intronic
1054848755 9:69824066-69824088 CTGCCCTATGGAGCTCCTTGAGG - Intronic
1060389961 9:123268826-123268848 CGGCCTTATGCACCTGCCAGCGG + Intergenic
1060985560 9:127817188-127817210 CAGTCCTATGGACTTCCTGGAGG + Exonic
1061392794 9:130327174-130327196 CCACCTTCTGGACCTCCTGAAGG + Intronic
1062232988 9:135493024-135493046 CCGCCTTGGGGACATCCTGGAGG - Intergenic
1201755460 Y:17481848-17481870 TGGCCTTGTTTACCTCCTGGAGG + Intergenic
1201846092 Y:18424137-18424159 TGGCCTTGTTTACCTCCTGGAGG - Intergenic