ID: 1124988215

View in Genome Browser
Species Human (GRCh38)
Location 15:34644245-34644267
Sequence GTTTTTAAAGGGATCATCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124988212_1124988215 -2 Left 1124988212 15:34644224-34644246 CCTGAGGAGTTCTGGGCTAGAGT No data
Right 1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG No data
1124988211_1124988215 -1 Left 1124988211 15:34644223-34644245 CCCTGAGGAGTTCTGGGCTAGAG No data
Right 1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG No data
1124988208_1124988215 13 Left 1124988208 15:34644209-34644231 CCTCAAATCTATTTCCCTGAGGA No data
Right 1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124988215 Original CRISPR GTTTTTAAAGGGATCATCGA AGG Intergenic
No off target data available for this crispr