ID: 1124997178

View in Genome Browser
Species Human (GRCh38)
Location 15:34735230-34735252
Sequence GAGACTAGGGTGAATGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124997173_1124997178 4 Left 1124997173 15:34735203-34735225 CCTCTCTTCTTCCTCAGAAAGCT No data
Right 1124997178 15:34735230-34735252 GAGACTAGGGTGAATGTCACTGG No data
1124997170_1124997178 29 Left 1124997170 15:34735178-34735200 CCACCAGCATTAGTATTTTACCA No data
Right 1124997178 15:34735230-34735252 GAGACTAGGGTGAATGTCACTGG No data
1124997171_1124997178 26 Left 1124997171 15:34735181-34735203 CCAGCATTAGTATTTTACCACAC No data
Right 1124997178 15:34735230-34735252 GAGACTAGGGTGAATGTCACTGG No data
1124997172_1124997178 9 Left 1124997172 15:34735198-34735220 CCACACCTCTCTTCTTCCTCAGA No data
Right 1124997178 15:34735230-34735252 GAGACTAGGGTGAATGTCACTGG No data
1124997175_1124997178 -7 Left 1124997175 15:34735214-34735236 CCTCAGAAAGCTTTTGGAGACTA No data
Right 1124997178 15:34735230-34735252 GAGACTAGGGTGAATGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124997178 Original CRISPR GAGACTAGGGTGAATGTCAC TGG Intergenic
No off target data available for this crispr