ID: 1124977157

View in Genome Browser
Species Human (GRCh38)
Location 15:34536187-34536209
Sequence CTCCCCTCTCTCAGAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 2, 1: 17, 2: 23, 3: 150, 4: 330}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124977157_1124977164 -6 Left 1124977157 15:34536187-34536209 CCACCCACTCTGAGAGAGGGGAG 0: 2
1: 17
2: 23
3: 150
4: 330
Right 1124977164 15:34536204-34536226 GGGGAGGGGCCGCCCGCTCTGGG 0: 2
1: 7
2: 5
3: 40
4: 254
1124977157_1124977168 5 Left 1124977157 15:34536187-34536209 CCACCCACTCTGAGAGAGGGGAG 0: 2
1: 17
2: 23
3: 150
4: 330
Right 1124977168 15:34536215-34536237 GCCCGCTCTGGGAGAGTGGAGGG 0: 2
1: 0
2: 9
3: 27
4: 216
1124977157_1124977170 6 Left 1124977157 15:34536187-34536209 CCACCCACTCTGAGAGAGGGGAG 0: 2
1: 17
2: 23
3: 150
4: 330
Right 1124977170 15:34536216-34536238 CCCGCTCTGGGAGAGTGGAGGGG 0: 2
1: 0
2: 7
3: 44
4: 278
1124977157_1124977163 -7 Left 1124977157 15:34536187-34536209 CCACCCACTCTGAGAGAGGGGAG 0: 2
1: 17
2: 23
3: 150
4: 330
Right 1124977163 15:34536203-34536225 AGGGGAGGGGCCGCCCGCTCTGG 0: 2
1: 7
2: 6
3: 45
4: 278
1124977157_1124977165 1 Left 1124977157 15:34536187-34536209 CCACCCACTCTGAGAGAGGGGAG 0: 2
1: 17
2: 23
3: 150
4: 330
Right 1124977165 15:34536211-34536233 GGCCGCCCGCTCTGGGAGAGTGG 0: 2
1: 7
2: 10
3: 45
4: 824
1124977157_1124977167 4 Left 1124977157 15:34536187-34536209 CCACCCACTCTGAGAGAGGGGAG 0: 2
1: 17
2: 23
3: 150
4: 330
Right 1124977167 15:34536214-34536236 CGCCCGCTCTGGGAGAGTGGAGG 0: 2
1: 0
2: 5
3: 38
4: 695
1124977157_1124977172 10 Left 1124977157 15:34536187-34536209 CCACCCACTCTGAGAGAGGGGAG 0: 2
1: 17
2: 23
3: 150
4: 330
Right 1124977172 15:34536220-34536242 CTCTGGGAGAGTGGAGGGGCTGG 0: 2
1: 3
2: 14
3: 102
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124977157 Original CRISPR CTCCCCTCTCTCAGAGTGGG TGG (reversed) Intronic
900013876 1:136265-136287 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900013900 1:136362-136384 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900013924 1:136459-136481 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900013948 1:136557-136579 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014003 1:136752-136774 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014017 1:136801-136823 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014031 1:136850-136872 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014060 1:136948-136970 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014084 1:137045-137067 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014108 1:137143-137165 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900014132 1:137240-137262 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900043946 1:492248-492270 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900043971 1:492345-492367 CTGACCTCTCTCAGCATGGGAGG + Intergenic
900043995 1:492442-492464 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900065382 1:727251-727273 TTGACCTCTCTCAGCGTGGGAGG + Intergenic
900065405 1:727348-727370 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
900117420 1:1034513-1034535 CGCCCCACTCTCAGAGCGTGGGG - Intronic
901523268 1:9802024-9802046 TACCCCTCTCACAGAGTGGGTGG - Intronic
902721946 1:18309705-18309727 CTGCCCTCTGCCAGTGTGGGAGG + Intronic
903161968 1:21495493-21495515 GTCCCCTCTCTCCTAGGGGGAGG + Intergenic
903679428 1:25087394-25087416 CACCCCTCTCTGAGCCTGGGAGG + Intergenic
904604654 1:31691898-31691920 CTCCCCTTGCTCAGACAGGGTGG - Intronic
905370374 1:37479794-37479816 CTCGCCTCTTGCAGCGTGGGTGG - Intronic
907158530 1:52355352-52355374 TTCTCCTCCCTCAGAGTGTGTGG - Intronic
907455524 1:54572909-54572931 TTCTCAGCTCTCAGAGTGGGAGG - Intronic
910860883 1:91741537-91741559 CTCCCCTCCTTCAGAGGGGTGGG + Intronic
911569766 1:99508278-99508300 CTCCCCACTCCCAGACGGGGTGG - Intergenic
912204178 1:107492501-107492523 CTCACCTCTCCCAGATAGGGTGG + Intergenic
912751783 1:112293564-112293586 CTCCCCCCTCCCGGACTGGGCGG - Intergenic
913993851 1:143638057-143638079 CTCCCCCCTCCCGGACTGGGCGG - Intergenic
915911554 1:159918676-159918698 CTCCTTTCTGTCAGGGTGGGGGG - Exonic
916658295 1:166897553-166897575 CTCCCCTCCCTAAGGTTGGGAGG - Intergenic
917423628 1:174890877-174890899 CTACACACTCACAGAGTGGGAGG - Intronic
917549988 1:176016578-176016600 TTCCCCTAACTCAGAGAGGGAGG - Intronic
917966655 1:180183113-180183135 GTCTCCTCTCTCCGAGTTGGTGG + Intronic
918238810 1:182604158-182604180 CTCCACTCCCTAAGAGTTGGTGG + Intronic
918687970 1:187443409-187443431 TTCTCCTTTCTCAGAGTAGGGGG + Intergenic
919465967 1:197921789-197921811 CTCCCTTCCTTCAGAGTGAGAGG - Intronic
919584752 1:199422460-199422482 CACCTGTCTCTAAGAGTGGGTGG + Intergenic
920733507 1:208510846-208510868 CTCCCCTGTCTCAAAGAGGCAGG + Intergenic
922734742 1:227972974-227972996 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
923554621 1:234990941-234990963 CACCCCTCACTCAGAGAGGATGG + Intergenic
1064957366 10:20925544-20925566 CTCACCTTTTTCAGAGTGGCTGG + Intronic
1065919009 10:30374626-30374648 CTCCCCTCTCCCAGAGTGGGTGG - Intergenic
1066252957 10:33651995-33652017 CTTCCCTCTCAAAGGGTGGGAGG - Intergenic
1066732653 10:38449288-38449310 CTGACCTGTCTCAGCGTGGGAGG - Intergenic
1066732676 10:38449383-38449405 CTGACCTCTCTCAGTGTGGGAGG - Intergenic
1066732697 10:38449480-38449502 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1066732708 10:38449528-38449550 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066732721 10:38449577-38449599 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066732781 10:38449822-38449844 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066732795 10:38449871-38449893 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066732808 10:38449920-38449942 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066732820 10:38449969-38449991 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066732833 10:38450018-38450040 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066732846 10:38450067-38450089 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066732857 10:38450116-38450138 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066732870 10:38450165-38450187 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066732926 10:38450361-38450383 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066732966 10:38450506-38450528 TTGACCTCTCTCAGCGTGGGAGG - Intergenic
1066732978 10:38450555-38450577 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066732991 10:38450604-38450626 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1066733013 10:38450701-38450723 CTGACCTCTCTCAGCGTGGAAGG - Intergenic
1068969619 10:62947802-62947824 CTCCCCCCTCCCGGACTGGGCGG - Intergenic
1069317874 10:67130350-67130372 CTCACCTCCCTCATAGAGGGTGG - Intronic
1069635854 10:69924433-69924455 CACCCACCTCCCAGAGTGGGCGG - Intronic
1069755664 10:70773162-70773184 CTCTGCTCTCTCAGAGTGGAAGG + Intronic
1070127841 10:73636141-73636163 CTCCACCCTCTCTGAGTGGCTGG - Intronic
1070535709 10:77375774-77375796 CTCCCATCACTCAGAGGAGGTGG - Intronic
1070772488 10:79090435-79090457 CTGCCCCCTCTCAGGGTGTGGGG + Intronic
1071669666 10:87596860-87596882 CTCCACTATCTCAGTGTGGCAGG + Intergenic
1071677177 10:87665649-87665671 TTGCCGTCTCTCTGAGTGGGAGG + Intronic
1073475755 10:103752017-103752039 CTCCCCTCTCTAGGTTTGGGAGG - Intronic
1073756462 10:106586174-106586196 ATCCCCACTCTCAGGGTGGCAGG + Intronic
1074419627 10:113297728-113297750 TTCCTCTCTCTGAGAGTGGCTGG - Intergenic
1074885370 10:117689044-117689066 CCTCCATCTCTCAGAGTTGGAGG + Intergenic
1075082056 10:119390934-119390956 CTCGCCTCTCTCAGAGGGAGGGG - Intronic
1075426654 10:122347049-122347071 CTGCCCTGTCCCAGAGAGGGAGG + Intergenic
1075781324 10:125018974-125018996 GTCCCCACTGACAGAGTGGGCGG - Intronic
1076596435 10:131625501-131625523 CTGCGCCCTCTCACAGTGGGAGG + Intergenic
1076970208 11:128431-128453 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1076970222 11:128480-128502 CTGACCTCTCTCCGCGTGGGAGG + Intergenic
1076970234 11:128528-128550 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1076970258 11:128626-128648 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1076970269 11:128674-128696 CTGACCTCTCTCAGCATGGGAGG + Intergenic
1076970282 11:128723-128745 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1076970306 11:128820-128842 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1076970332 11:128917-128939 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1077394699 11:2315230-2315252 CCACCCTATCTCACAGTGGGAGG + Intronic
1079861922 11:25683795-25683817 CTGCCCTCACCCAGTGTGGGTGG + Intergenic
1081789252 11:45771441-45771463 CTCCCCTCTCTAAGCGTCCGCGG - Exonic
1084517865 11:69646236-69646258 CTCCCGGCTCTCAGACTGGGTGG + Intronic
1085292439 11:75410079-75410101 CTCCCCCCTCCCGGACTGGGCGG + Intronic
1086884622 11:92190772-92190794 CTCCTCTCACTCAGCTTGGGAGG + Intergenic
1089583936 11:119498122-119498144 GCCCCCTCCCTCAGAGTGGCTGG + Intergenic
1089616250 11:119696500-119696522 CTGCCCGCTCTCAGTGGGGGTGG - Intronic
1089775959 11:120836055-120836077 CTCCACTCTGTCAGAGTGCAGGG - Intronic
1092672373 12:10878428-10878450 CTCCCACCTCTCAGATTGCGGGG - Intronic
1092890835 12:12967876-12967898 CTTCCCTCTCTCAGAGGATGAGG - Intergenic
1096751003 12:53758826-53758848 CTTCCCTCCCTCAGTCTGGGAGG + Intergenic
1096820268 12:54228348-54228370 ATCACCTCTCCCAGTGTGGGAGG + Intergenic
1098805552 12:75016776-75016798 CTCCCCTCTTTCTAGGTGGGTGG - Intergenic
1102030230 12:109736094-109736116 CTCCCCGCTCTGAGGTTGGGGGG + Intronic
1102048501 12:109845375-109845397 CTGCCCGCTCCCAAAGTGGGTGG - Intergenic
1102228318 12:111245056-111245078 CTTCCATTTCTCAGAGTAGGGGG - Intronic
1102680246 12:114686005-114686027 CTCCCCTATCTCAGCGTGGTTGG - Intergenic
1103343601 12:120234807-120234829 CTCCTGTGTGTCAGAGTGGGAGG - Intronic
1103813712 12:123636294-123636316 CTCCCCTATCTCAGAGCAGAAGG - Intronic
1105497632 13:20944746-20944768 CTCCTGTCTCTCAGGGTGGAGGG - Intergenic
1106976609 13:35225306-35225328 TTCCCCTCCCTCAGAGTAGAGGG + Intronic
1108132908 13:47322661-47322683 CTCTCCTCTCTCACAGAAGGAGG - Intergenic
1108686713 13:52826339-52826361 GGCCCCTCACTCAGAGTGGCTGG + Intergenic
1110799496 13:79678583-79678605 CTCCACTCTCAAAGTGTGGGTGG + Intergenic
1111946062 13:94667264-94667286 CCCCCATGTCTCTGAGTGGGTGG + Intergenic
1114350352 14:21843750-21843772 CTCCCTTGCCTCAGCGTGGGAGG - Intergenic
1117528170 14:56632372-56632394 CTCCCCTCTCTCAGAGTTTTGGG + Intronic
1117823592 14:59677061-59677083 CTCCCCTCACTCAGAAAGTGTGG - Intronic
1117953123 14:61102568-61102590 CCACCCTGTCCCAGAGTGGGAGG - Intergenic
1118321768 14:64757633-64757655 CTCCCCCCTCCCAGAGAGGAAGG - Intronic
1121530996 14:94653503-94653525 TTCCCCTCTCTAACATTGGGTGG - Intergenic
1121641858 14:95490055-95490077 CTCACTCGTCTCAGAGTGGGTGG - Intergenic
1122480589 14:102044715-102044737 CTCCCCACACGCAGGGTGGGTGG + Intronic
1123469905 15:20541942-20541964 CGCCCCTCTCCTGGAGTGGGCGG - Intergenic
1123471927 15:20562151-20562173 TGCCCCTCTCCCAGAGTTGGCGG + Intergenic
1123471936 15:20562177-20562199 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1123646068 15:22438176-22438198 CTCCCCTCTCTTAGGGTGGGTGG - Intergenic
1123646079 15:22438202-22438224 TGCCCCTCTCCCAGAGTTGGCGG - Intergenic
1123648150 15:22458739-22458761 CGCCCCTCTCCTGGAGTGGGCGG + Intergenic
1123667379 15:22618057-22618079 CTCTTCTCTTCCAGAGTGGGAGG - Intergenic
1123683075 15:22776298-22776320 CGCCTCTCTCCCAGAGTGGGCGG - Intronic
1123730199 15:23136964-23136986 CGCCCCTCTCCTGGAGTGGGCGG - Intergenic
1123732230 15:23157142-23157164 TGCCCCTCTCCCAGAGTTGGCGG + Intergenic
1123732239 15:23157168-23157190 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1123748337 15:23334374-23334396 CGCCCCTCTCCTGGAGTGGGCGG - Intergenic
1123750365 15:23354524-23354546 TGCCCCTCTCCCAGAGTTGGCGG + Intergenic
1123750374 15:23354550-23354572 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1123763106 15:23447421-23447443 CGCCCCTCTCCTGGAGTGGGCGG - Intergenic
1124280715 15:28358261-28358283 CGCCCCTCTCCTGGAGTGGGCGG - Intergenic
1124282735 15:28378440-28378462 TGCCCCTCTCCCAGAGTTGGCGG + Intergenic
1124282744 15:28378466-28378488 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124299956 15:28533147-28533169 CTCCCCTCTCTTAGGGTGGGTGG - Intergenic
1124299967 15:28533173-28533195 TGCCCCTCTCCCAGAGTTGGCGG - Intergenic
1124301989 15:28553368-28553390 CGCCCCTCTCCTGGAGTGGGCGG + Intergenic
1124321221 15:28712624-28712646 CTCTTCTCTTCCAGAGTGGGAGG - Intronic
1124334833 15:28848822-28848844 CGCCCCTCTCCCAGAGTGGGCGG - Intergenic
1124481277 15:30082729-30082751 CTCTTCTCTTCCAGAGTGGGAGG + Intergenic
1124481282 15:30082755-30082777 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124487732 15:30134825-30134847 CTCTTCTCTTCCAGAGTGGGAGG + Intergenic
1124487737 15:30134851-30134873 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124522317 15:30414438-30414460 CTCCCCTCTCTTAGAGTGGGTGG - Intergenic
1124522322 15:30414464-30414486 CTCTTCTCTTCCAGAGTGGGAGG - Intergenic
1124536342 15:30551754-30551776 CTCTTCTCTTCCAGAGTGGGAGG + Intergenic
1124536347 15:30551780-30551802 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124542821 15:30603802-30603824 CTCTTCTCTTCCAGAGTGGGAGG + Intergenic
1124542826 15:30603828-30603850 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124562782 15:30791278-30791300 CTCCCCTCTCACAGAGTGGGCGG + Intergenic
1124755792 15:32403470-32403492 CTCCCCTCTCTTAGAGTGGGTGG - Intergenic
1124755797 15:32403496-32403518 CTCTTCTCTTCCAGAGTGGGAGG - Intergenic
1124762304 15:32455812-32455834 CTCCCCTCTCTTAGAGTGGGTGG - Intergenic
1124762309 15:32455838-32455860 CTCTTCTCTTCCAGAGTGGGAGG - Intergenic
1124776322 15:32593232-32593254 CTCTTCTCTTCCAGAGTGGGAGG + Intergenic
1124776327 15:32593258-32593280 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124960528 15:34389966-34389988 CTCCCCTCTCTCAGAGTGGGTGG - Intronic
1124960537 15:34389992-34390014 CTCCACTCTCCCAGAGCGGGCGG - Intronic
1124977157 15:34536187-34536209 CTCCCCTCTCTCAGAGTGGGTGG - Intronic
1124977166 15:34536213-34536235 CTCCACTCTCCCAGAGCGGGCGG - Intronic
1125712585 15:41798841-41798863 CTCCCCTGGCTCAGAGAGTGGGG - Intronic
1126113367 15:45187956-45187978 CTCCCCTCGCTCAGTCTGGCTGG - Intronic
1127866396 15:63036784-63036806 CTCCCATCACTGAGAGTGGGTGG + Intergenic
1128660041 15:69493423-69493445 CTCCCCTCTCTCTGAGACAGAGG - Intergenic
1129028957 15:72604923-72604945 CTCCCCTCTCCCAGAGTGGGAGG + Intergenic
1129474393 15:75775353-75775375 CACCCCTCTCCCCAAGTGGGTGG + Intergenic
1129516036 15:76158214-76158236 CTCTGCTCTCTCAGAGAGCGTGG + Intronic
1129730357 15:77927044-77927066 CGCCCCTCTCCCCGAATGGGCGG - Intergenic
1129838142 15:78726885-78726907 CTCCCCTCTCCTGGAGTGGGCGG + Intronic
1129838161 15:78726938-78726960 CGCCCCTCTCCCCAAGTGGGCGG + Intronic
1130260435 15:82349614-82349636 CTCCCCTTTCTCTGAGTGGGCGG - Intergenic
1130260446 15:82349640-82349662 TTCCCCTCTCCCAGAGTGGGCGG - Intergenic
1130268286 15:82429793-82429815 CTCCCCTCTCCCAGAGTGGGCGG + Intergenic
1130268295 15:82429819-82429841 CTCCCCTCTCTCTGAGTGGGCGG + Intergenic
1130280786 15:82519364-82519386 TTCCCCTCTCCCAGAGTGGGCGG + Intergenic
1130280797 15:82519390-82519412 CTCCCCTTTCTCTGAGTGGGCGG + Intergenic
1130472157 15:84235547-84235569 TTCCCCTCTCCCAGAGTGGGCGG + Intergenic
1130472168 15:84235573-84235595 CTCCCCTTTCTCTGAGTGGGCGG + Intergenic
1130479650 15:84350118-84350140 TTCCCCTCTCCCAGAGTGGGCGG + Intergenic
1130479661 15:84350144-84350166 CTCCCCTTTCTCTGAGTGGGCGG + Intergenic
1130492109 15:84437985-84438007 CTCCCCTTTCTCTGAGTGGGCGG - Intergenic
1130492120 15:84438011-84438033 TTCCCCTCTCCCAGAGTGGGCGG - Intergenic
1130503737 15:84517047-84517069 TTCCCCTCTCCCAGAGTGGGTGG - Intergenic
1130594457 15:85240184-85240206 TTCTCCTCTCCCAGAGTGGGCGG + Intergenic
1130594466 15:85240210-85240232 CTCCCCTTTCTCTGAGTGGGCGG + Intergenic
1130714038 15:86314217-86314239 AAGGCCTCTCTCAGAGTGGGAGG - Intronic
1131187912 15:90291701-90291723 CCTCCCTCTCTCTGAGTGGTCGG + Intronic
1131616082 15:94018684-94018706 CTCCCCACCTCCAGAGTGGGGGG - Intergenic
1132184287 15:99790843-99790865 CTCCCCTCTCCCAGAGGGGGCGG + Intergenic
1132434078 15:101782281-101782303 CTCCACTCTCTTAGAGTGGGCGG - Intergenic
1132434088 15:101782307-101782329 CTCCCCTGTCCCAGAGTGGGTGG - Intergenic
1132724054 16:1331230-1331252 CTGCCCTCTCTCTTAGTGGGAGG + Intergenic
1133041905 16:3065352-3065374 CTCCCCACTCTCAGGCTGGTGGG + Intronic
1133330720 16:4971697-4971719 CTCCCTAGTCTCAGAGTGAGTGG - Intronic
1136069866 16:27781262-27781284 ATTCCCTCTGTGAGAGTGGGAGG + Intergenic
1136773034 16:32857896-32857918 CTCGCCTCGCTGCGAGTGGGTGG + Intergenic
1136897581 16:34003623-34003645 CTCGCCTCGCTGCGAGTGGGTGG - Intergenic
1138510967 16:57508224-57508246 CCCTCCTCTCCCATAGTGGGAGG - Intergenic
1139864274 16:70051308-70051330 CTCCCCCCTCCCGGACTGGGCGG - Intergenic
1140209565 16:72959811-72959833 CTCTCCTCTCTCAGGGGTGGCGG + Exonic
1141799694 16:86298418-86298440 CTCCCCTCGCCCAGCGTGGAAGG + Intergenic
1142449917 16:90168565-90168587 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142449941 16:90168662-90168684 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142449967 16:90168759-90168781 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142449991 16:90168856-90168878 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450016 16:90168953-90168975 CTGACCTCTCGCAGCGTGGGAGG - Intergenic
1142450028 16:90169001-90169023 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450040 16:90169049-90169071 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450051 16:90169097-90169119 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450065 16:90169146-90169168 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450077 16:90169194-90169216 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450090 16:90169243-90169265 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450101 16:90169291-90169313 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450115 16:90169340-90169362 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450127 16:90169388-90169410 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450141 16:90169437-90169459 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450152 16:90169486-90169508 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450164 16:90169534-90169556 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450191 16:90169632-90169654 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450203 16:90169680-90169702 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450217 16:90169729-90169751 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450241 16:90169826-90169848 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450253 16:90169874-90169896 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450280 16:90169972-90169994 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450292 16:90170020-90170042 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450304 16:90170069-90170091 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450317 16:90170118-90170140 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450331 16:90170167-90170189 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450355 16:90170264-90170286 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450367 16:90170312-90170334 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450394 16:90170410-90170432 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450406 16:90170458-90170480 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450433 16:90170556-90170578 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450445 16:90170604-90170626 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1142450457 16:90170653-90170675 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203075459 16_KI270728v1_random:1120006-1120028 CTCGCCTCGCTGCGAGTGGGTGG + Intergenic
1142457105 17:63038-63060 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1142457129 17:63135-63157 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1142457167 17:63281-63303 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1143514484 17:7413001-7413023 CACCCCTCTCCCAGTGTGAGGGG - Intronic
1148113487 17:45161264-45161286 CTCGCCTCTCACAGAGTGCGGGG - Intronic
1148123625 17:45225949-45225971 ATCCCCTTTCTCACAGTGGAGGG - Intronic
1148753041 17:49956865-49956887 CTCAACTCTCTCTGAATGGGTGG - Intergenic
1150527414 17:65937721-65937743 CACCCCCCTCCCAGACTGGGCGG - Intronic
1151305620 17:73261165-73261187 CTCCTCTGTTTCAGAGTTGGGGG - Intronic
1151404588 17:73878202-73878224 CTCTCCTCTCTCAGCCAGGGAGG + Intergenic
1152578840 17:81157153-81157175 CTCCCCTCTCTTGGCGGGGGCGG - Intronic
1153924558 18:9824697-9824719 CGCCCCACTCCCAGAGTGGAAGG + Intronic
1157748972 18:50161418-50161440 CTCCCCTCTAAGGGAGTGGGGGG + Intronic
1160058527 18:75509017-75509039 TTCCCCTCTCACAGTTTGGGTGG - Intergenic
1160647018 19:198397-198419 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647042 19:198494-198516 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647068 19:198591-198613 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647094 19:198688-198710 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647118 19:198785-198807 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647144 19:198882-198904 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647170 19:198979-199001 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647194 19:199076-199098 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647218 19:199170-199192 CACACCTCTCTCAGCGTGGGAGG + Intergenic
1160647232 19:199219-199241 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647243 19:199268-199290 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647254 19:199316-199338 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647280 19:199413-199435 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647306 19:199510-199532 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647330 19:199607-199629 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647344 19:199656-199678 CTGACCTCTCTCAGCATGGGAGG + Intergenic
1160647355 19:199705-199727 CTGACCTCTCTCAGCATGGGAGG + Intergenic
1160647393 19:199851-199873 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647418 19:199948-199970 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647442 19:200045-200067 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647466 19:200142-200164 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647490 19:200239-200261 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647514 19:200337-200359 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160647526 19:200386-200408 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1160968067 19:1755271-1755293 CTCCCCTCCTCCAGAGTGGGTGG + Intronic
1161614478 19:5262367-5262389 TTCATCTCTCTCAGGGTGGGAGG - Intronic
1161685938 19:5702459-5702481 CTCCTCCCTCCCAGAGGGGGCGG - Intronic
1161955739 19:7493880-7493902 CTCCCCTCTCCCCCAGTGGGGGG + Intronic
1162022241 19:7873268-7873290 CTCCCCTCTCCCAGAGGCTGGGG + Exonic
1162519943 19:11173879-11173901 GTCTCCTCTATCAGACTGGGAGG + Intronic
1162738968 19:12763141-12763163 CTTCCCTCTCCCAGATTGGTGGG - Exonic
1166407686 19:42532985-42533007 CTGCCCTCACTCACTGTGGGTGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925831291 2:7898403-7898425 CTCACCAATATCAGAGTGGGGGG - Intergenic
927765382 2:25802710-25802732 CTCCCCAATCTCAGGGAGGGAGG + Intronic
927828854 2:26330669-26330691 CTCCACTCTCTCTGAGTGTTAGG + Intronic
928558027 2:32447664-32447686 CTCCCCCCTCCCGGACTGGGCGG + Intronic
929189023 2:39122646-39122668 CTCCCCACTTTCAAAGTGTGTGG + Intronic
930476460 2:51888513-51888535 TTCCCCTCCCCCAGGGTGGGGGG + Intergenic
931753740 2:65353260-65353282 CTACCCTCTCCCAAAGAGGGAGG + Intronic
932781279 2:74560162-74560184 CTCGGCTCTCCCAGTGTGGGTGG + Exonic
932781429 2:74560962-74560984 CTCCCCAGGCTAAGAGTGGGAGG - Intronic
933214298 2:79610299-79610321 CTCCCCTTTCCCACAGTGGTGGG + Intronic
933713677 2:85345153-85345175 CTCCCCTCTCTCAGACTCTCAGG - Intronic
933981561 2:87554911-87554933 CTCACCTCACTCAAAGTGGCAGG + Intergenic
934709966 2:96508342-96508364 CACCCGTCTCCCAGGGTGGGTGG + Intergenic
934756198 2:96826632-96826654 CACCCCTCTCTCTGTGTGGTTGG + Intronic
936312275 2:111395905-111395927 CTCACCTCACTCAAAGTGGCAGG - Intergenic
938367573 2:130746988-130747010 CTGCCATCTCTCAGAGATGGGGG - Intergenic
938533883 2:132221347-132221369 CTCCCCCCTCCCGGACTGGGCGG - Intronic
940118624 2:150238386-150238408 CTGCCCTCCGTCAGAGTGGAAGG + Intergenic
940415688 2:153417340-153417362 TTTCTCTCTCTCAGAGTGAGAGG + Intergenic
941027260 2:160470745-160470767 GTACTCGCTCTCAGAGTGGGGGG + Intronic
942249356 2:174034331-174034353 CTCCCATCTCCCAGATTGAGTGG - Intergenic
942293749 2:174498260-174498282 CTCACCTCACTCTGAGTGGTTGG - Intergenic
945167091 2:206957690-206957712 TTCCCCTCTTTCAGAGCGGTAGG - Intronic
946195407 2:218029932-218029954 CTCTCATCTCACAGAGAGGGTGG - Intergenic
946249939 2:218405809-218405831 CTCCCCTCCCCCAGAGCGGGTGG + Exonic
946751378 2:222896935-222896957 CTCCCCCCTCCCGGACTGGGCGG + Intronic
947263887 2:228254460-228254482 CTCCCCTGAGTCAGAGAGGGAGG + Intergenic
947543651 2:230995607-230995629 CTCCCCTCCCACAGTGCGGGAGG + Intergenic
948778631 2:240303398-240303420 CTTCCCTCTCCCACTGTGGGTGG + Intergenic
1168847393 20:954839-954861 CACCTCTCTCCTAGAGTGGGAGG - Intergenic
1169277507 20:4243676-4243698 CTCCCCTCTCTCTCGGTGAGGGG + Intronic
1170517790 20:17149586-17149608 GTCCCCTGTCACAGAGTGGCAGG + Intergenic
1170669234 20:18415397-18415419 GTCCCCCCTTTCTGAGTGGGCGG + Exonic
1174285967 20:49473835-49473857 CTCACCTCTCTGAGACTGGGAGG - Intronic
1177097977 21:16862195-16862217 CTCTACTCTCTGAGAGTGAGTGG - Intergenic
1179896070 21:44364463-44364485 CACCCCACTCTCAGAGTGCTTGG + Intronic
1180118116 21:45725576-45725598 CTTCCCGGTCTCAGAGTGGCAGG + Intronic
1180244296 21:46536452-46536474 CTCCCCTCTGTAAGAGCTGGTGG - Intronic
1181847781 22:25726491-25726513 AACCCCTCACTCAGGGTGGGAGG - Exonic
1182352299 22:29705766-29705788 CCCACCCCGCTCAGAGTGGGTGG + Intergenic
1183709486 22:39494473-39494495 CTCCTCTCTCTCAGAGTCCTGGG + Intergenic
1184178106 22:42801295-42801317 CTCCCCTCTCTGAGACAGAGGGG + Intronic
950363748 3:12468550-12468572 CTGCCCTCTCACAGTGTGGTAGG - Intergenic
952412925 3:33065481-33065503 CTCTCCTCTATCAGAATGGAGGG - Exonic
957279052 3:78126483-78126505 CTCGCCTTTCTCAATGTGGGTGG - Intergenic
957659475 3:83128856-83128878 CTCTCCTGCCTCTGAGTGGGTGG - Intergenic
960089795 3:113627710-113627732 CTCCCCTCTCTTAATGTTGGAGG - Exonic
961584938 3:127914799-127914821 TACACCTCTCTGAGAGTGGGAGG - Intergenic
961810400 3:129518670-129518692 CGCCCCTCTCCCACAGTGGTGGG - Intronic
962430248 3:135312361-135312383 CTCCCCTATCACAGGGTAGGTGG - Intergenic
963495369 3:146052963-146052985 CTCTCCTCTCTCAGAGTTTTCGG - Intergenic
964826976 3:160839358-160839380 TTCCCATCTCTAGGAGTGGGTGG + Intronic
965639108 3:170814180-170814202 CTCCCTTCTCTAAGAATGGCTGG - Intronic
966783938 3:183608322-183608344 CTCCCCCCTCCCGGACTGGGCGG - Intergenic
968370327 3:198219818-198219840 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370351 3:198219915-198219937 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370376 3:198220012-198220034 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370414 3:198220158-198220180 CTGACCTCTCTCAGCATGGGAGG - Intergenic
968370425 3:198220205-198220227 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370452 3:198220303-198220325 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370476 3:198220400-198220422 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370500 3:198220497-198220519 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370514 3:198220546-198220568 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370525 3:198220595-198220617 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370539 3:198220644-198220666 CACACCTCTCTCAGCGTGGGAGG - Intergenic
968370563 3:198220738-198220760 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370587 3:198220835-198220857 CCGACCTCTCTCAGCGTGGGAGG - Intergenic
968370614 3:198220932-198220954 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370640 3:198221029-198221051 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968370664 3:198221126-198221148 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
968474070 4:794950-794972 CTCCACACTCTCAGAGCGGGAGG - Intronic
968897429 4:3412934-3412956 CGCCCCTGTCCCAGAGTGGCCGG - Intronic
969577340 4:8044089-8044111 CCCTCCTCTCTCATAGTGGTTGG - Intronic
971356997 4:25904027-25904049 CTGCCCTCACACAGTGTGGGTGG - Intronic
971463720 4:26931160-26931182 TTTCACTCTCTCAGAGTGAGAGG + Intronic
973725328 4:53770008-53770030 CTCCCATCTCTCAGAGGGGCTGG + Intronic
976971551 4:91108918-91108940 CTGCCCTCACCCAGTGTGGGTGG + Intronic
977673429 4:99721997-99722019 CTAGACTCTCTCAGAGTTGGAGG + Intergenic
977885781 4:102250569-102250591 GGCCCCTCACTCAGAGTGGCCGG - Intergenic
979443532 4:120781808-120781830 TTTCCCTCTCCCAGAATGGGAGG - Intronic
982065411 4:151650269-151650291 CTCCTCGCTCTCCGGGTGGGCGG - Exonic
982977180 4:162078510-162078532 CTCCCATCTCCCAGAGTGCCAGG + Intronic
984478283 4:180265134-180265156 CTCCACTCTGACAGAATGGGAGG - Intergenic
986264900 5:6182848-6182870 CTCACTCCTGTCAGAGTGGGAGG - Intergenic
986393680 5:7306832-7306854 CGCCCCTCTCCCAGAGTGGGCGG - Intergenic
989587918 5:43088133-43088155 CTCCCCCCTCCCGGACTGGGCGG + Intronic
991060099 5:62365495-62365517 ATCCTCTCTATCAGAGTGGCAGG - Intronic
992677958 5:79124502-79124524 CTCTCTCCTCTCAAAGTGGGAGG - Intronic
994959772 5:106584408-106584430 CTCCCCTCCCACAGAGATGGAGG + Intergenic
996934396 5:128931792-128931814 GTCCCCTCTTTCAGAAAGGGAGG - Intronic
997439112 5:133896746-133896768 CTCCTGCCTCTGAGAGTGGGTGG - Intergenic
998191689 5:140030724-140030746 CTCCTTTCTCTCAGAGGTGGTGG + Intronic
999910554 5:156193697-156193719 GTTCCATCTCTCTGAGTGGGTGG - Intronic
1001706367 5:173743950-173743972 CTCCCCTCTCTCAGAAGGCCTGG + Intergenic
1002729848 5:181326487-181326509 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1002729872 5:181326584-181326606 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1002729897 5:181326681-181326703 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1002865159 6:1115348-1115370 TTCCCCTCTTTCAGTGTGGTTGG + Intergenic
1003964072 6:11236561-11236583 CTGCCCTCTCTATGAGTGGCTGG - Intronic
1004192128 6:13473089-13473111 CTCCCATCTTTCATGGTGGGTGG - Intronic
1005909553 6:30296356-30296378 ATACCCTCTCTCAGAGTTGAAGG - Intergenic
1007276274 6:40676454-40676476 CTCTCCCCTCTCAGACTGGGTGG + Intergenic
1007384226 6:41509835-41509857 CTCCCCTCTCTCTGAGTCCCTGG - Intergenic
1007966064 6:46004786-46004808 CTCCCCTCTCCCAGAGCCTGTGG + Intronic
1008321385 6:50118493-50118515 CTCCCTTCTCTCTGTGTGGTAGG + Intergenic
1008587857 6:52965373-52965395 ATCCCGTCTCTCAGAGCAGGTGG - Intergenic
1014295696 6:119614385-119614407 CACCACTCTTGCAGAGTGGGAGG + Intergenic
1019155780 6:170038050-170038072 CTCCCCTGTGACAGTGTGGGAGG - Intergenic
1019724785 7:2595533-2595555 CTCCACTCCCTCAGCGTGTGTGG + Intronic
1020347690 7:7182878-7182900 CTCCCCCCTCTCCGGGTTGGTGG + Intronic
1023401075 7:39793271-39793293 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1023818587 7:43968196-43968218 CAGGCCTCTCTCAGAGTGAGGGG - Intergenic
1024074574 7:45811970-45811992 CTGACCTCTCTCGGCGTGGGAGG - Intergenic
1024074843 7:45813098-45813120 CGGACCTCTCTCAGCGTGGGAGG - Intergenic
1024074879 7:45813245-45813267 CCGACCTCTCTCAGCGTGGGAGG - Intergenic
1024074893 7:45813294-45813316 CCAACCTCTCTCAGCGTGGGAGG - Intergenic
1024074979 7:45813622-45813644 CTGACCTCTGTCAGTGTGGGAGG - Intergenic
1024074991 7:45813671-45813693 CTGACCTCTGTCAGTGTGGGAGG - Intergenic
1024075003 7:45813720-45813742 CTGACCTCTGTCAGTGTGGGAGG - Intergenic
1024075058 7:45813931-45813953 CTGACCTCTCTCAGCCTGGGAGG - Intergenic
1024606673 7:51027727-51027749 CTTCCCTCCCGCAGAGTGGATGG + Exonic
1024648536 7:51387410-51387432 CTGACCTCTGTCAGCGTGGGAGG + Intergenic
1024648560 7:51387508-51387530 CTGACCTCTCTCAGTGTGGGAGG + Intergenic
1024927541 7:54633216-54633238 ATCCCCTCTGTGAGTGTGGGTGG - Intergenic
1025052385 7:55741878-55741900 CTGACCTCTCTCTGCGTGGGAGG + Intergenic
1025052407 7:55741958-55741980 CGCCCACCTCTCAGCGTGGGAGG + Intergenic
1025052421 7:55742006-55742028 CTGACCTCTCTCTGCGTGGGAGG + Intergenic
1025052444 7:55742104-55742126 CGGACCTCTCTCAGCGTGGGAGG + Intergenic
1025052479 7:55742234-55742256 CGGACCTCTCTCAGCGTGGGAGG + Intergenic
1025052493 7:55742282-55742304 CTGACCTCTCTCGGCGTGGGAGG + Intergenic
1025052505 7:55742331-55742353 CTGACCTCTCTCTGCGTGGGAGG + Intergenic
1025052777 7:55743426-55743448 CTGACCTCTCTCCGCGTGGGAGG + Intergenic
1025052877 7:55743739-55743761 CCGACCTCTCTCAGCGTGGGAGG + Intergenic
1025129361 7:56367610-56367632 CTGACCTCTCTCGGCGTGGGAGG + Intergenic
1025129409 7:56367787-56367809 CCGACCTCTCTCAGGGTGGGAGG + Intergenic
1025129421 7:56367836-56367858 CCGACCTCTCTCAGCGTGGGAGG + Intergenic
1025129455 7:56367981-56368003 CTGACCTCTCTCTGCGTGGGAGG + Intergenic
1025129581 7:56368464-56368486 CGGACCTCTCTCAGTGTGGGAGG + Intergenic
1025129635 7:56368692-56368714 CTGACCTCTCTCAGCGTGAGAGG + Intergenic
1025129648 7:56368741-56368763 CGGCCCTCTCTCAGCGTGGGAGG + Intergenic
1025129694 7:56368918-56368940 CCTTCCTCTCTCAGGGTGGGAGG + Intergenic
1025129751 7:56369160-56369182 CTGACCTCTCTCAGCGTGGGAGG + Intergenic
1025129764 7:56369208-56369230 CTGACCTCTCTCGGCGTGGGAGG + Intergenic
1025129786 7:56369290-56369312 CCGACCTCTCTCAGTGTGGGAGG + Intergenic
1025130060 7:56370412-56370434 CTGACCTCTCTCGGCGTGGGAGG + Intergenic
1025130082 7:56370510-56370532 CTGACCTCTCTCTGCGTGGGAGG + Intergenic
1025130106 7:56370592-56370614 CCGACCTCTCTCAGCGTGGGAGG + Intergenic
1025130367 7:56371662-56371684 CTGACCTCTCTCGGCGTGGGAGG + Intergenic
1025130379 7:56371710-56371732 CTGACCTCTCTCGGCGTGGGAGG + Intergenic
1025130402 7:56371808-56371830 CTGACCTCTCTCTGCGTGGGAGG + Intergenic
1025130426 7:56371890-56371912 CCGACCTCTCTCAGCGTGGGAGG + Intergenic
1025130687 7:56372960-56372982 CTGACCTCTCTCGGCGTGGGAGG + Intergenic
1025130699 7:56373008-56373030 CTGACCTCTCTCGGCGTGGGAGG + Intergenic
1025131002 7:56374253-56374275 CTGACCTCTCTCGGCGTGGGAGG + Intergenic
1025131014 7:56374301-56374323 CTGACCTCTCTCGGCGTGGGAGG + Intergenic
1025131037 7:56374399-56374421 CTGACCTCTCTCTGCGTGGGAGG + Intergenic
1025131061 7:56374481-56374503 CCGACCTCTCTCAGCGTGGGAGG + Intergenic
1028088913 7:86672857-86672879 CTCCCCTCTCTATGAGTGTGTGG + Intronic
1028862535 7:95669636-95669658 CTCACCTCTAGCAGTGTGGGAGG + Intergenic
1029743636 7:102505161-102505183 CAGGCCTCTCTCAGAGTGAGGGG - Intronic
1029761622 7:102604324-102604346 CAGGCCTCTCTCAGAGTGAGGGG - Intronic
1029960828 7:104687859-104687881 CTACCCTCTAGCAGAATGGGTGG + Intronic
1030388187 7:108891749-108891771 CTCCCTTCTCTCAGCTTTGGAGG + Intergenic
1030391340 7:108931819-108931841 CTCTCCTCTCTTTGAGTGGAAGG + Intergenic
1032051579 7:128653653-128653675 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1032655814 7:133928623-133928645 CTCCCCTCACTCACAGTCTGTGG + Intronic
1034961784 7:155367675-155367697 CTCCCCCCTCCCGGACTGGGTGG + Intronic
1038234784 8:25742146-25742168 CTCCACACACTCAGAGTTGGCGG + Intergenic
1039848374 8:41342278-41342300 CTCCCCTCCCTCTGAGGGGTAGG + Intergenic
1040573403 8:48628888-48628910 TTCCCCTCCCTCAGTGTGAGTGG - Intergenic
1040992011 8:53362370-53362392 CTCCCCTGTGTCACAGTGCGAGG - Intergenic
1042958318 8:74275822-74275844 CTCCCCATTCTCAGAGCAGGGGG - Intronic
1044832931 8:96267850-96267872 CTGCCATCTCTCAGACTGGAAGG + Intronic
1045850929 8:106697300-106697322 CTCCCTTCTGTCAGGGTGAGGGG - Intronic
1046681832 8:117179070-117179092 CTCCTCTCTCTCTGAGTTGATGG - Intergenic
1046775330 8:118158445-118158467 CTCCCCTCTTTCTGAGTTGGAGG + Intergenic
1047438430 8:124855317-124855339 CTCCCCCATCTCAGAGCGTGAGG - Intergenic
1048812834 8:138304180-138304202 CTCCCTTGTCTCAGGATGGGAGG - Intronic
1049302759 8:141880345-141880367 CTCCCCTCCCCCAGTGTGTGGGG + Intergenic
1051008272 9:12376958-12376980 CTGCCCTCTCCAATAGTGGGTGG - Intergenic
1051525090 9:18033983-18034005 CTCTCTTCTCTCAGAGTAAGAGG + Intergenic
1052966753 9:34346156-34346178 CTCCGCACTCTCAGAATGGGAGG + Intergenic
1056681264 9:88721143-88721165 CTCTCCTCCCCCAGAGTGGGTGG + Intergenic
1056691661 9:88813315-88813337 CTCCCCTCTCACTGGGTGGGCGG + Intergenic
1057803572 9:98204781-98204803 CTCCGTTCTCTCAGAGCTGGTGG + Intronic
1057843756 9:98506423-98506445 CTCCTCCATCTAAGAGTGGGTGG - Intronic
1059654627 9:116346372-116346394 CTCCCTACTCTCAGATTTGGCGG - Intronic
1060894552 9:127209409-127209431 CACCCCTCTTTCTGAGAGGGAGG + Intronic
1061615096 9:131774218-131774240 CTCCCCTCACTCGGAGGGTGGGG + Intergenic
1061826702 9:133262362-133262384 CTCCCTCTTCTCTGAGTGGGAGG - Intronic
1061941176 9:133884869-133884891 CGCCCCTCTGGCTGAGTGGGAGG - Intronic
1062231413 9:135484096-135484118 CTCCCCTCTTACAGAGAAGGTGG + Intronic
1062754275 9:138279048-138279070 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1062754300 9:138279146-138279168 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1062754312 9:138279195-138279217 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203577822 Un_KI270745v1:21756-21778 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203577845 Un_KI270745v1:21853-21875 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203577919 Un_KI270745v1:22142-22164 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203577940 Un_KI270745v1:22239-22261 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203577963 Un_KI270745v1:22336-22358 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203577991 Un_KI270745v1:22433-22455 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578010 Un_KI270745v1:22530-22552 CTGACCTCTCTCAGCATGGGAGG - Intergenic
1203578034 Un_KI270745v1:22627-22649 CTGACCTCTCTCAGCATGGGAGG - Intergenic
1203578044 Un_KI270745v1:22675-22697 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578058 Un_KI270745v1:22724-22746 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578084 Un_KI270745v1:22822-22844 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578098 Un_KI270745v1:22871-22893 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578121 Un_KI270745v1:22967-22989 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578144 Un_KI270745v1:23064-23086 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578169 Un_KI270745v1:23161-23183 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578193 Un_KI270745v1:23258-23280 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1203578217 Un_KI270745v1:23355-23377 CTGACCTCTCTCAGCGTGGGAGG - Intergenic
1186760885 X:12720719-12720741 CTCCCCCCTCTCAGATCCGGTGG - Exonic
1187482659 X:19672322-19672344 CTCCCCACTCTTTAAGTGGGAGG + Intronic
1189113055 X:38313725-38313747 CACCTCTCTCCCAGAGTGGTTGG + Intronic
1189134478 X:38534317-38534339 CTCCCCTCTCAAAGAGGAGGTGG + Intronic
1190596333 X:52055131-52055153 CCGCCATCTCCCAGAGTGGGGGG - Intergenic
1190612491 X:52198942-52198964 CCGCCATCTCCCAGAGTGGGGGG + Intergenic
1198681908 X:139191969-139191991 CTCGGCTCTCGCAGAGAGGGCGG - Intronic
1199622627 X:149713713-149713735 CTCCCATATCTCAGAGAGGTGGG + Intronic
1200119246 X:153782699-153782721 CTCCCCTAGCTGAGGGTGGGTGG + Intronic
1202366220 Y:24167899-24167921 CTCCCCTCTCCCAGATTGGGCGG + Intergenic
1202366231 Y:24167925-24167947 CTCCCCTCTCTCTTAGTGGGCGG + Intergenic
1202380824 Y:24275867-24275889 CTGACCTCTGTCAGTGTGGGAGG - Intergenic
1202380838 Y:24275916-24275938 CTGACCTCTGTCAGCGTGGGAGG - Intergenic
1202380852 Y:24275965-24275987 CTGACCTCTCTCAGTGTGGGAGG - Intergenic
1202380863 Y:24276013-24276035 CTGACCTCTCTCAGTGTGGGAGG - Intergenic
1202489921 Y:25394112-25394134 CTGACCTCTCTCAGTGTGGGAGG + Intergenic
1202489932 Y:25394160-25394182 CTGACCTCTCTCAGTGTGGGAGG + Intergenic
1202489946 Y:25394209-25394231 CTGACCTCTGTCAGCGTGGGAGG + Intergenic
1202489960 Y:25394258-25394280 CTGACCTCTGTCAGTGTGGGAGG + Intergenic
1202504550 Y:25502198-25502220 CTCCCCTCTCTCTTAGTGGGCGG - Intergenic
1202504561 Y:25502224-25502246 CTCCCCTCTCCCAGATTGGGCGG - Intergenic