ID: 1124989775

View in Genome Browser
Species Human (GRCh38)
Location 15:34660150-34660172
Sequence CCCTGAAGAGGGCCATGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124989767_1124989775 -6 Left 1124989767 15:34660133-34660155 CCTGGGACCCAGGAATCCCCTGA No data
Right 1124989775 15:34660150-34660172 CCCTGAAGAGGGCCATGGACTGG No data
1124989765_1124989775 9 Left 1124989765 15:34660118-34660140 CCTGGTAGACATGAGCCTGGGAC No data
Right 1124989775 15:34660150-34660172 CCCTGAAGAGGGCCATGGACTGG No data
1124989762_1124989775 24 Left 1124989762 15:34660103-34660125 CCAGTGAAATATAGACCTGGTAG No data
Right 1124989775 15:34660150-34660172 CCCTGAAGAGGGCCATGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124989775 Original CRISPR CCCTGAAGAGGGCCATGGAC TGG Intergenic
No off target data available for this crispr