ID: 1124991152

View in Genome Browser
Species Human (GRCh38)
Location 15:34674988-34675010
Sequence ATGGTAGACCAGCTCTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124991151_1124991152 -8 Left 1124991151 15:34674973-34674995 CCTAAGTCAGGATGGATGGTAGA No data
Right 1124991152 15:34674988-34675010 ATGGTAGACCAGCTCTGACAAGG No data
1124991149_1124991152 -1 Left 1124991149 15:34674966-34674988 CCTGTATCCTAAGTCAGGATGGA No data
Right 1124991152 15:34674988-34675010 ATGGTAGACCAGCTCTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124991152 Original CRISPR ATGGTAGACCAGCTCTGACA AGG Intergenic
No off target data available for this crispr